Abstract
We have created a novel glutathione S-transferase π1 (gstp1) knockout (KO) zebrafish model and used it for comparative analyses of redox homeostasis and response to drugs that cause endoplasmic reticulum (ER) stress and induce the unfolded protein response (UPR). Under basal conditions, gstp1 KO larvae had higher expression of antioxidant nuclear factor erythroid 2–related factor 2 (Nrf2) accompanied by a more reduced larval environment and a status consistent with reductive stress. Compared with wild type, various UPR markers were decreased in KO larvae, but treatment with drugs that induce ER stress caused greater toxicities and increased expression of Nrf2 and UPR markers in KO. Tunicamycin and 02-{2,4-dinitro-5-[4-(N-methylamino)benzoyloxy]phenyl}1-(N,N-dimethylamino)diazen-1-ium-1,2-diolate (PABA/nitric oxide) activated inositol-requiring protein-1/X-box binding protein 1 pathways, whereas thapsigargin caused greater activation of protein kinase-like ER kinase/activating transcription factor 4/CHOP pathways. These results suggest that this teleost model is useful for predicting how GSTP regulates organismal management of oxidative/reductive stress and is a determinant of response to drug-induced ER stress and the UPR.
SIGNIFICANCE STATEMENT A new zebrafish model has been created to study the importance of glutathione S-transferase π1 in development, redox homeostasis, and response to drugs that enact cytotoxicity through endoplasmic reticulum stress and induction of the unfolded protein response.
Introduction
Zebrafish have been used as surrogate species for predicting pharmacologically or toxicologically active compounds in humans (Zon and Peterson, 2005). More than 50% of the enzymes involved in drug metabolism are conserved between zebrafish and humans (Li et al., 2010). Glutathione S-transferases [GST/GST (human protein/gene); Gst/gst (zebrafish protein/gene)] are a multifunctional family of enzymes with roles in phase II xenobiotic metabolism, ligand binding, kinase regulation, and protein thiolase activities (Board and Menon, 2013) in which substrate interactions involve a glutathione (GSH; G-site) and a substrate binding site (H-site). Evolutionarily, GSTs are conserved throughout the plant and animal kingdoms, with three distinct subfamilies—cytosolic, mitochondrial, and microsomal (Frova, 2006)—with cytosolic further divided into seven distinct classes: α, μ, ω, π, θ, ζ, and σ in mammals and ρ in teleost fish (Glisic et al., 2015). GST enzymatic activity is detected during the first 4 hours of zebrafish development as well as in all adult organs. Two zebrafish gstp genes, gstp1 and gstp2, are syntenic with their human orthologs, but in zebrafish, gstp1 is predominantly expressed during development, whereas gstp2 is a minor constituent (Glisic et al., 2015). At the amino acid level, Gstp1 shares ∼60% identity with Gstp1/GSTP1 from mouse/human and is perhaps the most versatile of the GST family because it catalyzes GSH conjugation with select electrophilic chemicals, which is the forward reaction of protein S-glutathionylation (Townsend et al., 2009a; Zhang et al., 2018), and through protein-protein interactions, regulating c-Jun N-terminal kinase mitogen-activated protein kinase signaling pathways (Okamura et al., 2015). GSTP has been found to be overexpressed in a range of human tumors (Howie et al., 1990), and mice lacking gstp1/2 are more sensitive to chemicals that impact redox homeostasis (Henderson and Wolf, 2011) and also develop phenotypes of augmented immunity and increased myeloproliferation (Gate et al., 2004; Zhang et al., 2014). In addition to these intrinsic phenotypes, we have previously shown that GSTP contributes to redox regulation in the oxidative environment of the ER, and that in turn can influence the UPR (Ye et al., 2017). This is relevant since certain drugs induce cytotoxicity through UPR induction with concomitant imbalance in redox homeostasis (Saito et al., 2009). The maintenance of redox homeostasis is crucial for the fate of vertebrates. Excess reactive oxygen species (ROS) or reducing equivalents can directly influence normal development and lead to pathologies (Grek and Townsend, 2014; Pérez-Torres et al., 2017). As an inverse imbalance of oxidative stress, reductive stress (an excess of reducing equivalents), has emerged as an essential physiologic parameter in both pro- and eukaryotes (Rajasekaran et al., 2007; Mavi et al., 2020). Although the condition is characterized by elevated intracellular reducing equivalents, conversely, by impacting mitochondrial functions and/or accumulating misfolding proteins in the ER (Peris et al., 2019; Wu et al., 2019), it can cause release of ROS, which can then activate Nrf2 (Guang et al., 2019).
In the present study, we used CRISPR gene editing to create gstp1 KO zebrafish embryo/larvae, characterizing basal parameters of redox homeostasis, and measured their comparative sensitivity to ER stress and UPR-inducing drugs. Our data show that although gstp1 KO fish develop normally, they demonstrate increased sensitivities to drug-induced oxidative stress and ER stress. Moreover, endogenous baseline components of redox homeostasis were increased in gstp1 KO larvae, whereas the baseline expression of UPR proteins decreased. In this scenario, we reason that the absence of gstp1 may enhance reductive stress, thereby influencing drug responses.
Materials and Methods
Zebrafish Husbandry.
Zebrafish (Danio rerio) were maintained at 28.5°C in a recirculating filtered-water system (Techiplast) in water purified by reverse osmosis and supplemented with Instant Ocean salts (60 mg/l) on a 14:10 light/dark cycle and fed regular food twice per day (10 mg per fish per meal, which is the tested amount of food that can be completely consumed within 10 minutes). All methods for this article were performed in accordance with relevant guidelines and regulations of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and Medical University of South Carolina’s Division of Laboratory Animal Resources (Park and Kim, 2019). All experiments on zebrafish were approved by the Institutional Animal Care and Use Committee of the Medical University of South Carolina (Institutional Animal Care and Use Committee protocol 3364).
Generation of gstp1 KO Zebrafish.
A mixture of guide RNA targeting exon 3 in gstp1 (GGACAAAGACCAGCAGCTGA, 50 ng/µl) and Cas9 RNA (100 ng/µl) was injected into zebrafish embryos at the one-cell stage. Injected embryos were raised in the facility. F0 fish were outcrossed with wild-type zebrafish, and progeny with indels were identified by polymerase chain reaction (35 cycles, 64°C annealing temperature) with forward (5′-CCTGGAATCATGTGCTCCCTGCAG-3′) and reverse (5′-ACAGGTGGCTTTCAAGTCGCCCT-3′) primers and confirmed by sequencing. In this paper, we used a mutant line with an 11-base pair deletion that resulted in premature stop at 33 amino acid loci.
Zebrafish Toxicity Tests.
We used zebrafish larvae at 4 days postfertilization (dpf) to determine acute toxicity because, by this point, morphogenesis and the development of functioning primary organ systems is completed. In addition, gstp1 expression remains constant throughout the larval stage. Drug concentrations used in the acute toxicity tests are as follows: tunicamycin (TuM), 0, 2, 4, 6, 8, 10, 12 µM; thapsigargin (ThG), 1, 0.5, 1, 1.5, 2, 2.5, 3 µM; and 02-{2,4-dinitro-5-[4-(N-methylamino)benzoyloxy]phenyl}1-(N,N-dimethylamino)diazen-1-ium-1,2-diolate (PABA/NO), 0, 2.5, 5, 7.5, 10, 12.5, 15 µM. Larvae with >95% viability were chosen for experiments and randomly distributed into 24-well plates with 10 larvae per well and varying concentrations of drugs in triplicate wells for 24 hours. Zebrafish observations were made directly in the 24-well plate using an inverted dissecting microscope. Acute toxicity was further determined based on daily observations of abnormal abdomens, mild blood pooling/congestion, and bent, short bodies. For the duration of the experiments, dead larvae were removed daily from the wells. Numbers of dead zebrafish within 24 hours for each drug concentration were recorded, and survival rates (%) were calculated. GraphPad Prism 5 [log (inhibitor) vs. normalized response-variable slope nonlinear model] was used to calculate 50% lethal concentration (LC50) values for each drug.
Quantitative Polymerase Chain Reaction.
For the qPCR studies, total RNA was isolated from 20 larvae per group with Trizol Reagent (15596-026; Invitrogen). The same amount of RNA was mixed to make pooled RNA as a template for complementary DNA synthesis. Oligo-dT–primed complementary DNA was prepared by using superscript III First-Strand kit (18080-051; Invitrogen). Real-Time qPCR was performed with a Bio-Rad CFX96 Real-Time System with one cycle of 98°C for 30 seconds, 45 cycles of 95°C for 15 seconds, and 60°C for 30 seconds using 50 ng cDNA, with 4 pmol of each gene-specific primer per 20-μl reaction (Supplemental Table 1), and SsoAdvanced Universal SYBR Green Supermix (172-5274; Bio-rad). We used qPCR primers employed in a previous study (Park and Kim, 2019) or newly designed and tested primers. Glyceraldehyde-3-phosphate dehydrogenase (gapdh) was used as a reference, and relative quantification was calculated using ΔΔCt method. The qPCR was assessed in at least triplicate replicates for each gene.
GST Activity.
GST activity was performed as previously described (Bräutigam et al., 2018). In total, 30 embryos (5 dpf), either control or treated with drugs, were collected and transferred to 300 μl of ice-cold homogenization buffer followed by gentle sonication on ice for 10 seconds three times with 10 seconds of cooling in between (CL-18; Fisher Scientific). The lysates were centrifuged at 13,000 rpm for 10 minutes, and supernatants were collected and protein were quantified using the Bicinchoninic Acid. assay. The colorimetric GST activity assay was performed in a total volume of 100 μl at 22°C in 0.1 M potassium phosphate buffer (pH 7.5) with 5 mM GSH and 0.5 mM 1-chloro-2,4-dinitrobenzene (CDNB), with absorbance once every 15 seconds at 340 nm using a plate reader to obtain at least 18 time points. Enzymatic reactions were started by adding 50 µg homogenate, and nonenzymatic background reaction rates were subtracted.
GSH and GSH Disulfide Levels.
GSH and GSSG levels were measured as previously described (Park et al., 2019a). In total, 30 embryos (5 dpf), either control or treated with drugs, were homogenized on ice in 300 µl of homogenization buffer. Protein determinations and protein concentrations were adjusted to 1 mg/ml, and then lysates were divided into two parts (for total thiol and GSH). One part was used to measure total thiol; the other part was subject to sulfosalicylic acid cell extraction (final 0.6%) to lyse the cells, placed at −80°C to freeze, and thawed and centrifuged at 4000g for 5 minutes to precipitate protein. The supernatants were kept for measuring reduced GSH; supernatants were neutralized (triethanolamine to the supernatant 1:16 ratio) to pH ∼7. In all, 2.5 μg of total thiol lysate or reduced GSH supernatant (volume to 10 μl) was added to thiol fluorescent probe IV (final 5 μM in PBS) and shaken for 15 minutes before reading fluorescent intensities at Ex/Em 400/465 nm. The concentration of thiol was quantified using GSH standards. Protein thiol can be measured by total thiol (reduced GSH + protein thiol) subtracted by reduced GSH. For measuring GSSG, the supernatant was incubated with the reduction system containing NADPH and glutathione reductase at 37°C for 20 minutes. GSSG was calculated based on the results from reduced GSH and total thiol; the ratio of GSH/GSSG = 
.
Intracellular ROS.
Intracellular ROS was measured as previously described (Park et al., 2019b). In total, 30 embryos (5 dpf), either control or treated with drugs, were homogenized on ice in 300 µl of homogenization buffer. Protein concentrations were adjusted to 1 mg/ml, and 25 μl was transferred to 96-well plates suitable for fluorescence measurements. Fluorescence was measured at 480 nm excitation/530 nm emission. Details were essentially according to the manufacturer’s instructions (Cell Biolabs, San Diego, CA). Each sample, including unknowns and standards, was assayed in triplicate.
Immunoblotting.
Immunoblotting was performed as previously described (Zhang et al., 2019). In total, 30 embryos (5 dpf), either control or treated with drugs, were collected and transferred to 300 μl of ice-cold homogenization buffer followed by gentle sonication on ice for 10 seconds three times with 10 seconds of cooling in between. The lysate was centrifuged at 16,000g for 10 minutes, supernatant was collected, and protein was quantified using the Bicinchoninic Acid assay. Equal amounts (60 μg) of protein were electrophoretically separated by SDS-PAGE (Bio-Rad) and transferred onto low-fluorescence polyvinylidene fluoride membranes (Millipore) by the Trans-Blot Turbo Transfer System (Bio-Rad). Polyvinylidene fluoride was incubated in the Odyssey blocking buffer (LI-COR) for 1 hour to reduce nonspecific binding and then probed with appropriate primary antibodies at 4°C overnight. Immunoblots were then developed with infrared fluorescence IRDye secondary antibodies (LI-COR) at a dilution of 1:15,000, imaged with a two-channel (red and green) infrared fluorescent Odyssey CLx imaging system (LI-COR), and quantified with ImageJ software (FIJI).
Statistical Analysis.
All measurements were collected from at least three independent experiments. Statistical analysis was performed using GraphPad Prism 6.0 and Microsoft Excel. Significant differences were determined using two-tailed t tests and one-way ANOVA followed by Newman-Keuls as a post-test.
Results
Zebrafish Contain Two Homologs of Human GSTP1.
The annotated zebrafish genome (GRCz11, www.ensembl.org) confirmed that gstp exists as two genes, gstp1 and gstp2, that share high amino acid identities (87%), with each located on chromosome 14. These two isoforms (NM_131734.3, gstp1; and NM_001020513.1, gstp2) share ∼60% identity at the amino acid level with the human homolog GSTP1, which is found on chromosome 11 (Supplemental Fig. 1). During embryo development, gstp1 is expressed in all organs, whereas gstp2 is below the levels of standard detection. Gstp1 is also the most prevalent and abundant of the zebrafish GST isozymes.
Generation and Characterization of gstp1 Mutant Zebrafish.
CRISPR/Cas9 targeting gstp1 caused an 11-base pair deletion in exon 3 of gstp1, which led to a stop codon at the 33 amino acid loci (Fig. 1A). Loss of functional gstp1 did not alter the gross morphology of either embryos or larvae (Supplemental Fig. 2A). There were no obvious defects during embryogenesis, hatching, or early adult growth, with normal survival and fecundity—circumstances similar to gstp1/2 KO mice (Henderson et al., 1998). Since gstp1/2 KO mice have hematopoietic changes, we performed in situ hybridization against globin, a marker for erythrocytes, revealing no significant changes in the number of red blood cells in gstp1 KO embryos (Supplemental Fig. 2B). Expression of gstp1 remains constant from hatching until the late larval stages, so to measure any functional consequences of the KO, larvae at 4 dpf of each genotype were assessed for expression of the gstp gene and protein and enzyme activity. Gene and protein expression were absent in the KO larvae, which also showed lower GST activity levels (Fig. 1, B–D), in which residual CDNB activity will be a consequence of the other GST isozymes.
Generation of gstp1 KO zebrafish. (A) Gstp1cri mutant has an 11-bp deletion. Deleted nucleotides are shown in red in WT. Relative levels of mRNA expression (B) and protein expression (C) of Gstp1/2 in WT and gstp1 KO zebrafish (D) GST activity in WT and gstp1 KO zebrafish. **P < 0.01; ***P < 0.001 vs. WT by two-tailed t tests.cri, CRISPR; mut, mutation.
Drug Sensitivities in WT and gstp1 KO Larvae.
Larvae were exposed to three drugs known to cause ER stress, albeit by distinct mechanisms: TuM, ThG, and PABA/NO. Lethality curves are presented in Fig. 2. WT and gstp1 KO larvae at 4 dpf were used to ascertain the maximum tolerable concentration of the drugs. These values were 10 μM (TuM), 2.5 μM (ThG), and 12.5 μM (PABA/NO). For subsequent experiments, concentrations decreasing geometrically from the maximum tolerable concentration were used, and the LC50 values are shown in Table 1. Despite the differences in drug administration conditions, these values are comparable with those for gstp1/2 KO cells and mice, as well as zebrafish larvae with a phosphomannomutase 2 mutation (Table 1) (Ye et al., 2017; Mukaigasa et al., 2018; Cheng et al., 2019; Liu et al., 2019; Xia et al., 2020). Overall, the data showed that deletion of gstp1 enhances the cytotoxic effects of TuM, ThG, or PABA/NO.
Drug toxicities in WT and gstp1 KO zebrafish larvae. Dose-dependent survival curves for WT and gstp1 KO zebrafish larvae. Larvae at 4 dpf were exposed to (A) TuM, (B) ThG, and (C) PABA/NO for 24 hours. Each point is the average of triplicate measurements, and each measurement contains data from 10 larvae ± S.D. (micromolar).
LC50 values in zebrafish and mice
Malformation Caused by Drugs in WT and gstp1 KO Larvae.
Using bright-field microscopy, we identified no apparent differences in development between WT and KO early larvae (Fig. 3A). After 16-hour drug treatments, the majority of the KO larvae showed significant pericardial edema and curvature of spine and tail (ThG) and pericardial edema and yolk sac edema (PABA/NO). However, in WT larvae, these effects were absent or mild in nature (Fig. 3, A and B). After 24-hour treatments, excess malformation caused by ThG and PABA/NO occurred in a time-dependent manner, and the effects in WT larvae remained less substantial than in KO (Fig. 3, D and E). Distinct from the other two drugs, TuM caused no malformations before 24 hours, at which time pericardial edema was more pronounced in KO than WT larvae (Fig. 3, A and B, D and E). However, overall body lengths were unaffected by any of the drugs (Fig. 3, C and F). Thus, at most of the treatment time points, TuM had a diminished impact on ratios of abnormal versus normal development features compared with either ThG or PABA/NO.
Zebrafish larvae malformation assays. (A and D) Representative views of larval malformations caused by TuM, ThG, and PABA/NO after 16 and 24 hours. Total malformations (B and E) and body length (C and F) for 16 and 24 hours are presented as means ± S.D. for three replicates per treatment (n = 10 random larvae per replicate) in scatter plots.
Impact of gstp1 KO Phenotype on Redox Pathways.
We reasoned that basic parameters of GSH homeostasis were likely to be altered by GSTP deletion. As such, we compared WT and gstp1 KO larvae for alterations in expression of redox pathway constituents, both before and after drug treatments. Figures 4⇓–6 illustrate that gstp1 KO larvae had increased baseline values for GSH, protein thiol, GSH/GSSG ratios, and gene expression of glutamate-cysteine ligase catalytic subunit (gclc) and glutathione reductase (gr) and decreased GSSG and ROS levels (Fig. 4); increased gene expression of nrf2a and sod2 (Fig. 5; Table 2); and higher baseline expression of Nrf2 protein and increased Nrf2 and SOD1 protein levels after each drug (Fig. 6). Drug treatments produced a coordinated increase in GSH (Fig. 4, A, G, and M); protein thiol (Fig. 4, D, J, and P); ratios of GSH/GSSG (Fig. 4, C, I, and O); ROS (Fig. 4E, K, and Q); and gene expression of gclc, glutamate-cysteine ligase modifier subunit (gclm), and gr (Fig. 4, F, L, and R) and decreased GSSG (Fig. 4, B, H, and N). The shift in the ratio of GSH/GSSG toward a more reduced state, plus the presence of higher ROS in gstp1 KO larvae after drug treatments, would be consistent with some form of reductive stress preceding resultant increases in oxidative stress.
Drug effects on redox homeostasis. TuM: (A) GSH levels, (B) GSSG levels, (C) GSH/GSSG ratios, (D) protein thiol, (E) intracellular ROS, and (F) mRNA expression of gclc, gclm, and gr. Data are derived from three independent experiments and presented as means ± S.D. in scatter plots. *P < 0.05 vs. WT untreated control, #P < 0.05; ##P < 0.01 vs. KO untreated control by one-way ANOVA followed by Newman-Keuls as a post-test. ThG: (G) GSH levels, (H) GSSG levels, (I) GSH/GSSG ratios, (J) protein thiol, (K) intracellular ROS, and (L) mRNA expression of gclc, gclm, and gr. Data are derived from three independent experiments and presented as means ± S.D. in scatter plots. *P < 0.05; **P < 0.01 vs. WT untreated control, #P < 0.05; ##P < 0.01 vs. KO untreated control by one-way ANOVA followed by Newman-Keuls as a post-test. PABA/NO: (M) GSH levels, (N) GSSG levels, (O) GSH/GSSG ratios, (P) protein thiol, (Q) intracellular ROS, and (R) mRNA expression of gclc, gclm, and gr. Data are derived from three independent experiments and presented as means ± S.D. in scatter plots. *P < 0.05 vs. WT untreated control, #P < 0.05; ##P < 0.01 vs. KO untreated control by one-way ANOVA followed by Newman-Keuls as a post-test. Ctrl, control.
Heat map showing drug-induced changes in expression of oxidative stress and ER stress response genes. Larvae at 4 dpf were exposed to TuM (4 μM), ThG (0.75 μM), and PABA/NO (4 μM) for 24 hours. Shown are fold changes in gene expression after drug treatment relative to WT untreated larvae with mean values set at 1. Relative gene expression quantification was based on the Ct method (2∆∆Ct), with normalization of the raw data to the housekeeping gene (gapdh). Data are derived from three independent experiments and presented as means ± S.D. in heat map. *P < 0.05; **P < 0.01; ***P < 0.001 vs. the WT untreated control, #P < 0.05; ##P < 0.01; ###P < 0.001 vs. the KO untreated control by one-way ANOVA followed by Newman-Keuls as a post-test. Ctrl, control.
Oxidative stress protein expression. Larvae at 4 dpf were exposed to TuM (4 μM), ThG (0.75 μM), and PABA/NO (4 μM) for 24 hours. (A) Proteins were separated by SDS-PAGE and evaluated by immunoblots. (B) Protein expression before and after treatment was quantified by ImageJ software. Fold changes in protein expression after drug treatment relative to WT untreated larvae with mean values set at 1. Relative protein expression quantification was normalized to GAPDH. Data are derived from three independent experiments and presented as means ± S.D. in the scatter plots. *P < 0.05; **P < 0.01 vs. the WT untreated control, #P < 0.05 vs. KO untreated control by one-way ANOVA followed by Newman-Keuls as a post-test. Ctrl, control.
Drug-induced changes in gene expression of oxidative stress and ER stress/UPR in WT and gstp1 KO zebrafish larvae
ER Stress/UPR Gene and Protein Expression Patterns.
In both mice and zebrafish, gstp1 gene expression is influenced by induced ER stress (Ye et al., 2017; Mukaigasa et al., 2018), so we compared drug effects in the WT and KO larvae. We chose UPR sensors and their target genes, as well as subsequent genes associated with mitochondrial injury and ER stress–induced apoptosis (baxb, bida, and bim). Relative to WT larvae, gstp1 KO was linked with lower baseline expressions of bip (0.51-fold), ire1 (0.73-fold), atf6 (0.35-fold), xbp1-u (0.80-fold), xbp1-s (0.61-fold), atf4 (0.79-fold), chop (0.70-fold), and gadd45a (0.74-fold), indicating connectivity between gstp1 and UPR in zebrafish (Fig. 5; Table 2). In both WT and KO larvae, TuM and PABA/NO produced a coordinated increase in expression of UPR-associated genes, including bip, dnajc3, grp94, ire1, xbp1-u, xbp1-s, atf4, chop, gadd45a, edem1, baxb, bida, and bim. In addition, significant induction of gadd45a was found in KO larvae, whereas TuM and PABA/NO decreased its expression in WT larvae. However, in the KO larvae, ThG enhanced expression of bip, dnajc3, grp94, perk, atf4, and chop and diminished the upregulation of ire1, edem1, baxb, bida, and bim. These data confirmed that manipulation of gstp1 expression directly influenced ER stress/UPR in zebrafish.
Immunoblots identified key UPR protein expression differences between WT and gstp1 KO larvae (Supplemental Fig. 3). The gstp1 KO was associated with lower baseline expression of IRE1 and XBP1s. Figure 7 shows that drug treatments produced a coordinated increase in all UPR proteins except IRE1 and XBP1-s. Independent of baseline expression patterns, TuM and PABA/NO significantly increased IRE1, XBP1-s, and Bax in gstp1 KO larvae, whereas ThG decreased their expression but increased CHOP. Induction of BiP was caused by each of the three drugs in both WT and KO larvae. These results indicate that although minor differences for each drug exist, in general, the absence of gstp1 makes the larvae more vulnerable to ER stress/UPR. Consistent with the toxicity assays and gene expression data, drug treatments induced oxidative and ER stress for the majority of the markers of interest in KO larvae, particularly the IRE1/XBP1 UPR pathway for TuM and PABA/NO and the PERK/ATF4/CHOP pathway for ThG.
ER stress/UPR protein expression. Larvae at 4 dpf were exposed to TuM (4 μM), ThG (0.75 μM), and PABA/NO (4 μM) for 24 hours. (A–C) Protein expression before and after treatment was quantified by ImageJ software. Fold changes in protein expression after drug treatment relative to WT untreated larvae with mean values set at 1. Relative protein expression quantification was normalized to GAPDH. Data are derived from three independent experiments and presented as means ± S.D. in scatter plots. *P < 0.05; **P < 0.01; ***P < 0.001 vs. the WT untreated control, #P < 0.05; ##P < 0.01; ###P < 0.001 vs. KO untreated control by one-way ANOVA followed by Newman-Keuls as a post-test. Ctrl, control.
Discussion
Since zebrafish are useful surrogates for the study of certain aspects of human drug response (Ding et al., 2020; Mohd Sakeh et al., 2020), our goal with the present work was to generate and characterize a novel gstp1-deficient model to establish its role in redox homeostasis and drug response. Zebrafish Gstp1 shares with human GSTP1 conserved residues in the substrate binding site (H-site), including Tyr8, Phe9, Val11, Ile105, and Tyr109 (Suzuki et al., 2005), each important in GSH conjugation with various substrates (Maher, 2005). During the developmental process, the physiologic roles of Gstp1 are well conserved among vertebrates, including teleost fish and mammals (Abunnaja et al., 2017). Unlike mammals that express both GSTP1 and GSTP2 in a tissue-specific manner, in zebrafish, Gstp1 is the predominant isoenzyme of this class and is constitutively expressed at high levels in all tissues, especially throughout early development, whereas Gstp2 is essentially undetectable (Glisic et al., 2015). Gstp2 does have a high catalytic constant for CDNB (Glisic et al., 2015), and this accounts for the residual CDNB activity we measured in gstp1 KO larvae. Gstp1 was expressed early during zebrafish embryogenesis, similar to GSTP1 in mammalian embryogenesis (Raijmakers et al., 2001; Tierbach et al., 2018), implying that Gstp1 shares similar functions in both. Homozygous zebrafish mutants were fertile and displayed no overt morphologic phenotypes under normal rearing conditions. As with mice, gstp1/2 KO was not lethal to the embryo, nor was there any intrinsic impact on early embryonic development or growth patterns. However, our results revealed that gstp1 KO larvae did contain higher basal levels of GSH, GSH/GSSG, and Nrf2, with lower levels of basal ER stress, which was evidenced by decreases in expression of UPR-associated proteins and is suggestive of conditions of reductive stress in these larvae.
Abrogation of gstp1/2 in mice was shown to cause increased ER stress and enhanced sensitivity to various drugs through activation of the UPR (Ye et al., 2017), and compared with the KO cells, WT gstp1/2 bone marrow–derived dendritic cells were more resistant to these drugs (Zhang et al., 2020). Consistent with the mouse data, gstp1 KO zebrafish larvae were shown to be more sensitive than WT larvae to TuM, ThG, and PABA/NO. TuM is an N-linked glycosylation inhibitor, causing accumulation of misfolded proteins in the ER, which results in UPR (Oda et al., 2008) and also actuates GSTP translocation from the cytosol to the ER (Ye et al., 2017). TuM shifted the ratio of GSH/GSSG toward the more reduced state, producing reductive stress–induced mitochondrial dysfunction and ROS augmentation, thereby increasing Nrf2, IRE1, XBP1-s, and Bax expression. Taken together, these results suggest that gstp1 protects larvae from oxidative and ER stress and death via the IRE1/XBP1/Bax pathway, implicating gstp1 in pathways relevant to reductive stress, where its absence enhances reductive stress–induced cell death.
ThG is an inhibitor of the Ca2+ ATPase (sarco/endoplasmic reticulum Ca2+-ATPase), causing disruption of Ca2+ homeostasis and UPR (Sehgal et al., 2017). Cells from gstp1/2 KO mice showed increased sensitivity to ThG (Ye et al., 2017). Our present results showed that although ThG was more cytotoxic and induced oxidative and ER stress in gstp1 KO larvae, its effects were distinct from TuM. Instead of activating the IRE1/XBP1 axis, ThG increased expression of PERK, ATF4, and CHOP compared with WT larvae, confirming a distinct mechanism of action. PABA/NO is a GST-activated prodrug that releases nitric oxide (NO), causing nitrosative and oxidative stress that in mice targets protein disulfide isomerase, which in turn causes accumulation of misfolded proteins and activation of the UPR (Townsend et al., 2009b; Xiong et al., 2012). Our results showed that PABA/NO to some extent mimicked TuM in gstp1 KO larvae. For example, in gstp1 KO larvae, it was more cytotoxic; it increased GSH levels and GSH/GSSG ratios and ROS; and it raised levels of Nrf2, IRE1, XBP1-s, and Bax. Activation of PABA/NO may have been influenced by the absence of gstp1, but over the long incubation period, spontaneous and other GST isoform activation will have compensated (Townsend et al., 2009b). With respect to drug-induced developmental effects, at the 24-hour time point, exposure of larvae to either TuM or PABA/NO caused pericardial edema, whereas ThG caused severe pericardial edema and curvature of the spine and tail (Fig. 3D), again reflecting the distinctive mechanisms of action. Although deficiencies in gstp1/2 in mice have been linked with altered hematopoiesis (Gate et al., 2004) in zebrafish, the unaltered hemoglobin results suggest dissimilarities between the species. This may be explained by the indications that microsomal GST (Bräutigam et al., 2018) and a melanin umbrella, rather than bone, has a more specific role in regulation of teleost marrow functions (Kapp et al., 2018).
Overall, our results indicate that gstp1 KO larvae are more susceptible to UPR after TuM, ThG, or PABA/NO, although the basal levels of UPR in gstp1 KO larvae are significantly lower than those in WT larvae. Taken together, this new zebrafish model has enabled us to clarify the roles of gstp1 in redox homeostasis and drug and stress response and show that although there are some differences from mammals, there are also significant similarities.
Acknowledgments
We thank the analytical redox core of the COBRE grant (NCRR P20RR024485).
Authorship Contributions
Participated in research design: Tew, Townsend.
Conducted experiments: Zhang L, Ye, Kim.
Contributed new reagents or analytic tools: Kim, Park, Zhang J
Performed data analysis: Zhang L.
Wrote or contributed to the writing of the manuscript: Tew, Zhang L, Kim.
Footnotes
- Received November 13, 2020.
- Accepted January 25, 2021.
This work was supported by grants from the National Institutes of Health (CA08660, CA117259, NCRR P20RR024485 - COBRE in Oxidants, Redox Balance and Stress Signaling) and support from the South Carolina Centers of Excellence program and was conducted in a facility constructed with the support from the National Institutes of Health, Grant Number C06 RR015455 from the Extramural Research Facilities Program of the National Center for Research Resources. Supported in part by the Drug Metabolism and Clinical Pharmacology shared resource, Hollings Cancer Center, Medical University of South Carolina.
No author has an actual or perceived conflict of interest with the contents of this article.
↵
This article has supplemental material available at jpet.aspetjournals.org.
Abbreviations
- atf
- activating transcription factor
- baxb
- Bcl2-associated x b
- bida
- BH3-interacting domain death agonist a
- bim
- Bcl2-interacting mediator of cell death
- bip
- binding immunoglobulin protein
- CDNB
- 1-chloro-2,4-dinitrobenzene
- dnajc3
- DnaJ homolog subfamily C member 3
- dpf
- days postfertilization
- edem1
- ER degradation–enhancing α-mannosidase-like 1
- ER
- endoplasmic reticulum
- gadd45a
- growth arrest and DNA-damage-inducible 45α
- gapdh
- glyceraldehyde-3-phosphate dehydrogenase
- gclc
- glutamate-cysteine ligase catalytic subunit
- gclm
- glutamate-cysteine ligase modifier subunit
- gr
- glutathione reductase
- grp94
- glucose-regulated protein 94
- GSH
- glutathione
- GSSG
- GSH disulfide
- GST
- glutathione S-transferase
- GSTP
- glutathione S-transferase π
- ire1
- inositol-requiring protein-1
- KO
- knockout
- LC50
- 50% lethal concentration
- NO
- nitric oxide
- Nrf2
- nuclear factor erythroid 2–related factor 2
- perk
- protein kinase-like ER kinase
- qPCR
- quantitative polymerase chain reaction
- ROS
- reactive oxygen species
- sod
- superoxide dismutase
- ThG
- thapsigargin
- TuM
- tunicamycin
- UPR
- unfolded protein response
- WT
- wild type
- xbp1
- X-box binding protein 1
- xbp1-s
- spliced form of xbp1
- xbp1-u
- unspliced form of xbp1
- Copyright © 2021 by The American Society for Pharmacology and Experimental Therapeutics
