TABLE 1

Sequence and conditions of oligos used for PCR amplification and EMSA


Primer Name

Sequence (5′-3′)

Conditions
Oligos for amplifying the cDNA
CAR-F1 GGAGAGGCATTCCATACCAG 94°C × 30 s, 58°C × 30 s, 72°C × 90 s, 32 cycles
CAR-R1 TTCCCACTCCAGTGTATCCAG
CAR-F2 CAGGTGACATGCTGCCTAAG 94°C × 30 s, 57.3°C × 30 s, 72°C × 90 s, 15 cycles
CAR-R2 TATCCAGGGTGTTCCAGGTG
CAR-Taq-F CCAGCTCATCTGTTCATCCA 94°C × 30 s, 57°C × 30 s, 72°C × 30 s, 30 cycles
CAR-Taq-R GGTAACTCCAGGTCGGTCAG
CYP2B6-F CACTCATCAGCTCTGTATTCG 94°C × 30 s, 57°C × 30 s, 72°C × 30 s, 30 cycles
CYP2B6-R GTAGACTCTCTCTGCAACATGAG
MRP4-F GCAAGATGCTGCCCGTGTAC 94°C × 30 s, 60°C × 30 s, 72°C × 30 s, 30 cycles
MRP4-R ACCCTTGCAACTCCTCTCCAAG
Oligos for EMSA
CYP2B6-NR1 GATCCTGTACTTTCCTGACCCTGAGATC
CYP2B6-NR2 GATCCATGGACTTTCCTGAACCAAGATC
Oligos used for creating ATG mutants
CAR-ATG-exon1-220-F GTGGCCTGCAGGTGACTTGCTGCCTAAGAGAAGC* 95°C × 30 s, 55°C × 30 s, 68°C × 12 min, 12 cycles
CAR-ATG-exon-220-R GCTTCTCTTAGGCAGCAAGTCACCTGCAGGCCAC*
CAR-ATG-exon4-645-F CCCACACCCGCCACTTGGGCACCATGTTT* 95°C × 30 s, 55°C × 30 s, 68°C × 12 min, 12 cycles
CAR-ATG-exon4-645-R AAACATGGTGCCCAAGTGGCGGGTGTGGG*
CAR-ATG-exon-654-F GCCACATGGGCACCTTGTTTGAACAGTTTGTG* 95°C × 30 s, 55°C × 30 s, 68°C × 12 min, 12 cycles
CAR-ATG-exon-654-R CACAAACTGTTCAAACAAGGTGCCCATGTGGC*
Primers used to amplify the cDNA from hepatocytes
CYP3A4-F CCAAGCTATGCTCTTCACCG 95°C × 30 s, 50°C × 30 s, 72°C × 30 s, 28 cycles
CYP3A4-R TCAGGCTCCACTTACGGTGC
CYP2B6-F TCCTTTCTGAGGTTCCGAGA 95°C × 30 s, 58°C × 30 s, 72°C × 30 s, 35 cycles
CYP2B6-R TCCCGAAGTCCCTCATAGTG
PXR-F CAAGCGGAAGAAAAGTGAACG 95°C × 30 s, 60°C × 30 s, 72°C × 30 s, 28 cycles
PXR-R CTGGTCCTCGATGGGCAAGTC
GAPDH-F ACCACAGTCCATGCCATCAC 95°C × 30 s, 60°C × 30 s, 72°C × 30 s, 25 cycles
GAPDH-R
TCCACCACCCTGTTGCTGTA

  • * Bolded nucleotide indicates the base mutated to change ATG to TTG.