TABLE 3

The mouse primer sequences for single-cell reverse-transcription polymerase chain reaction

TargetPrimerSequence (5′ to 3′)Product Size (bp)Genomic Size (bp)NCBI Reference Sequence
β-actinForwardGTGGGAATGGGTCAGAAGG302756NM_007393.3
ReverseGAGGCATACAGGGACAGCA
NaV1.1ForwardAGACAGCATCAGGAGGAAGG118>1000NM_018733.2
ReverseGGAGAACAGGGAACCACGA
NaV1.2ForwardTTTTCGGCTCATTCTTCACA305>1000NM_001099298.2
ReverseCATCTCTTGGCTCTGGTCGT
NaV1.3ForwardAGACAGAGGGAGCACTTGGA200>1000NM_018732.3
ReverseCTATTGCGTCTTGGGGAAAA
NaV1.4ForwardTCATCTTCCTGGGTTCCTTC206941NM_133199.2
ReverseATCTGCCTCCTCTCCACCTT
NaV1.5ForwardTGGGCTCCTTCTACCTTGTG247>1000NM_021544.4
ReverseCGTTTCCTCCTCTTGCTCCT
NaV1.6ForwardAGGCAGCAAAGACAAACTGG157N/ANM_001077499.2
ReverseGCAGCACTTGAACCTCTGG
NaV1.7ForwardATGCTCTTCTTTGCGGTTTC381>1000NM_001290674.1
ReverseCGGCTTCTTCCTGCTCTTTT
NaV1.8ForwardCAATCCGACCCTTACAACCA147>1000NM_001205321.1
ReverseAAAGACCCCGTCATCCAAG
NaV1.9ForwardCAGCTTTGGCTGGTCTTTTC228>1000NM_011887.3
ReverseTTCTCCTTGGCCTCTGTCTC
  • NCBI, National Center for Biotechnology Information.

  • a N/A indicates no match in UCSC (University of California, Santa Cruz) Genome Browser in silico polymerase chain reaction.