TABLE 1 

Gene-specific primers used in this study

GenePrimer sequences (5′ to 3′)
β-actinForward: GGAGATTACTGCCCTGGCTCCTA
Reverse: GACTCATCGTACTCCTGCTTGCTG
GRForward: AAGGTTAGCAGAGGGAGGCTTT
Reverse: GAAGGGTGGGGAGGATTAGTG
11β-HSD1Forward: CCCATGTGGTATTGATGCAAG
Reverse: AGAGGCTGCTCCGAGTTCAAG
AdiponectinForward: GCCTATCCACAAAGTCCAGGATG
Reverse: CCCGGGAATGAAGTCCAAAC
LeptinForward: GCCTATCCACAAAGTCCAGGATG
Reverse: CCCGGGAATGAAGTCCAAAC
TNF-αForward: ATACACTGGCCCGAGGCAAC
Reverse: CCACATCTCGGATCATGCTTTC
IL-6Forward: ATTGTATGAACAGCGATGATGCAC
Reverse: CCAGGTAGAAACGGAACTCCAGA
PPAR-γForward: TGCAGCAGGTTGTCTTGGATG
Reverse: GGAGCCTAAGTTTGAGTTTGCTGTG
GLUT-4Forward: TATTTGCCGTCCTCCTGCTT
Reverse: TGGGTTTCACCTCCTGCTCT