TABLE 1

Oligonucleotides used for CYP2B6 amplification and sequencing


Fragment

Primer

Sequence 5′-3′

Length

Product Size
bp
Exon 1 CYP2B6_E1f1 GGGATAGGCATCAGGTCACTGG 22 431
CYP2B6_E1r1 TTCCCCAAGTACCAAGGCAAGA 22
Exon 2 CYP2B6_E2f1 GCTTTACTGGCCCAACCAGA 20 518
CYP2B6_E2r1 GGAGGTGTGGGTTGGTTGTA 20
Exon 3 CYP2B6_E3f1 GGTGCATCAGGGAAGGGAGTAT 22 450
CYP2B6_E3r1 TCTGTGTTTCTCTCCTGCCCATC 23
Exon 4 CYP2B6_E4f CTCGGTCTGCCCATCTATAAAC 22 520
CYP2B6_E4r CATGTCTGCGTTTCTTCCAAGG 22
Exon 5 CYP2B6_E5f CTCTCTCCCTGTGACCTGCTA 21 496
CYP2B6_E5r CTCCCTCTGTCTTTCATTCTGTC 23
Exon 6 CYP2B6_E6f1 GCGGTTGGATGTGTAGAGGACA 22 440
CYP2B6_E6r1 TGGTTGGAATCTAGCCCAGAGC 22
Exon 7 CYP2B6_E7f CCACCCACCTCAACCTCCAA 20 443
CYP2B6_E7r TCCAACCCTCCACACACTCC 20
Exon 8 CYP2B6_E8f TGGAGTGTGTGGAGGGTTGG 20 493
CYP2B6_E8r TACAGTGGTGCCCAACAGAT 20
Exon 9 CYP2B6_E9f TCTGGTTTCAGAGCAGCTTCC 21 510
CYP2B6_E9r CTTGCAATGTGACCTCAGAC 20
Exon 1-9 CYP2B6_cFE1 ATGGAACTCAGCGTCCTCCTCTTC 21 1476
CYP2B6_cRE9 TCAGCGGGGCAGGAAGCGGATCTG 24
CYP2B6_cF1 Bam GCGGATCCATGGAACTCAGCGTCC 24 1493
CYP2B6_cR9 Xba GCTCTAGACTCAGCGGGGCAGGAAG 25
Exon 1-4 CYP2B6_cF1 Bam GCGGATCCATGGAACTCAGCGTCC 24 635

CYP2B6_cRE4
GATGAGTGAAAAAGTCTGGT
20