Table 2

Genotyping procedures for the MDR-1 polymorphisms using genomic DNA

5′-Primer3′-PrimerLength (bp)Restriction EnzymeCutting PositionWild/WildWild/MutantMutant/Mutant
A-41aG5′ TAAATGCGAATCCCGAGAAAA 3′5′ TCCCGGCCCGGATTGACTGAA 3′243 BsrI108,243243108,135,243108,135
C-145G5′ TGATTGGCTGGGCAGGAACAG 3′5′ AATCTTGGAAGAAGATACTCC 3′178 Bpu1102I37,7537,14137,38,103,14137,38,103
T-129C MspA1I92,12454,12432,54,92,12432,54,92
T1236C5′ TTTTTCTCACGGTCCTGGTAG 3′5′ CATCCCCTCTGTGGGGTCATA 3′147 HaeIII33,6868,7933,35,68,7933,35,79
G2677G5′ TTTAGTTTGACTCACCTTGCTAG 3′ NheI24,8324,83,107107
G2677T5′ TACCCATCATTGCAATAGCAG 3′5′ TTTAGTTTGACTCACCTTTCTAG 3′107 XbaI8310724,83,10724,83
G2677A5′ TTTAGTTTGACTCACCTTCCC 3′ AfaI10724,83,10724,83
A2956G5′ TTGTGTTTGTGCTTTCCAGAG 3′5′ TTAGGCCTTCCGTGCTGTAGC 3′171 NcoI4747,12447,124,171171
C3435T5′ TTGATGGCAAAGAAATAAAGC 3′5′ CTTACATTAGGCAGTGACTCG 3′207 NdeII14562,14562,145,207207
G4030C5′ TCCTCAGTCAAGTTCAGAGTC 3′5′ GACACTTTATGCAAACATTTC 3′242 Alw26I26,55,7126,29,18716,26,29,171,18716,26,29,171
A4036G5′ GTTATAAAATTTATAATGCAGTTTAACATA 3′111 NdeI8130,8130,81,111111