Article Figures & Data
Figures
- Fig. 1.
CHBP and/or CASP3siRNA preserved renal function and structure in IR kidneys. (A) Schematic diagram of mouse renal IR models with the treatment of CHBP and/or CASP3siRNA. Bilateral kidney pedicles were occluded for 30 minutes, followed by 48-hour reperfusion. CASP3siRNA or NCsiRNA was injected via the tail vein at a dose of 0.03 mg/kg BW 2 hours before surgery. CHBP was given through intraperitoneal cavity at 24 nmol/kg BW 15 minutes postreperfusion. (B) The level of SCr was demonstrated for each group. There were six animals in each group, and the detection was repeated for three times independently. The experiment was performed three times independently. (C) Representative photomicrographs of H&E staining in renal cortex were shown for each group. Scale bar, 100 μm. (D) Semiquantitative analysis of TID score (n = 6). The sections were blindly scored by two researchers independently. Data were shown as means ± S.D. n = 6 animals per group; *P < 0.05; **P < 0.01. Statistical comparisons were calculated by ANOVA followed by post hoc LSD test.
- Fig. 2.
CHBP and/or CASP3siRNA ameliorated apoptosis in tubulointerstitial areas. (A) The method of ISEL fragmented DNAs was used to detect apoptotic cells in kidney tissues. AEC was used to develop color labeling. Representative photomicrographs of apoptotic cells (indicated by arrows) in cortical areas were shown in each group. Scale bar, 50 μm. (B) The average number of ISEL+ cells per field are demonstrated for each group (n = 6). The sections were blindly reviewed by two researchers independently. Data were shown as means ± S.D. n = 6 animals per group; *P < 0.05; **P < 0.01. Statistical comparisons were calculated by ANOVA followed by post hoc LSD test.
- Fig. 3.
CHBP and/or CASP3siRNA decreased the number of active 17 kDa caspase-3–positive cells. (A) Representative photomicrographs of cells positively stained with 17 kDa caspase-3+ were shown in the indicated groups. Detected by immunostaining, 17 kDa caspase-3 was labeled and revealed by AEC. Scale bar, 50 μm. (B) The average number of 17 kDa caspase-3+ cells per field are demonstrated in each group (n = 6). The sections were blindly reviewed by two researchers independently. Data were shown as means ± S.D. n = 6 animals per group; *P < 0.05; **P < 0.01. Statistical comparisons were calculated by ANOVA followed by post hoc LSD test.
- Fig. 4.
CHBP and/or CASP3siRNA decreased 17 kDa active caspase-3 and HMGB1 expression in IR kidneys. (A) The level of active caspase-3 was measured by Western blotting and typical bands were shown. (B) Semiquantitative analysis showed the expression of 17 kDa caspase-3 corrected by the endogenous control of β-actin in each group (n = 6). (C) Representative bands of HMGB1 were shown. (D) The level of HMGB1 protein corrected by β-actin was determined in each group (n = 6). The immunoblotting was performed three times independently. Data were shown as means ± S.D. n = 6 animals per group; *P < 0.05; **P < 0.01. Statistical comparisons were calculated by ANOVA followed by post hoc LSD test.
- Fig. 5.
Identified DEGs and qPCR validation. (A) Venn diagram illustrating the number of significant DEGs in the three comparisons. The sorting criteria was FC > 1.414 and P < 0.05. In four groups (n = 3), each kidney sample was analyzed separately. (B–E) The expression of SLC22A7, CFH, GREM1, and ANGPTL2 mRNA was detected by qPCR, which was done three times independently. n = 3 kidney samples from individual animals in each group; *P < 0.05. Statistical comparisons were calculated by two-tailed unpaired Student’s t test.
- Fig. 6.
GO analysis of DEGs in IR kidneys. The top 30 significantly enriched GO items of biologic processes were shown from three comparisons, modified by CHBP (A) and then further by CASP3siRNA (B) or NCsiRNA (C). The text on the left indicated the category of GO, and the bar chart indicated the enrich factor in each category. Underlined categories were particularly discussed in this study. n = 3 animals in each group.
Tables
Gene Symbol Full Name Primers (5′-3′) SLC22A7 Solute carrier family 22 member 7 Forward: CTGTCTGCCTGTGTTTATCC Reverse: CTTCCCCAAATGCCACAGCT CFH Complement factor H Forward: ACTTTCTCAGATTTTCCTGG Reverse: TGGTTGTTACATGCTTTGGG ANGPTL2 Angiopoietin-like 2 Forward: GGATGGTTCACAGAGAGAGTAC Reverse: CTCCTTGGAGTTGACACAAATG GREM1 Gremlin-1 Forward: GCAAGTATCTGAAGVGAGATTG Reverse: CGTCATGGTGGTGAACTTCTTG ACTB β-actin Forward: GAGACCTTCAACACCCCAGC Reverse: ATGTCACGCACGATTTCCC - TABLE 2
IR + CHBP vs. IR, top five upregulated and downregulated genes
The gene in italic was discussed for its potential function in IR-induced AKI. P < 0.05.
Accession Number Gene Symbol Gene Name Fold Change Upregulated AK016105 4930553I04RIK RIKEN cDNA 4930553I04 gene 8.559 AK046501 SACS Sacsin 5.261 NM_013501 CRYAA Crystallin, alpha A 4.357 NM_011255 RBP4 Retinol binding protein 4, plasma 4.213 NM_009744 BCL6 B cell leukemia/lymphoma 6 3.622 Downregulated NM_001167777 ASXL3 Additional sex combs like 3 −24.005 NM_029070 CLDN26 Claudin 26 −5.985 NM_001167746 DNAH17 Dynein, axonemal, heavy chain 17 −5.922 AK171340 PITPNC1 Phosphatidylinositol transfer protein, cytoplasmic 1 −5.113 NM_007501 NEUROD4 Neurogenic differentiation 4 −5.094 - TABLE 3
IR + CHBP + CASP3siRNA vs. IR + CHBP, top five upregulated and downregulated genes
The genes in italic were discussed for their potential function in IR-induced AKI. P < 0.05.
Accession Number Gene Symbol Gene Name Fold Change Upregulated NM_001001450 SSXB2 Synovial sarcoma, X member B, breakpoint 2 14.730 NR_028111 4930523C07RIK RIKEN cDNA 4930523C07 gene 10.131 NM_011414 SLPI Secretory leukocyte peptidase inhibitor 8.478 NM_009253 SERPINA3M Serine (or cysteine) peptidase inhibitor, clade A, member 3M 8.289 NM_175309 UPK3B Uroplakin 3B 5.483 Downregulated AK016105 4930553I04RIK RIKEN cDNA 4930553I04 gene −8.735 NM_029747 2410137M14RIK RIKEN cDNA 2410137M14 gene −5.134 NM_147025 OLFR380 Olfactory receptor 380 −4.354 NM_134160 MCOLN3 Mucolipin 3 −4.142 NM_001163513 DLG5 Discs large MAGUK scaffold protein 5 −3.700 - TABLE 4
IR + CHBP + CASP3siRNA vs. IR + CHBP + NCsiRNA, top five upregulated and downregulated genes
Genes in italic indicate analysis by qPCR and were discussed as biomarker candidates of IR-induced AKI. P < 0.05.
Accession Number Gene Symbol Gene Name Fold Change Upregulated NM_011824 GREM1 Gremlin 1 15.987 NM_001001450 SSXB2 Synovial sarcoma, X member B, breakpoint 2 14.817 NM_026433 TMEM100 Transmembrane protein 100 9.749 NM_011825 GREM2 Gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis) 9.312 NM_007729 COL11A1 Collagen, type XI, alpha 1 8.978 Downregulated AK041888 ANGPTL2 Angiopoietin-like 2 −24.390 AF107847 GNAS GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus −12.195 AK081320 ZFYVE9 Zinc finger, FYVE domain containing 9 −7.576 NM_010258 GATA6 GATA binding protein 6 −6.711 NM_026648 DNAAF1 Dynein, axonemal assembly factor 1 −6.579
In this issue
CHBP and Caspase-3 siRNA Protected IR Kidneys
