Table 1

List of oligonucleotide probes generated for analysis of Oat expression by bDNA signal amplification

Target Sequence1-aFunction1-bProbe Sequence
Oat1 (accession no.-AB004559)
 657–675CE ggaaagcccgatgagagcaTTTTTctcttggaaagaaagt
 735–752CE cagcctgtccgccaggtaTTTTTctcttggaaagaaagt
 971–988CE gccaggaggaactggcccTTTTTctcttggaaagaaagt
 1117–1135CE gctcggagggtgaggtccaTTTTTctcttggaaagaaagt
 1154–1177CE ccttcttcttgtttcccattgatcTTTTTctcttggaaagaaagt
 1179–1203CE ggagcacctctatacttagcttagcTTTTTctcttggaaagaaagt
 1245–1263CE gcagctccatggctgaggcTTTTTctcttggaaagaaagt
 716–734LE gccaaacaccatggctcccTTTTTaggcataggacccgtgtct
 769–792LE ctgtctgcaggtagttcaagatcaTTTTTaggcataggacccgtgtct
 793–812LE tgcacaggttcccgacacagTTTTTaggcataggacccgtgtct
 902–924LE ggataggcatccattccacatttTTTTTaggcataggacccgtgtct
 926–943LE cccacataggcacgggtgTTTTTaggcataggacccgtgtct
 947–969LE ggctgtagacatagccaatcaagTTTTTaggcataggacccgtgtct
 990–1008LE gcacagcataggcgatgccTTTTTaggcataggacccgtgtct
 1223–1244LE ttggcctttgcttagagtcagtTTTTTaggcataggacccgtgtct
 677–693BL gggactgggccagctgg
 694–714BL gcagcactcccaccatgtaca
 754–768BL gcaccttccggcggc
 813–836BL gacagtatagttgggtgcataggc
 837–855BL ggagccggaaaacgcagta
 858–876BL tagccaaagacatgcccga
 879–901BL agtgtcatgcagttgattgcaat
 1010–1026BL gcaggtggcgccagtgg
 1027–1048BL aaaggcacagagaccacaagct
 1049–1072BL caagagtagatgaaggcaatgaaa
 1073–1093BL cgggctgactcaatgaagaac
 1095–1116BL gccttcctgaggaggagtacca
 1136–1153BL cgggccactctctgcagg
 1204–1222BL tccttctgcaggctggtcc
Oat2 (accession no.-L27651)
 798–815CE ccagtgccagcagcagcaTTTTTctcttggaaagaaagt
 872–891CE atgctgatgatgcctgggacTTTTTctcttggaaagaaagt
 976–991CE gggccgcccattgagcTTTTTctcttggaaagaaagt
 1011–1028CE tgttcagggcctcctggcTTTTTctcttggaaagaaagt
 1070–1092CE tgagatgttcggaacaggtctaaTTTTTctcttggaaagaaagt
 816–834LE ctccggatcaggtagcccaTTTTTaggcataggacccgtgtct
 855–871LE acacggcagggtggcagTTTTTaggcataggacccgtgtct
 892–912LE gcagactcaggaacccaccagTTTTTaggcataggacccgtgtct
 933–952LE ttttgcctcctccacacgacTTTTTaggcataggacccgtgtct
 956–974LE caggctgccctcacccacTTTTTaggcataggacccgtgtct
 992–1009LE caggctgccctcacccacTTTTTaggcataggacccgtgtct
 1030–1048LE cctttccatggtgaccacgTTTTTaggcataggacccgtgtct
 1049–1069LE gtatgagggtctttgcaacgcTTTTTaggcataggacccgtgtct
 1115–1134LE ccaaaccacaccatcatgcaTTTTTaggcataggacccgtgtct
 913–932BL cctgggttagaagccaccgt
 1093–1114BL gcacagtgagatatgtcggagc
Oat3 (accession no.-AB017446)
 318–336CE ctcaggcttcccatttgggTTTTTctcttggaaagaaagt
 360–378CE gggaagactggcatttggcTTTTTctcttggaaagaaagt
 503–522CE tatgcctgccatgaagatcgTTTTTctcttggaaagaaagt
 589–609CE ggctgccagcatgagataactTTTTTctcttggaaagaaagt
 673–689CE cccgagatgctgcagccTTTTTctcttggaaagaaagt
 936–956CE cgttggagtgtcttcagggccTTTTTctcttggaaagaaagt
 978–998CE agctttttcccttcctccttcTTTTTctcttggaaagaaagt
 999–1021CE tgaacttcagctcctctatggtgTTTTTctcttggaaagaaagt
 1046–1069CE cagataagccatatttgaccttggTTTTTctcttggaaagaaagt
 337–359LE agatgtacgaagcggagacacttTTTTTaggcataggacccgtgtct
 398–415LE catccaagcacggctcggTTTTTaggcataggacccgtgtct
 438–461LE tcccactctatcacaatggtgtctTTTTTaggcataggacccgtgtct
 523–544LE caatcacaggtcctccaaccagTTTTTaggcataggacccgtgtct
 569–588LE ccaggtcaggataggcttgcTTTTTaggcataggacccgtgtct
 611–627LE ggcagcaccagagccgcTTTTTaggcataggacccgtgtct
 714–735LE ggtgggtacccattccacattcTTTTTaggcataggacccgtgtct
 738–756LE tgatgagatggcccgcatcTTTTTaggcataggacccgtgtct
 757–781LE tggtgtagcagtacccaatagatgtTTTTTaggcataggacccgtgtct
 782–803LE ccggacagaatgaactgaccaaTTTTTaggcataggacccgtgtct
 910–935LE tttgagtattttccagatagaaccagTTTTTaggcataggacccgtgtct
 1023–1044LE tgaggtgatgtccttctgcaagTTTTTaggcataggacccgtgtct
 379–397BL tggccctctgggtgtcatt
 416–437BL ctggtgctgttgtagatccagc
 462–481BL tgttggagctgcacaccaag
 482–502BL actgggccatctccttcagtt
 546–568BL ggccaaacctgtctgacagttct
 628–646BL cagggaggctgggactgaa
 648–672BL acacaggaatcggaagatcatatag
 690–713BL aagataacggtgtcagagaaatg
 804–822BL aggaatggcataggccagg
 823–842BL aactgtagccagcgccactg
 843–863BL aagaagggagcagacgaggt
 864–886BL acaggacaacaaggagaagatg
 887–908BL cagcgtatggactctggtaccc
 958–977BL ttgccgttgaaggtagccac
  • CE, capture extender; LE, label extender; BL, blocker.

  • 1-a  Target refers to the sequence of the mRNA transcript as enumerated in the GenBank file.

  • 1-b  Function refers to the utility of the oligonucleotide probe in the bDNA assay.