JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on June 23, 2005; DOI: 10.1124/jpet.105.086041


0022-3565/05/3151-155-162$20.00
JPET 315:155-162, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.105.086041v1
315/1/155    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teixeira, C. E.
Right arrow Articles by Webb, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Teixeira, C. E.
Right arrow Articles by Webb, R. C.

CELLULAR AND MOLECULAR

Proerectile Effects of the Rho-Kinase Inhibitor (S)-(+)-2-Methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]homopiperazine (H-1152) in the Rat Penis

Cleber E. Teixeira, Zhekang Ying, and R. Clinton Webb

Department of Physiology, Medical College of Georgia, Augusta, Georgia

Received March 8, 2005; accepted June 14, 2005.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The Rho-kinase pathway mediates Ca2+ sensitization in the penile circulation, which maintains the penis in the flaccid state. We aimed to investigate the functional effect of a novel Rho-kinase inhibitor, H-1152 [(S)-(+)-2-methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]homopiperazine], both in vitro and in vivo as well as to demonstrate the expression of Rho guanine nucleotide exchange factors (RhoGEFs) in the rat corpus cavernosum (CC), by using a semiquantitative reverse transcription-polymerase chain reaction assay to measure their mRNA expression. Cumulative addition of H-1152 (0.001–3 µM) or Y-27632 [0.01–30 µM; (R)-(+)-trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide] caused sustained relaxations of precontracted CC strips, which were not affected by inhibition of the nitric oxide signaling pathway. Addition of H-1152 (0.1 µM), Y-27632 (1 µM), or sodium nitroprusside (SNP; 0.1 µM) caused rightward shifts in the curves to phenylephrine (PE), but it had little effect on the contractions mediated by electrical field stimulation (EFS). It is noteworthy that when H-1152 or Y-27632 was combined with SNP, a marked synergistic inhibition was noted both on PE- and EFS-induced contractions. Intraperitoneal administration of H-1152 (100 nmol/kg) had a discrete effect on mean arterial pressure and significantly enhanced erectile responses evoked by stimulation of the cavernous nerve. The mRNA expression for PDZ-RhoGEF, p115RhoGEF, and leukemia-associated RhoGEF in cavernosal segments was visualized by electrophoresis on agarose gel. The results indicate that H-1152 is a powerful Rho-kinase inhibitor, giving rise to its therapeutic potential in the treatment of erectile dysfunction. The regulator of G-protein signaling-containing RhoGEFs may represent key components of the molecular mechanisms associated with the abnormal function of the cavernosal smooth muscle.


The contraction of the cavernosal smooth muscle has an important role in maintaining the penis in the flaccid state and is considered to be mediated by the release of several substances, such as noradrenaline, angiotensin II, prostanoids, and endothelin-1 (Andersson, 2001Go, 2003Go). The main contractile factor is thought to be noradrenaline released from sympathetic nerve endings, acting on postjunctional {alpha}1-adrenoceptors (Andersson, 2001Go, 2003Go). The mechanism of noradrenergic contraction is based on the activation of subcellular signaling systems that mobilize Ca2+ from extracellular and intracellular stores, resulting in an increased intracellular Ca2+ concentration ([Ca2+]i) (Himpens et al., 1995Go). The elevation of [Ca2+]i causes calmodulin-mediated activation of myosin light chain (MLC) kinase, MLC phosphorylation, and cross-bridge cycling, which results in contraction. On the other hand, a decrease in [Ca2+]i permits dephosphorylation of MLC by MLC phosphatase, thus, causing relaxation (Somlyo and Somlyo, 2003Go).

In addition, distinct regulatory mechanisms brought about by activation of heterotrimeric G protein-coupled receptors are known to elevate the degree of contractile force without further increases in [Ca2+]i, a process termed Ca2+ sensitization. One of these mechanisms involves RhoA, a small, monomeric G protein that activates Rho-kinase, which in turn phosphorylates the regulatory subunit of MLC phosphatase and leads to sensitization of myofilaments to Ca2+ (Riento and Ridley, 2003Go; Somlyo and Somlyo, 2003Go). Rho-kinase is expressed in human, rabbit, and rat cavernosal smooth muscle (Mills et al., 2001Go; Rees et al., 2002Go; Wang et al., 2002Go). Using an in vivo rat model, we have demonstrated that a Rho-kinase inhibitor, Y-27632, caused a dramatic increase in intracavernosal pressure by a mechanism independent of nitric oxide (NO), with minimal effects on systemic blood pressure (Chitaley et al., 2001Go). In addition, this inhibitor has been shown to antagonize noradrenergic contractions in human and rabbit penile tissue (Rees et al., 2002Go; Wang et al., 2002Go; Takahashi et al., 2003Go). These findings collectively indicate that the RhoA/Rho-kinase pathway is present and active in the resting (contracted) state of the corpus cavernosum.

A pivotal role for NO in the relaxation of the corpus cavernosum and vasculature is widely accepted (Andersson and Wagner, 1995Go). The endothelium and nerve fibers innervating the cavernosal tissue may be the source of NO, which is released after stimulation of neuronal and endothelial NO synthase (eNOS), respectively. Chitaley et al. (2001Go) have reported that cavernosal relaxations induced by Y-27632 were not affected by treatment with inhibitors of either NO synthase or soluble guanylyl cyclase. In contrast, recent studies reported that stimulation of the cGMP-dependent protein kinase leads to phosphorylation of RhoA and its inhibition. Therefore, inhibition of RhoA and its downstream target Rho-kinase by NO would contribute to the vasodilator action of NO (Sauzeau et al., 2000Go; Sandu et al., 2001Go; Chitaley and Webb, 2002Go).

Because cavernosal smooth muscle is kept contracted by basal noradrenergic activity in the detumescent state, we were interested in investigating the in vitro and in vivo effects of the novel Rho-kinase inhibitor H-1152 (Sasaki et al., 2002Go) in the penile tissue. Moreover, multiple mechanisms were recently described to link the Rho-kinase pathway and NO-generating system; therefore, we decided to reexamine the role of endogenous NO in the modulation of the mechanisms underlying Ca2+ sensitization in the corpus cavernosum. Furthermore, previous studies demonstrated that the regulator of G protein signaling (RGS) domain is responsible for the physical association with the G{alpha} subunit of GTPase and acts to regulate G protein-coupled receptor signaling (Ross and Wilkie, 2000Go; Sah et al., 2000Go; Schmidt and Hall, 2002Go). Therefore, to further explore the signal transduction pathway for the increases in Ca2+ sensitivity, we investigated the mRNA expression of the RGS-containing Rho guanine nucleotide exchange factors (RhoGEFs) in the corpus cavernosum.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals. Adult male Sprague-Dawley rats (250–300 g; Harlan, Indianapolis, IN) were used in these studies. All procedures were performed in accordance with the Guiding Principles in the Care and Use of Animals, approved by the Medical College of Georgia Committee on the Use of Animals in Research and Education. The animals were housed two per cage on a 12-h light/dark cycle and fed a standard chow diet with water ad libitum.

Drugs and Solutions. Krebs' solution of the following composition was used: 130 mM NaCl, 14.9 mM NaHCO3, 5.5 mM dextrose, 4.7 mM KCl, 1.18 mM KH2PO4, 1.17 mM MgSO4·7H2O, and 1.6 mM CaCl2·2H2O. Acetylcholine, bretylium tosylate, N{omega}-nitro-L-arginine methyl ester (L-NAME), 1H-[1,2,4]oxadiazolo [4,3,-a]quinoxalin-1-one (ODQ), phenylephrine, prazosin, sodium nitroprusside, and tetrodotoxin were purchased from Sigma Chemical Co. (St. Louis, MO). Pentobarbital sodium was obtained from the university pharmacy. H-1152 and Y-27632 were acquired from Calbiochem (San Diego, CA). TRIzol and superscript II kit were purchased from Invitrogen (Carlsbad, CA). All other reagents used were of analytical grade. Stock solutions were prepared in deionized water and stored in aliquots at –20°C; dilutions were made up immediately before use. ODQ was prepared in dimethyl sulfoxide. Solutions were stored at –20°C and further diluted in deionized water just before use.

Functional Studies in Cavernosal Strips. The animals were anesthetized with pentobarbital sodium (40 mg/kg i.p.), killed by decapitation, and exsanguinated. The penis was excised, transferred into ice-cold Krebs' solution, and surgically dissected to remove the tunica albuginea. One crural strip preparation (1 x 1 x 10 mm) was obtained from each corpus cavernosum. Cavernosal strips were mounted in 4-ml myograph chambers (Danish Myo Technology, Aarhus, Denmark) containing Krebs' solution at 37°C continuously bubbled with a mixture of 95% O2 and 5% CO2. The tissues were stretched to a resting force of 2 mN and allowed to equilibrate for 60 min. Changes in isometric force were recorded using a PowerLab/8SP data acquisition system (Chart software, version 5.0; ADInstruments, Colorado Springs, CO). To verify the contractile ability of the preparations, a high K+ solution (80 mM) was added to the organ baths at the end of the equilibration period. Cumulative concentration-response curves to H-1152 (0.001–3 µM) and Y-27632 (0.01–30 µM) were obtained in cavernosal strips contracted with phenylephrine (PE; 10 µM). Electrical field stimulation (EFS) was applied in muscles placed between platinum pin electrodes attached to a stimulus splitter unit (Stimu-Splitter II), which was connected to a Grass S88 stimulator (Astro-Med West Warwick, RI). EFS was conducted at 50 V, 1-ms pulse width and trains of stimuli lasting 10 s at varying frequencies (1–32 Hz).

Measurement of Intracavernosal Pressure. Rats were anesthetized with intramuscular ketamine (87 mg/kg) plus xylazine (13 mg/kg) and maintained on supplemental ketamine as needed. The right carotid artery was cannulated for continuous monitoring of mean arterial pressure (MAP), and a 30-gauge needle was inserted into the right corpus cavernosum to record intracavernosal pressure (ICP) simultaneously via Grass pressure transducers (Astro-Med). The abdominal cavity was opened, exposing the right cavernosal nerve at the dorsolateral aspect of the prostate. Stainless steel bipolar electrodes connected to a Grass SD9 stimulator (Astro-Med) were positioned on the cavernosal nerve. Electrical stimulation of the cavernous nerve (5-ms pulse width; 60 s; 5 V) at different frequencies (1, 2, 4, 8, and 16 Hz) was performed. All pressure data were collected for analysis using PowerLab/8SP data acquisition system.

Primer Design and RT-PCR. Rat homologues of PDZ-RhoGEF, LARG, and p115RhoGEF were identified by comparative genome analysis using publicly available rat, mouse, and human data. Primers were designed with Primer3 program based on the known mRNA sequences for each gene. To exclude the possible contamination of genomic DNA, care was taken to ensure that the two primers for one gene were located at different exons. The PDZ-RhoGEF primers were as follows: forward, 5'-GGGACCCTCTTCGAGAACGCCAAA-3'; and reverse, 5'-GGGCAGCCAC-TTGTCCTTGTCAGG-3'. LARG primers were forward, 5'-AGCCATG-CGCGCTGGAGTACAAAC-3'; and reverse, 5'-GCTCCAGGGGAATGAGGGGATGTC-3'. p115RhoGEF primers were forward, 5'-TCCGGACCAAGAGTGGGGACAAGA-3'; and reverse, 5'-TACCCAGGCTTCCCTTCCGGTCTG-3'. Glyceraldehyde-3-phosphate dehydrogenase primers were forward, TGCATCCTGCACCACCAACTGCTT; and reverse, ACAGCCTTGGCAGCACC-AGTGGAT.

Penile tissue was isolated, snap-frozen in liquid nitrogen, and stored at –80°C for subsequent analysis. Total RNA (4 µg/reaction) extracted from tissue segments with TRIzol reagent (Invitrogen) was used for the first-strand cDNA synthesis with superscript II kit (Invitrogen), according to manufacturer's specifications. cDNA equal to 0.04 µg of total RNA was used for each PCR reaction under the following conditions: 94°C for 2 min and 22 (for glyceraldehyde-3-phosphate dehydrogenase) or 30 (for RhoGEFs) cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s, followed by 72°C for 7 min. The reaction products were analyzed by electrophoresis on agarose gel and the expected product was extracted and verified by direct DNA sequencing. The gel images were recorded by videocamera (Sony Video Camera Module Charge-Coupled Device; Sony, Tokyo, Japan), connected to an IBM AT computer (IBM, White Plains, NY) with a 512 x 512-pixel array imaging board with 256 gray levels.

Statistical Analysis. Experimental values of relaxation were calculated relative to the maximal changes from the contraction produced by PE in each tissue, which was taken as 100%. Calculations were based on the number of experiments performed in each individual. In vivo erectile responses were expressed as the ratio of {Delta}ICP (mm Hg)/MAP (mm Hg) x 100, with {Delta}ICP, the difference between ICP in the flaccid state and ICP during the plateau phase of the erectile response and MAP, the mean arterial pressure during the plateau phase of the erectile response. During detumescence, the time (D20) and the rate ({Delta}D20) for ICP to decrease to 20% of maximal increase were determined (Mizusawa et al., 2001Go). Data are shown as the percentage of relaxation of n experiments, expressed as the mean ± S.E.M. Analysis of variance and Student's paired t test were used to evaluate the results. A p value less than 0.05 was considered to indicate significance. A program package was used for the statistical analysis of all data (Instat, ver. 3.0; GraphPad Software Inc., San Diego, CA).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Relaxing Activity of Rho-Kinase Inhibitors. The addition of PE (10 µM) to the bathing medium caused a submaximal contraction of rat cavernosal segments and generated active force of 9.3 ± 0.8 mN (n = 18), which consisted of a rapid rise in force followed by a slower rise to a sustained level within 10 min (Fig. 1). The cumulative addition of H-1152 (0.001–3 µM) and Y-27632 (0.01–30 µM) produced long-lasting and concentration-dependent relaxations in contracted tissues (Fig. 1), with pEC50 values of 7.04 ± 0.04 and 6.02 ± 0.07, respectively (p < 0.01; n = 9). Maximal responses elicited by these compounds were not statistically different (94 ± 2% for H-1152 and 90 ± 2% for Y-27632; Fig. 1).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Effects of the Rho-kinase inhibitors H-1152 and Y-27632 in cavernosal smooth muscle strips contracted with PE (10 µM). a, typical tracing showing the sustained and concentration-dependent relaxant response of H-1152 (0.001–3 µM). This is a representative tracing of nine experiments. b, experimental values of the relaxations induced by H-1152 (open symbols; n = 9) and Y-27632 (closed symbols; n = 9) were calculated relative to the maximal changes from the contraction produced by PE in each tissue, which was taken as 100%. Data represent the mean ± S.E.M. of n experiments.

 

Effect of L-NAME and ODQ on Relaxations Induced by H-1152 and Y-27632. Under our experimental conditions, the incubation of rat cavernosal strips with either L-NAME (100 µM), a nonselective inhibitor of NO synthase, or ODQ (10 µM), an inhibitor of soluble guanylyl cyclase, virtually abolished the endothelium-dependent relaxations mediated by acetylcholine (10 µM). It is interesting that acetylcholine relaxed precontracted rat corporeal tissue at the above-mentioned concentration by only 10 ± 2%, unlike in corpus cavernosum isolated from humans, rabbits, or mice, where this concentration has been shown to cause 40 to 70% relaxation. The addition of L-NAME (n = 5) or ODQ (n = 4) caused a discrete contractile effect (~5% increase) on the tone induced by PE (10 µM). As shown in Table 1, treatment of cavernosal strips with either L-NAME or ODQ did not significantly affect the relaxations evoked by H-1152 (0.001–3 µM) or Y-27632 (0.01–30 µM).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Effect of the NO synthesis inhibitor L-NAME (100 µM; n = 5) and of the soluble guanylyl cyclase inhibitor ODQ (10 µM; n = 4) on relaxations induced by the Rho-kinase inhibitors H-1152 (0.001-3 µM) and Y-27632 (0.01-30 µM) in rat corpus cavernosum

Experimental values of pEC50 were calculated relative to the maximal changes from the contraction produced by phenylephrine (10 µ M) and represented as – log of the molar concentration to produce 50% of the maximal relaxation elicited by H-1152 or Y-27632 in contracted tissues. Maximal response is calculated as the percentage of relaxation with respect to the level of contraction. Data represent the mean ± S.E.M. of n experiments.

 

Effect of Rho-Kinase Inhibition on PE- and EFS-Induced Contractions. Addition of PE (0.01–100 µM) to the bathing medium concentration dependently contracted the cavernosal smooth muscle strips with a pEC50 value of 6.27 ± 0.06 (n = 18), reaching a peak (166 ± 4% of KCl-induced contraction) at 30 µM. Addition of the Rho-kinase inhibitors H-1152 (0.1–1 µM) or Y-27632 (1–10 µM) significantly attenuated the contractions evoked by PE in a concentration-dependent manner. At their highest concentration, H-1152 and Y-27632 caused 9.7- and 11.5-fold rightward shifts in the curves to PE, respectively (n = 4; p < 0.01). The NO donor SNP (0.1–1 µM; n = 4) also inhibited the contractile activity evoked by PE in a concentration-dependent manner, culminating with a 6.7-fold shift to the right after treatment of the preparations with 1 µM SNP. As shown in Fig. 2, H-1152 (0.1 µM), Y-27632 (1 µM), and SNP (0.1 µM) caused similar rightward shifts in the curves to PE of 2.8-, 2.9- and 2.4-fold, respectively (n = 4). However, the coincubation of H-1152 (0.1 µM) or Y-27632 (1 µM) with SNP (0.1 µM) resulted in significantly higher shifts in the curves to PE, compared with their actions individually, as represented by the 9.9- (H-1152 plus SNP) and 7.5-fold (Y-27632 plus SNP) displacement to the right (Fig. 2; p < 0.01).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Effects of SNP (0.1 µM; n = 8) and the Rho-kinase inhibitors H-1152 (0.1 µM; n = 4) and Y-27632 (1 µM; n = 4) in the concentration-response curves elicited by PE (0.01–100 µM) in rat corpus cavernosum. After completion of a control curve to PE, the tissues were incubated in the presence of SNP (a and b), H-1152 (a), or Y-27632 (b) alone or in combination, and a second curve to PE was performed. Experimental values of contraction were calculated relative to the maximal changes produced by KCl (80 mM) in each tissue, which was taken as 100%. c, rightward shifts derived from PE-induced contractions represent fold displacement of the curves in the presence of Rho-kinase inhibitor (open columns), SNP (closed columns), or their combination (hatched columns), calculated as the anti-log of the difference between pEC50 values derived from control and experimental conditions. Data represent the mean ± S.E.M. of n experiments. *, p < 0.01 compared with Rho-kinase inhibitors or SNP alone.

 
In cavernosal smooth muscle strips under resting conditions, EFS (1–32 Hz) produced frequency-dependent contractions that were virtually abolished by the Na+ channel blocker tetrodotoxin (1 µM; n = 6) and by the {alpha}1-adrenergic antagonist prazosin (1 µM; n = 5). In addition, electrically induced contractions were fully blocked by the noradrenergic nerve blocking agent bretylium tosylate (30 µM; n = 6), confirming that these responses are neuronal in origin and adrenergic in nature. Addition of H-1152 (0.1–1 µM), Y-27632 (1–10 µM), or SNP (0.1–1 µM) caused concentration-dependent reductions of EFS-induced contractions, with maximal inhibitions at their highest concentration of 42 ± 4, 44 ± 3, and 16 ± 3%, respectively, when the strips were stimulated at 32 Hz (n = 4, each). As shown in Fig. 3, each agent had little effect on the contractile activity elicited by EFS over the full range of the frequency-response curve when their lowest concentration was used (H-1152, 0.1 µM; Y-27632, 1 µM; and SNP, 0.1 µM). However, the combination of either Rho-kinase inhibitor with SNP produced a significant inhibition of the electrically evoked contractions compared with the controls (Fig. 3; p < 0.01; n = 4).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3. Effects of SNP (0.1 µM; n = 8) and the Rho-kinase inhibitors H-1152 (0.1 µM; n = 4) and Y-27632 (1 µM; n = 4) in the frequency-response curves elicited by EFS (1–32 Hz) in rat corpus cavernosum. After completion of a control curve to EFS, the tissues were incubated in the presence of SNP (top and bottom), H-1152 (top), or Y-27632 (bottom) alone or in combination, and a second curve to EFS was performed. Experimental values of contraction were calculated relative to the maximal changes produced by KCl (80 mM) in each tissue, which was taken as 100%. Data represent the mean ± S.E.M. of n experiments. *, p < 0.01 compared with control values.

 
Effect of H-1152 on Penile ICP. ICP and MAP under resting conditions in anesthetized rats averaged 8 ± 2 and 116 ± 5 mm Hg, respectively (n = 8). Electrical stimulation of the cavernous nerve induced frequency-dependent (1–16 Hz) and sustained increases in ICP, accompanied by transient decreases in the MAP (n = 8). The ratio of ICP over MAP was used to provide an index of erectile activity that controls for changes in MAP. The highest frequency used (16 Hz) produced a mean ICP of 77 ± 4 mm Hg, which corresponded to a mean of 0.74 ± 0.05 ICP/MAP.

Intraperitoneal administration of H-1152 (100 nmol/kg; n = 4) did not considerably affect the ICP/MAP ratio in the absence of electrical stimulation of the cavernous nerve (0.07 ± 0.01 in control conditions, 0.08 ± 0.01 after 5 min, and 0.09 ± 0.01 after 15 min of H-1152 administration), despite a 12 ± 3% decrease in MAP. However, H-1152 significantly enhanced the responses evoked by electrical stimulation (Fig. 4). The enhancement by H-1152 was revealed both in the magnitude of the erectile responses as well as in the poststimulation period (Table 2). The potentiation of electrical stimulation-induced increases in ICP was also demonstrated by the measurement of the area under the curve (AUC) parameter in vehicle- and H-1152-treated animals. Indeed, AUC was increased by 42 ± 7% after 15 min of H-1152 administration (p < 0.01), whereas no significant change was noted in vehicle-treated animals (n = 4). As summarized in Table 2, administration of H-1152 caused an increase in the time (D20) and a decrease in the rate ({Delta}D20) for ICP to decrease to 20% of the peak response.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. Effect of the intraperitoneal administration of the Rho-kinase inhibitor H-1152 (100 nmol/kg; n = 4) in the in vivo erectile response. a, actual tracings showing the changes in the ICP and MAP in response to electrical stimulation of the cavernous nerve (1–16 Hz; 5 V) before and after administration of H-1152. b, after an initial ganglionic stimulation (control), H-1152 was injected and frequency-response curves were repeated at 5 and 15 min after drug administration. Results were calculated as the ratio ICP/MAP. Data represent the mean ± S.E.M. of n experiments. **, p < 0.01 and *, p < 0.05 compared with control values. B, baseline ICP.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2 Effect of the intraperitoneal administration of the Rho-kinase inhibitor H-1152 (100 nmol/kg; n = 4) or vehicle (saline 0.9%; n = 4) on ICP during cavernous nerve stimulation in vivo

AUC was expressed as millimeters of Hg per second and calculated during (ES) and after cessation of electrical stimulation (post-ES) of the cavernous nerve. The time (D20) and the rate ({Delta}D20) for ICP to decrease to 20% of peak ICP were calculated during detumescence. Data represent the mean ± S.E.M. of n experiments.

 

Expression of RGS-Containing RhoGEFs. An RT-PCR assay was used to measure the mRNA expression of the RGS-containing RhoGEFs in the rat corpus cavernosum, according to a methodology developed in our laboratory (Ying et al., 2004Go). Complimentary DNAs prepared by reverse transcription of total RNA extracted from rat celiac arteries coding for PDZ-RhoGEF, p115RhoGEF, and LARG were detectable. As a representative example, Fig. 5 demonstrates the electrophoretic visualization of the polymerase chain reaction products obtained from the amplification of cDNAs. In all samples, the fragments exhibiting the expected sizes were amplified without any contamination from nonspecific products (210 bp for PDZ-RhoGEF, 226 bp for p115RhoGEF, and 237 bp for LARG).



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 5. mRNA analysis of p115RhoGEF, PDZ-RhoGEF, and LARG in corpus cavernosum smooth muscle. Total RNA was isolated from crude homogenates of cavernosal strips and expression of RGS-containing RhoGEFs mRNA was analyzed by semiquantitative RT-PCR, as described under Materials and Methods. The electrophoretic visualization of the amplicons represent six sets of separate experiments.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
One of the main purposes of the present study was to elucidate the role of the Rho-kinase pathway in mediating cavernosal smooth muscle contraction and its regulation by endothelium-derived NO. Both in vitro (Chitaley et al., 2001Go; Rees et al., 2002Go; Wang et al., 2002Go; Takahashi et al., 2003Go) and in vivo (Chitaley et al., 2001Go) studies of erectile function have shown that the RhoA/Rho-kinase signaling pathway is implicated in the regulation of cavernosal smooth muscle tone because of the inhibition of MLC phosphatase activity, resulting in increased MLC phosphorylation and force in the penile tissue. First, we compared the relaxant responses of two Rho-kinase inhibitors, H-1152 and Y-27632, in the isolated rat corpus cavernosum, by applying either compound to strips precontracted with the {alpha}1-agonist phenylephrine. The contractions were concentration dependently inhibited by H-1152 and Y-27632, indicating that the Rho-kinase pathway is involved in the adrenergic contraction of the cavernosal tissue, supporting previous studies (Chitaley et al., 2001Go; Rees et al., 2002Go; Wang et al., 2002Go; Takahashi et al., 2003Go). The tonic force produced by phenylephrine in rat corpus cavernosum was more sensitive to H-1152 than Y-27632, because the former compound was approximately 10 times more potent than the later, rendering H-1152 as a more effective inhibitor of Rho-kinase.

Previous studies demonstrated that in vascular smooth muscle RhoA activation is accompanied by the membrane translocation of GTP-bound RhoA (Fujihara et al., 1997Go; Seasholtz et al., 1999Go; Gong et al., 2001Go). On the other hand, the NO signaling pathway exerts an inhibitory action on RhoA function via cGMP-dependent protein kinases, which phosphorylate RhoA, thus inhibiting its translocation to the membrane (Gohla et al., 2000Go; Sauzeau et al., 2000Go; Sandu et al., 2001Go; Sawada et al., 2001Go; Chitaley and Webb, 2002Go). In rat cavernosal strips, we found that neither L-NAME nor ODQ affected the relaxant responses evoked by H-1152 or Y-27632, corroborating previous observations that inhibition of NOS or soluble guanylyl cyclase does not influence relaxations mediated by Rho-kinase inhibitors (Chitaley et al., 2001Go). Nevertheless, although pharmacological inhibition of the NO/cGMP pathway failed to affect both H-1152- and Y-27632-evoked relaxations, the lines of evidence presented in this study suggest that attenuation of RhoA/Rho-kinase signaling in rat cavernosal smooth muscle represents part of the NO-induced inhibitory effects on contractile activity, as evidenced previously in vascular smooth muscle. First, relaxations evoked by acetylcholine at a concentration that markedly relaxes both human and rabbit cavernosal preparations (10 µM), caused only a small relaxant response in precontracted rat corporeal tissue, in agreement with previous studies (Hedlund et al., 1999Go; Claudino et al., 2004Go). Second, addition of either L-NAME or ODQ had little effect on the tone of the preparations, whereas these inhibitors have been shown to induce marked contractions in the corpus cavernosum from other species (Teixeira et al., 2004aGo,bGo). Although a positive NADPH diaphorase has been described in some parts of the sinusoidal endothelium of the rat penis (Keast, 1992Go), this has not been found in later investigations (Schirar et al., 1994Go; Dail et al., 1995Go; Hedlund et al., 1999Go). Bivalacqua et al. (2004Go) have demonstrated that the RhoA/Rho-kinase pathway down-regulates rat penile eNOS in diabetes and that inhibition of Rho-kinase led to a restoration of the erectile function, which was accompanied by an improvement of eNOS expression. Based on these observations, one could argue in favor of endothelium-derived NO as a key mediator of erectile function. Nevertheless, the erectile process is initiated by stimulation of NO release from nitrergic nerves, with a subsequent dilation of the penile arteries to permit an increase in blood flow to the penis (Andersson and Wagner, 1995Go). In response to stretch and possibly shear stress, the sinusoidal endothelium may release NO to help maintain the erectile state. In this previous study (Bivalacqua et al., 2004Go), the functional data presented were obtained in the intact animal by measuring intracavernosal pressure, thus representing an action of nerve-derived NO on the arteries and the sinuses (stretch). The authors did not test the responsiveness to acetylcholine in the isolated cavernosal tissue; therefore, a confusing issue remains with regard to the physiological basis for erection and the means to establish this basis experimentally. Together, our present observations as well as the previous studies aforementioned (Schirar et al., 1994Go; Dail et al., 1995Go; Hedlund et al., 1999Go; Claudino et al., 2004Go; Teixeira et al., 2004aGo,bGo) rule out a significant role for endothelium-derived NO in the erectile responses of rat corpus cavernosum, thus explaining the poor acetylcholine-evoked relaxations as well as the lack of effect of L-NAME and ODQ to increase tone and to inhibit the relaxant responses induced by Rho-kinase inhibitors.

To investigate the nature of the interaction between NO and Rho-kinase inhibitors in erectile tissue, we applied H-1152, Y-27632, or SNP to rat corpus cavernosum stimulated with phenylephrine or EFS, because contraction of the cavernosal smooth muscle is maintained by noradrenaline released from noradrenergic nerves of the penis as a result of {alpha}1-adrenoceptor activation (Cellek, 2000Go; Andersson, 2001Go; Moreland et al., 2001Go). Whereas either compound alone elicited a 3-fold rightward shift in the concentration-response curves to phenylephrine, coapplication of H-1152 plus SNP or Y-27632 plus SNP led to a synergistic inhibition of phenylephrine-induced contractions. Likewise, at concentrations that did not affect the transient contractions elicited by EFS, treatment of cavernosal strips with a combination of H-1152/Y-27632 with SNP caused significant attenuations of electrically induced contractions. These data indicate that increased NO and decreased Rho-kinase activity synergize to induce cavernosal smooth muscle relaxation in vitro (this study) as well as penile erection in vivo (Mills et al., 2002Go).

Previous studies from this laboratory suggest that vasoconstriction in the penile circulation may be regulated, in part, by the RhoA/Rho-kinase Ca2+ sensitization pathway (Chitaley et al., 2001Go; Mills et al., 2001Go). Indeed, injection of Y-27632 in the cavernous sinuses causes dose-dependent increases in intracavernous pressure, supporting a role for Rho-kinase in the maintenance of penile flaccidity (Chitaley et al., 2001Go). In the present investigation, we have evaluated the in vivo effects of H-1152 in the erectile responses evoked by stimulation of the cavernous nerve. The results presented herein demonstrate the relationship among electrical stimulation of the cavernous nerve, intracavernous pressure and mean arterial pressure, with measurements made before and after administration of H-1152. Most interesting is the demonstration that intraperitoneal injection of H-1152 significantly enhances both the magnitude and the duration of the erectile responses. Thus, these results confirm that the Rho-kinase pathway plays an important role in the maintenance of the vasoconstrictive state of the cavernosal vasculature.

The activity of Rho itself is regulated by distinct groups of proteins, such as RhoGEFs, which facilitate the activation of Rho by promoting the dissociation of GDP and subsequent binding of GTP (Ross and Wilkie, 2000Go; Sah et al., 2000Go; Schmidt and Hall, 2002Go). A group of RhoGEFs has recently been identified and characterized by a moiety resembling a regulator of RGS domain that binds the activated {alpha} subunit of GTPase. This group of RhoGEF proteins currently comprises three members: LARG, p115RhoGEF, and PDZ-RhoGEF (Ross and Wilkie, 2000Go; Schmidt and Hall, 2002Go; Somlyo and Somlyo, 2003Go). Although p115RhoGEF is found predominantly in hematopoietic cells (Girkontaite et al., 2001Go), PDZ-RhoGEF and LARG seem to be more widely expressed (Fukuhara et al., 1999Go, 2000Go; Kourlas et al., 2000Go). We have developed a method for semiquantification of mRNA expression of the RGS domain-containing RhoGEFs in biological samples (Ying et al., 2004Go). To our knowledge, this is the first study that demonstrates the presence of RGS domain-containing RhoGEFs in corpus cavernosum, suggesting their potential role in the regulation of cavernosal smooth muscle tone.

In conclusion, our results showed that the compound H-1152 can completely and more potently reverse the Ca2+ sensitization process in the cavernosal tissue, both in vitro and in vivo. On this basis, Rho-kinase antagonism represents another potential line of therapy in the treatment of erectile dysfunction, especially in cases where either noradrenergic tone is elevated or nitrergic/endothelial-dependent responses are blunted. Most importantly, the design and synthesis of selective inhibitors of RGS domain-containing RhoGEFs should provide the framework for defining new physiological roles for these factors, not to mention the possibility of identifying novel agents to treat erectile disorders.


    Footnotes
 
This study was supported by National Institutes of Health Grants HL71138 and HL74167. C.E.T. is funded by a postdoctoral fellowship (0425437B) from the American Heart Association (Southeast Affiliate).

doi:10.1124/jpet.105.086041.

ABBREVIATIONS: MLC, myosin light chain; Y-27632, (R)-(+)-trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide; SNP, sodium nitroprusside; NO, nitric oxide; eNOS, endothelial nitric-oxide synthase; H-1152, (S)-(+)-2-methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]homopiperazine; RGS, regulator of G-protein signaling; RhoGEF, Rho guanine nucleotide exchange factor; L-NAME, N{omega}-nitro-L-arginine methyl ester; ODQ, 1H-[1,2,4]oxadiazolo[4,3,-a]quinoxalin-1-one; PE, phenylephrine; EFS, electrical field stimulation; MAP, mean arterial pressure; ICP, intracavernosal pressure; RT-PCR, reverse transcription-polymerase chain reaction; LARG, leukemia-associated Rho guanine nucleotide exchange factor; D, detumescence; AUC, area under the curve; ACh, acetylcholine; CC, corpus cavernosum; GPCR, G-protein-coupled receptors; bp, base pair(s).

Address correspondence to: Dr. Cleber E. Teixeira, Department of Physiology, Medical College of Georgia, 1120 15th St., CA-3101, Augusta, GA 30912-3000. E-mail: cteixeira{at}mail.mcg.edu


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Andersson KE (2001) Pharmacology of penile erection. Pharmacol Rev 53: 417–450.[Abstract/Free Full Text]

Andersson KE (2003) Erectile physiological and pathophysiological pathways involved in erectile dysfunction. J Urol 170: S6–S13.[Medline]

Andersson KE and Wagner G (1995) Physiology of penile erection. Physiol Rev 75: 191–236.[Free Full Text]

Bivalacqua TJ, Champion HC, Usta MF, Cellek S, Chitaley K, Webb RC, Lewis RL, Mills TM, Hellstrom WJ, and Kadowitz PJ (2004) RhoA/Rho-kinase suppresses endothelial nitric oxide synthase in the penis: a mechanism for diabetes-associated erectile dysfunction. Proc Natl Acad Sci USA 101: 9121–9126.[Abstract/Free Full Text]

Cellek S (2000) Nitrergic-noradrenergic interaction in penile erection: a new insight into erectile dysfunction. Drugs Today 36: 135–146.

Chitaley K and Webb RC (2002) Nitric oxide induces dilation of rat aorta via inhibition of rho-kinase signaling. Hypertension 39: 438–442.[Abstract/Free Full Text]

Chitaley K, Wingard CJ, Webb RC, Branam H, Stopper VS, Lewis RW, and Mills TM (2001) Antagonism of Rho-kinase stimulates rat penile erection via a nitric oxide-independent pathway. Nat Med 7: 119–122.[CrossRef][Medline]

Claudino MA, Priviero FB, Teixeira CE, de Nucci G, Antunes E, and Zanesco A (2004) Improvement in relaxation response in corpus cavernosum from trained rats. Urology 63: 1004–1008.[CrossRef][Medline]

Dail WG, Barba V, Leyba L, and Galindo R (1995) Neural and endothelial nitric oxide synthase activity in rat penile erectile tissue. Cell Tissue Res 282: 109–116.[Medline]

Fujihara H, Walker LA, Gong MC, Lemichez E, Boquet P, Somlyo AV, and Somlyo AP (1997) Inhibition of RhoA translocation and calcium sensitization by in vivo ADP-ribosylation with the chimeric toxin DC3B. Mol Biol Cell 8: 2437–2447.[Abstract/Free Full Text]

Fukuhara S, Chikumi H, and Gutkind JS (2000) Leukemia-associated Rho guanine nucleotide exchange factor (LARG) links heterotrimeric G12 proteins of the G family to Rho. FEBS Lett 485: 183–188.[CrossRef][Medline]

Fukuhara S, Murga C, Zohar M, Igishi T, and Gutkind JS (1999) A novel PDZ domain containing guanine nucleotide exchange factor links heterotrimeric G proteins to Rho. J Biol Chem 274: 5868–5879.[Abstract/Free Full Text]

Girkontaite I, Missy K, Sakk V, Harenberg A, Tedford K, Potzel T, Pfeffer K, and Fischer KD (2001) Lsc is required for marginal zone B cells, regulation of lymphocyte motility and immune responses. Nat Immunol 2: 855–862.[CrossRef][Medline]

Gohla A, Schultz G, and Offermanns S (2000) Role for G12/13 in agonist-induced vascular smooth muscle cell contraction. Circ Res 87: 221–227.[Abstract/Free Full Text]

Gong MC, Gorenne I, Read P, Jia T, Nakamoto RK, Somlyo AV, and Somlyo AP (2001) Regulation by GDI of RhoA/Rho-kinase-induced Ca2+ sensitization of smooth muscle myosin II. Am J Physiol 281: C257–C269.

Hedlund P, Alm P, and Andersson KE (1999) NO synthase in cholinergic nerves and NO-induced relaxation in the rat isolated corpus cavernosum. Br J Pharmacol 127: 349–360.[CrossRef][Medline]

Himpens B, Missiaen L, and Casteels R (1995) Ca2+ homeostasis in vascular smooth muscle. J Vasc Res 32: 207–219.[Medline]

Keast JR (1992) A possible neural source of nitric oxide in the rat penis. Neurosci Lett 143: 69–73.[CrossRef][Medline]

Kourlas PJ, Strout MP, Becknell B, Veronese ML, Croce CM, Theil KS, Krahe R, Ruutu T, Knuutila S, Bloomfield CD, et al. (2000) Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia. Proc Natl Acad Sci USA 97: 2145–2150.[Abstract/Free Full Text]

Mills TM, Chitaley K, Lewis RW, and Webb RC (2002) Nitric oxide inhibits RhoA/Rho-kinase signaling to cause penile erection. Eur J Pharmacol 439: 173–174.[CrossRef][Medline]

Mills TM, Chitaley K, Wingard CJ, Lewis RW, and Webb RC (2001) Effect of Rho-kinase inhibition on vasoconstriction in the penile circulation. J Appl Physiol 91: 1269–1273.[Abstract/Free Full Text]

Mizusawa H, Hedlund P, Hakansson A, Alm P, and Andersson KE (2001) Morphological and functional in vitro and in vivo characterization of the mouse corpus cavernosum. Br J Pharmacol 132: 1333–1341.[CrossRef][Medline]

Moreland RB, Hsieh G, Nakane M, and Brioni JD (2001) The biochemical and neurologic basis for the treatment of male erectile dysfunction. J Pharmacol Exp Ther 296: 225–234.[Free Full Text]

Rees RW, Ziessen T, Ralph DJ, Kell P, Moncada S, and Cellek S (2002) Human and rabbit cavernosal smooth muscle cells express Rho-kinase. Int J Impot Res 14: 1–7.[CrossRef][Medline]

Riento K and Ridley AJ (2003) Rocks: multifunctional kinases in cell behaviour. Nat Rev Mol Cell Biol 4: 446–456.[CrossRef][Medline]

Ross EM and Wilkie TM (2000) GTPase-activating proteins for heterotrimeric G proteins: regulators of G protein signaling (RGS) and RGS-like proteins. Annu Rev Biochem 69: 795–827.[CrossRef][Medline]

Sah VP, Seasholtz TM, Sagi SA, and Brown JH (2000) The role of Rho in G protein-coupled receptor signal transduction. Annu Rev Pharmacol Toxicol 40: 459–489.[CrossRef][Medline]

Sandu OA, Ito M, and Begum N (2001) Selected contribution: insulin utilizes NO/cGMP pathway to activate myosin phosphatase via Rho inhibition in vascular smooth muscle. J Appl Physiol 91: 1475–1482.[Abstract/Free Full Text]

Sasaki Y, Suzuki M, and Hidaka H (2002) The novel and specific Rho-kinase inhibitor (S)-(+)-2-methyl-1-[(4-methyl-5-isoquinoline)sulfonyl]-homopiperazine as a probing molecule for Rho-kinase-involved pathway. Pharmacol Ther 93: 225–232.[CrossRef][Medline]

Sauzeau V, Le Jeune H, Cario-Toumaniantz C, Smolenski A, Lohmann SM, Bertoglio J, Chardin P, Pacaud P, and Loirand G (2000) Cyclic GMP-dependent protein kinase signaling pathway inhibits RhoA-induced Ca2+ sensitization of contraction in vascular smooth muscle. J Biol Chem 275: 21722–21729.[Abstract/Free Full Text]

Sawada N, Itoh H, Yamashita J, Doi K, Inoue M, Masatsugu K, Fukunaga Y, Sakaguchi S, Sone M, Yamahara K, et al. (2001) cGMP-dependent protein kinase phosphorylates and inactivates RhoA. Biochem Biophys Res Commun 280: 798–805.[CrossRef][Medline]

Schirar A, Giuliano F, Rampin O, and Rousseau JP (1994) A large proportion of pelvic neurons innervating the corpora cavernosa of the rat penis exhibit NADPH-diaphorase activity. Cell Tissue Res 278: 517–525.[Medline]

Schmidt A and Hall A (2002) Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev 16: 1587–1609.[Free Full Text]

Seasholtz TM, Majumdar M, and Brown JH (1999) Rho as a mediator of G protein-coupled receptor signaling. Mol Pharmacol 55: 949–956.[Free Full Text]

Somlyo AP and Somlyo AV (2003) Ca2+ sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases and myosin phosphatase. Physiol Rev 83: 1325–1358.[Abstract/Free Full Text]

Takahashi R, Nishimura J, Hirano K, Naito S, and Kanaide H (2003) Modulation of Ca2+ sensitivity regulates contractility of rabbit corpus cavernosum smooth muscle. J Urol 169: 2412–2416.[CrossRef][Medline]

Teixeira CE, Baracat JS, Zanesco A, Antunes E, and De Nucci G (2004a) Atypical {beta}-adrenoceptor subtypes mediate relaxations of rabbit corpus cavernosum. J Pharmacol Exp Ther 309: 587–593.[Abstract/Free Full Text]

Teixeira CE, de Oliveira JF, Baracat JS, Priviero FB, Okuyama CE, Rodrigues Netto N Jr, Fregonesi A, Antunes E, and De Nucci G (2004b) Nitric oxide release from human corpus cavernosum induced by a purified scorpion toxin. Urology 63: 184–189.[CrossRef][Medline]

Wang H, Eto M, Steers WD, Somlyo AP, and Somlyo AV (2002) RhoA-mediated Ca2+ sensitization in erectile function. J Biol Chem 277: 30614–30621.[Abstract/Free Full Text]

Ying Z, Jin L, Dorrance AM, and Webb RC (2004) Increased expression of mRNA for regulator of G protein signaling domain-containing Rho guanine nucleotide exchange factors in aorta from stroke-prone spontaneously hypertensive rats. Am J Hypertens 17: 981–985.[CrossRef][Medline]


This article has been cited by other articles:


Home page
J Biomol ScreenHome page
C. R. Evelyn, T. Ferng, R. J. Rojas, M. J. Larsen, J. Sondek, and R. R. Neubig
High-Throughput Screening for Small-Molecule Inhibitors of LARG-Stimulated RhoA Nucleotide Binding via a Novel Fluorescence Polarization Assay
J Biomol Screen, February 1, 2009; 14(2): 161 - 172.
[Abstract] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Rattan and C. A. Patel
Selectivity of ROCK inhibitors in the spontaneously tonic smooth muscle
Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G687 - G693.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. C. Tostes, F. R. C. Giachini, F. S. Carneiro, R. Leite, E. W. Inscho, and R. C. Webb
Determination of Adenosine Effects and Adenosine Receptors in Murine Corpus Cavernosum
J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 678 - 685.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Lin, G. P. Craig, L. Zhang, V. G. Yuen, M. Allard, J. H. McNeill, and K. M. MacLeod
Acute inhibition of Rho-kinase improves cardiac contractile function in streptozotocin-diabetic rats
Cardiovasc Res, July 1, 2007; 75(1): 51 - 58.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. E. Linder, R. Leite, K. Lauria, T. M. Mills, and R. C. Webb
Penile erection requires association of soluble guanylyl cyclase with endothelial caveolin-1 in rat corpus cavernosum
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2006; 290(5): R1302 - R1308.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
B. Musicki and A. L. Burnett
eNOS Function and Dysfunction in the Penis
Experimental Biology and Medicine, February 1, 2006; 231(2): 154 - 165.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.105.086041v1
315/1/155    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teixeira, C. E.
Right arrow Articles by Webb, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Teixeira, C. E.
Right arrow Articles by Webb, R. C.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition