TABLE 2

Mouse primer sequences for qRT-PCR (listed 5′-3′)

GeneForwardReverse
β-ActinGCAACGAGCGGTTCCGCCCAAGAAGGAAGGCTGGA
Il-4CGAGCTCACTCTCTGTGGTGTGAACGAGGTCACAGGAGAA
Il-5CTCTGTTGACAAGCAATGAGACGTCTTCAGTATGTCTAGCCCCTG
Il-13CCTGGCTCTTGCTTGCCTTGGTCTTGTGTGATGTTGCTCA
CaSRAGCAGGTGACCTTCGATGAGTACTTCCTTGAACACAATGGAGC
Muc5ACCTGTGACATTATCCCATAAGCCCAAGGGGTATAGCTGGCCTGA
Mip2CCAACCACCAGGCTACAGGGCGTCACACTCAAGCTCTG
iNosTGAAGAAAACCCCTTGTGCTTTCTGTGCTGTCCCAGTGAG
Cyp2E1GGGACATTCCTGTGTTCCAGCTTAGGGAAAACCTCCGCAC
Nqo1TTTAGGGTCGTCTTGGCAACGTCTTCTCTGAATGGGCCAG