TABLE 1

The guinea pig primer sequences for single-cell reverse-transcription polymerase chain reaction

TargetPrimerSequence (5′ to 3′)Product Size (bp)Genomic Size (bp)NCBI Reference Sequence
β-actinForwardTCTCTTCCAGCCCTCCTTC373N/AaNT_176389.1
ReverseGTCCTCAAAGGTGCTGTGCT
NaV1.1ForwardAAGGGTTTCGCTTCTCCATT206>1000XM_003478553.2
ReverseGTCCTCAAAGGTGCTGTGCT
NaV1.2ForwardGAGACTTCAGTGGTGCTGGTG265N/AXM_003478556.2
ReverseAGCAGAGACTGGTGTGGAGAA
NaV1.3ForwardACACAACAGAGGAGAGGCAGA171>1000XM_003478666.2
ReverseCGTCTTGGGGAGAATAGGG
NaV1.4ForwardGGCTCTCCCTCCACCATC159N/AXM_003465929.1
ReverseCAGCGGTTTCTTGCCATC
NaV1.5ForwardGTCATTTTCCTGGGCTCCTT245>1000XM_005001107.1
ReverseTTGCTCCTTCTCTCGTGGTT
NaV1.6ForwardCCTCCTATGGACGAAAAGACA222>1000XM_005006531.1
ReverseTGCAGATGGTGATAGCCAAG
NaV1.7ForwardGAGGAAAAGGGAGATGATGAGA158>1000XM_003478661.2
ReverseAACAGGGAGCCACGAATG
NaV1.8ForwardCGGAAAGGTGACAATGGAG187>1000XM_003464141.2
ReverseAGCAGGGACAGTAGCGAAGA
NaV1.9ForwardGTTCCAGGTTCCCAAATCAA162>1000XM_003464142.2
ReverseGAGGCAGAAGAGGGTGAGG
  • NCBI, National Center for Biotechnology Information.

  • a N/A indicates no match in UCSC (University of California, Santa Cruz) Genome Browser in silico polymerase chain reaction.