TABLE 1

Nucleotide sequences of the primers used in quantitative PCR




Forward Primer

Reverse Primer

Gene Bank Accession No.
HPRT GCTTTCCCTGGTTAAGCAGTACA CAAACTTGTCTGGAATTTCAAATC J00423
Bcrp AAATGGAGCACCTCAACCTG CCCATCACAACGTCATCTTG NM_011920
Mdrla TCATTGCGATAGCTGGAGTG CAAACTTCTGCTCCCGAGTC NM_011076
Mrp1 AGGCTGGAGCTAAGGAGGAG CAGCCATGGAGTAGCCAAAT NM_008576
Mrp4 GGTTGGAATTGTGGGCAGAA TCGTCCGTGTGCTCATTGAA XM_139262
Oatp2
ATAGCTTCAGGCGCATTTAC
TTCTCCATCATTCTGCATCG
NM_030687