Article Figures & Data
Additional Files
Data Supplement
Files in this Data Supplement:
- Data Supplement - Figure 1. PCR genotyping of APCmin/FXR KO mice. To generate APCmin/FXR KO mice, FXR KO mice were cross-bred with APCmin mice. The offspring�s tail genomic DNA was used to determine the genotype. The sequence of the primers for genotyping FXR allele was reported earlier (Sinal et al., 2000). To genotype APC WT and mutant allele the sequence of primers were obtained from the Jax Lab: forward primer 1 (F1)- TGCCAGCACAGAATAGGCTG (WT), forward primer 2 (F2)- GTTGTCATCCAGGTCTGGTG (mutant), reverse primer (R1)- TGGAAGGATTGGAGCTACGG. Primers F1/R1 combination generates an amplicon of 300 bp and primers F2/R1 combination generates one amplicon of 400 bp. The PCR conditions are as follows: 95�C 3 min; 95�C 45 sec; 60�C 30 sec; 72�C 1 min; 72�C 6 min; 4�C ; 34X.
- Data Supplement - Figure 2. Effect of FXR deficiency on Ileum histomorphology A. Pictures of H&E staining of ileum of 2- and 12-month old male WT and FXR KO mice (20X). B. Quantification of average villi height in the ileum. * P < 0.05.
- Data Supplement - Figure 3. Cell proliferation determined by the BrdU labeling index in female mice. The colon cell proliferation was determined in 2- and 12-mo old female WT and FXR KO mice, n=6/group, by BrdU labeling. Panel A: pictures of BrdU labeling with nuclei stained in brown color indicating BrdU-positive cells (40X). Panel B: quantification of BrdU immunostaining expressed as BrdU-labeling index (percentage). * P <_0.05. xmlns:c="urn:x-prefix:c" panel="panel" c:_="c:_" picture="picture" of="of" a="a" polyp="polyp" between="between" the="the" stomach="stomach" and="and" duodenum="duodenum" cross-section="cross-section" view="view" such="such" polyps="polyps" _10x.="_10x." _--="_--" end="end" desc="desc" jpet145409_fig.3.smaller_file.jpg="jpet145409_fig.3.smaller_file.jpg">