TABLE 2

The human primer sequences for single-cell reverse-transcription polymerase chain reaction

TargetPrimerSequence (5′ to 3′)Product Size (bp)Genomic Size (bp)NCBI Reference Sequence
β-actinForwardAGAAAATCTGGCACCACACC188629NM_001101.3
ReverseAGAGGCGTACAGGGATAGCA
NaV1.1ForwardTCAGTTCCTACATCGCCTGTT174>1000NM_001165963.1
ReverseACTCATTGCTCGTTGCCTTT
NaV1.2ForwardGTGCTGGTGGGATAGGAGTT288N/AaNM_021007.2
ReverseTGCGTCTTGGAGAGAAAAGG
NaV1.3ForwardGGAACCGAAGGAAGAAAAGAA252N/ANM_006922.3
ReverseCCCGACCTCTGAAACTGAAA
NaV1.4ForwardTCAACAACCCCTACCTGACC208>1000NM_000334.4
ReverseTTCTCCTCTGCCTGCTCCT
NaV1.5ForwardCTAAAGGCAGGCGAGAACC188708NM_198056.2
ReverseAGGTAGAAGGACCCCAGGAA
NaV1.6ForwardCGTCTTGGTCATCTTTGTGG242>1000NM_014191.3
ReverseCCCCTCCTTCTTCACCTTCT
NaV1.7ForwardTGGAGAGGAAAAGGGAGATG166>1000NM_002977.3
ReverseAGAAAACAAGGAGCCACGAA
NaV1.8ForwardTAAGCGAGGCACTTCTGACC144>1000NM_006514.3
ReverseGAGAGGAAAGCCCAAGCAA
NaV1.9ForwardGGCAAGAGGTTTCATTCTGG125>1000NM_014139.2
ReverseGGGGCAATAGTTTGATGGTG
  • NCBI, National Center for Biotechnology Information.

  • a N/A indicates no match in UCSC (University of California, Santa Cruz) Genome Browser in silico polymerase chain reaction.