Abstract
Neurodevelopmental disorder with involuntary movements (Online Mendelian Inheritance in Man: 617493) is a severe, early onset neurologic condition characterized by a delay in psychomotor development, hypotonia, and hyperkinetic involuntary movements. Heterozygous de novo mutations in the GNAO1 gene cause neurodevelopmental disorder with involuntary movements. Gαo, the gene product of GNAO1, is the alpha subunit of Go, a member of the heterotrimeric Gi/o family of G proteins. Go is found abundantly throughout the brain, but the pathophysiological mechanisms linking Gαo functions to clinical manifestations of GNAO1-related disorders are still poorly understood. One of the most common mutant alleles among the GNAO1 encephalopathies is the c.626G>A or p.Arg209His (R209H) mutation. We developed heterozygous knock-in Gnao1+/R209H mutant mice using CRISPR/Cas9 methodology to assess whether a mouse model could replicate aspects of the neurodevelopmental disorder with involuntary movements clinical pattern. Mice carrying the R209H mutation exhibited increased locomotor activity and a modest gait abnormality at 8–12 weeks. In contrast to mice carrying other mutations in Gnao1, the Gnao1+/R209H mice did not show enhanced seizure susceptibility. Levels of protein expression in multiple brain regions were unchanged from wild-type (WT) mice, but the nucleotide exchange rate of mutant R209H Gαo was 6.2× faster than WT. The atypical neuroleptic risperidone has shown efficacy in a patient with the R209H mutation. It also alleviated the hyperlocomotion phenotype observed in our mouse model but suppressed locomotion in WT mice as well. In this study, we show that Gnao1+/R209H mice mirror elements of the patient phenotype and respond to an approved pharmacological agent.
SIGNIFICANCE STATEMENT Children with de novo mutations in the GNAO1 gene may present with movement disorders with limited effective therapeutic options. The most common mutant variant seen in children with GNAO1-associated movement disorder is R209H. Here we show, using a novel Gnao1+/R209H mouse, that there is a clear behavioral phenotype that is suppressed by risperidone. However, risperidone also affects wild-type mouse activity, so its effects are not selective for the GNAO1-associated movement disorder.
Introduction
Gαo is the alpha subunit of the heterotrimeric G protein Go. It is the most abundant heterotrimeric G protein in the central nervous system, comprising 1% of mammalian brain membrane protein. Mutations in GNAO1, which encodes Gαo, have been linked to two distinct neurologic conditions. In 2013, four children with early infantile epileptic encephalopathy were identified with mutations in GNAO1 (Nakamura et al., 2013). Since then, a growing number of patients presenting with epilepsy and/or hyperkinetic movement disorders have been found to exhibit de novo mutations in GNAO1 (Feng et al., 2017, 2018). It was recognized in 2016 that some GNAO1 mutations result in movement disorders without epilepsy (Kulkarni et al., 2016; Saitsu et al., 2016). To date, there are over 70 published cases of children with mutations in GNAO1 presenting with early infantile epileptic encephalopathy 17 (Online Mendelian Inheritance in Man 615473) and/or neurodevelopmental disorder with involuntary movements (Online Mendelian Inheritance in Man 617493) (Nakamura et al., 2013; EuroEPINOMICS-RES Consortium et al., 2014; Law et al., 2015; Talvik et al., 2015; Ananth et al., 2016; Dhamija et al., 2016; Epi4K Consortium, 2016; Gawlinski et al., 2016; Kulkarni et al., 2016; Marcé-Grau et al., 2016; Menke et al., 2016; Saitsu et al., 2016; Yilmaz et al., 2016; Arya et al., 2017; Danti et al., 2017; Sakamoto et al., 2017; Schorling et al., 2017; Blumkin et al., 2018; Bruun et al., 2018; Gerald et al., 2018; Honey et al., 2018; Koy et al., 2018; Marecos et al., 2018; Okumura et al., 2018; Rim et al., 2018; Takezawa et al., 2018; Waak et al., 2018; Xiong et al., 2018; Kelly et al., 2019; Schirinzi et al., 2019).
More than 40 pathologic variants of GNAO1 have been reported. Using a cell-based biochemical signaling assay, we classified many of those Gαo variants for their ability to inhibit cAMP production in transfected human embryonic kidney (HEK) 293 cells (Feng et al., 2017). Some mutant Gαo proteins were unable to support receptor-mediated inhibition of cAMP, which classifies them as having a loss-of-function mechanism in vitro. These loss-of-function mutants were associated with epilepsy (Feng et al., 2017). In contrast, mutations resulting in enhanced cAMP inhibition [gain-of-function (GOF)] or normal cAMP regulation were generally associated with movement disorders (Feng et al., 2017).
To permit mechanistic studies and preclinical drug testing, we had previously created a mouse model with a GNAO1 GOF mutation, G203R, that was identified in patients who showed both epilepsy and movement disorders (Saitsu et al., 2016). As predicted, the Gnao1+/G203R (G203R) mutant mice exhibited motor coordination and gait abnormalities as well as enhanced seizure susceptibility in pentylenetrazol (PTZ) kindling studies (Feng et al., 2019). The R209H mutations are some of the most common pathogenic GNAO1 mutations (Schirinzi et al., 2019). Patients with de novo, heterozygous R209H mutations in GNAO1 display severe choreoathetosis and dystonia but do not exhibit seizures (Supplemental Table 1). Interestingly, the R209H mutation was found to have essentially normal function for cAMP inhibition in HEK293T cells. Despite this normal function in an in vitro assay, it causes a severe form of movement disorder in patients, often requiring intensive care unit admission (Ananth et al., 2016; Marecos et al., 2018). This discrepancy between the normal functionality in vitro and its clear clinical pathologic role makes the R209H mutation of substantial interest for in vivo physiologic studies.
We used a battery of behavioral tests to measure motor skills in heterozygous Gnao1+/R209H mutant mice as well as PTZ kindling studies to assess seizure susceptibility. As expected, Gnao1+/R209H mice did not show enhanced seizure susceptibility in PTZ kindling studies. Male and female Gnao1+/R209H mice displayed significant hyperactivity in an open field assessment. This finding was surprising because mice in our previous GNAO1-related movement disorder model, Gnao1+/G203R, did not show significant differences on the open field test (Feng et al., 2019). This difference in movement phenotype is consistent with the wide heterogeneity of movement patterns displayed by patients with GNAO1 mutations (Nakamura et al., 2013; Ananth et al., 2016; Dhamija et al., 2016; Kulkarni et al., 2016; Marcé-Grau et al., 2016; Menke et al., 2016; Feng et al., 2018).
Having a mouse model with a strong movement phenotype facilitates mechanistic studies of GNAO1 mutants, and this allowed us to begin allele-specific preclinical drug testing. The neuroleptic risperidone was reportedly beneficial in a patient with a GNAO1 R209H mutation (Ananth et al., 2016). Here we show risperidone attenuates hyperactivity in our R209H mutant mice. This suggests risperidone or related agents may be beneficial for GNAO1 patients with the R209H mutation.
Materials and Methods
Animals.
Gnao1+/R209H mice on a C57BL/6J background were generated in the Michigan State University Transgenic and Gene Editing Facility (https://tgef.vprgs.msu.edu) as described below. Mice (8–12 weeks old) were housed on a 12-hour light/dark cycle with ad libitum access to food and water. All experiments were performed in accordance with National Institutes of Health guidelines, and protocols were approved by the Michigan State University Institutional Animal Care and Use Committee.
Generation of Gnao1 R209H Edited Mice.
Mutant Gnao1+/R209H mice were generated via CRISPR/Cas9 genome editing on a C57BL/6J genomic background. CRISPR guide RNA (gRNA) selection and locus analysis were performed using the Benchling platform (Benchling, Inc., San Francisco, CA). A gRNA targeting exon 6 of the Gnao1 locus (ENSMUSG00000031748) was chosen to cause a double-strand DNA break 3 bp downstream of codon R209. A single-stranded oligodeoxynucleotide (ssODN) carrying the R209H mutation CGC > CAC with short homology arms was used as a repair template (Fig. 1; Table 1). Ribonucleoprotein complexes consisting of a synthetic CRISPR RNA/trans-activating CRISPR RNA hybrid and Alt-R S.p. Cas9 Nuclease V3 protein (Integrated DNA Technologies, Inc., Coralville, IA) were used to deliver CRISPR components along with the ssODN to mouse zygotes via electroporation as previously described (Feng et al., 2017, 2019). Edited embryos were implanted into pseudo-pregnant dams using standard techniques. Resulting litters were screened by polymerase chain reaction (PCR) (Phire Green HSII PCR Mastermix, F126L; Thermo Fisher, Waltham, MA), T7 Endonuclease I assay (M0302; New England Biolabs Inc.), and Sanger sequencing (GENEWIZ, Inc., Plainfield, NJ) for edits of the target site.
Genotyping and Breeding.
Studies were done on N1 R209H heterozygotes with comparisons to littermate controls. To generate Gnao1+/R209H heterozygotes (N1 backcross), two founder Gnao1+/R209H mice, one male and one female, were crossed with wild-type (WT) C57BL/6J mice obtained directly from The Jackson Laboratory (Bar Harbor, ME).
DNA was extracted by an alkaline method (Kehrl et al., 2014) from ear clips done before weaning. PCR products were generated with primers flanking the mutation site (Forward 5′ GGACAGGTGTCACAGGGGAT 3′; 5′ ACTGGCCTCCCTTGGCAATA 3′), which produces a 375-bp product. Reaction conditions were: 0.8 μl template, 4 μl 5× Promega PCR buffer, 0.4 μl 10 mM deoxyribonucleotide triphosphates, 1 μl 10 μM Forward Primer, 1 μl 10 μM Reverse Primer, 0.2 μl Promega GoTaq, and 12.6 μl DNase free water (catalog no. M3005; Promega, Madison, WI). Samples were denatured for 4 minutes at 95°C and then underwent 32 cycles of PCR (95°C for 30 seconds, 63°C for 30 seconds, and 72°C for 30 seconds) followed by a 7-minute final extension at 72°C. Ethanol precipitation was done on the PCR products, and then samples were sent for Sanger sequencing (GENEWIZ, Inc., Plainfield, NJ).
Behavioral Assessment.
Male and female Gnao1+/R209H mice (8–12 weeks of age) and their Gnao1+/+ littermates underwent a battery of behavioral testing to assess motor phenotype as described previously (Feng et al., 2019). Before each experiment, mice were acclimated for 10 minutes to the testing room. Experiments were performed by two female researchers. All behavioral studies were done by individuals who were blind to the genotype of the animals until completion of data collection.
Open Field.
The open field test is frequently used to assess locomotion, exploration, and anxiety (Tatem et al., 2014; Seibenhener and Wooten, 2015; Feng et al., 2019). The test was conducted in Fusion VersaMax clear 42 × 42 × 30 cm arenas (Omnitech Electronics, Inc., Columbus, OH). Gnao1+/R209H mice of both sexes and their littermates were placed in the arena for 30 minutes. Using the Fusion Software, we evaluated distance traveled (cm) in terms of novelty, sustained, and total movement corresponding to the first 10 minutes, 10–20 minutes, and total of 30 minutes. As a potential measure of anxiety, the fraction of time spent in the center was assessed. The center area was defined as the 20.32 × 20.32 cm area within the middle of the arena.
Rotarod.
To assess motor skills, we used the Economex accelerating RotaRod (Columbus Instruments, Columbus, OH). The protocol occurred over a 2-day period. On day 1, mice were trained for three 2-minute training sessions, with 10 minutes between each training trial. During the first two sessions, the RotaRod maintained a constant rotational speed of 5 rpm. The third training trial started at 5 rpm and accelerated at 0.1 rpm/s for 2 minutes. The following day, mice ran three more trials with a 10-minute break in between: two more 2-minute training trials and a final 5-minute test trial. Each of these trials started at 5 rpm with constant acceleration of 0.1 rpm/s. For all training and test trials, latency to fall off the spindle was recorded in seconds.
Grip Strength.
To assess mouse grip strength, we used seven homemade weights (10, 18, 26, 34, 42, 49, and 57 g) with a 2.54-cm ring for the mouse to grasp. The mouse was held by the middle/base of the tail and lowered to the weight. Once the mouse grasped the weighted ring with its forepaws, the mouse was lifted until the weight cleared the bench. For each weight, the mouse was given up to three trials to suspend the weight above the table for 3 seconds. If cleared, the next heaviest weight was tried. If the weight was not held, the total time and maximum weight lifted were recorded, and a grip strength score was calculated from Deacon et al. (2016). The calculated score was normalized to mouse body weight, which was measured the day of the test.
DigiGait.
Mouse gait analysis was performed on a DigiGait apparatus (Mouse Specifics, Inc, Framingham, MA). After acclimation, each mouse was placed on the treadmill at speeds of 18, 20, 22, 25, 28, 32, and 36 cm/s. A 10-second clip was recorded with a video camera located below the belt. There was a 5-minute rest between each speed. Recordings were analyzed with the DigiGait analysis program to assess the prespecified parameters of stride length and paw angle variability. Values for all four paws were averaged to give one value per mouse—the reported n values are the number of mice. In addition, the maximum speed at which each mouse was able to successfully complete a 10-second test after three attempts was recorded as described (Feng et al., 2019).
PTZ Kindling Study.
A PTZ kindling protocol was performed as described (Kehrl et al., 2014; Feng et al., 2019) to assess mouse susceptibility to seizure induction. Mice were injected with a subconvulsive dose of PTZ (40 mg/kg, i.p.) every other day for up to 24 days, and mice then were observed for 30 minutes postdose. Kindling was defined as death or tonic-clonic seizures on two consecutive injection days, after which mice were euthanized. Kaplan-Meier survival analysis was done based on the number of injections to achieve kindling.
Gαo Protein Expression.
Mice (6–8 weeks old) were sacrificed, and their brains were dissected into different regions and flash-frozen in liquid nitrogen. For Western blot analysis, tissues were thawed on ice and homogenized for 5 minutes with 0.50-mm zirconium beads in a Bullet Blender (Next Advance, Troy, NY) in radioimmunoprecipitation assay (RIPA) buffer (20 mM Tris-HCl, pH7.4; 150 mM NaCl; 1 mM EDTA; 1 mM β-glycerophospate; 1% Triton X-100; and 0.1% SDS) with protease inhibitor (Roche/1 tablet in 10 ml RIPA). Sample homogenates were centrifuged for 5 minutes at 4°C at 13,000g. Supernatants were collected and protein concentrations determined using the bicinchoninic acid method (Pierce, Rockford, IL). Protein concentration was normalized for all tissues with RIPA buffer, and 2× SDS sample buffer containing β-mercaptoethanol (Sigma-Aldrich) was added. Thirty micrograms of protein was loaded onto a 12% 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol SDS-PAGE gel, and samples were separated for 1.5 hours at 160 V. Proteins were then transferred to an Immobilon-FL polyvinylidene difluoride membrane (Millipore, Billerica, MA) on ice either for 2 hours at 100 V, 400 mA or overnight at 30 V, 50 mA. Immediately after transfer, polyvinylidene difluoride membranes were washed and blocked in Odyssey PBS blocking buffer (LI-COR) for 40 minutes at room temperature. The membranes were then incubated with anti-Gαo (rabbit; 1:1000; sc-387; Santa Cruz biotechnologies, Santa Cruz, CA) and anti-actin (goat; 1:1000; sc-1615; Santa Cruz) antibodies diluted in Odyssey blocking buffer with 0.1% Tween-20 overnight at 4°C. Following four 5-minute washes in phosphate-buffered saline with 0.1% Tween-20, the membrane was incubated for 1 hour at room temperature with secondary antibodies (both 1:10,000; IRDye 800CW Donkey anti-rabbit; IRDye 680RD Donkey anti-goat; LI-COR Biosciences) diluted in Odyssey blocking buffer with 0.1% Tween-20. The membrane was subjected to four 5-minute washes in PBS–Tween-20 and a final rinse in PBS for 5 minutes. The membrane was kept in the dark, and the infrared signals at 680 and 800 nm were detected with an Odyssey Fc image system (LI-COR Biosciences). The Gαo polyclonal antibody recognizes an epitope located between positions 90–140 Gαo (Santa Cruz Technical Support, personal communication), so there should be no interference from the R209H mutation.
Kinetics of Nucleotide Binding.
To estimate GDP release rates, which can control activation of G proteins, we measured the kinetics of binding of the fluorescent ligand 4–4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacine-3-yl (BODIPY-FL)-GTPγS as described previously (McEwen et al., 2002). In brief, WT and mutant His6-tagged Gαo subunits were expressed in Escherichia coli and purified by Ni-nitrilotriacetic acid affinity chromatography as previously described (Lee et al., 1994) and stored frozen at −80 C in 50 mM HEPES 100 mM NaCl buffer containing 50 μM GDP to stabilize the protein. Protein was diluted to 200 nM in binding buffer (50 mM HEPES, 10 mM MgCl2, 1 mM EDTA, and 1 mM dithiothreitol, pH 8.0), and then 100 nM BODIPY-GTPγS was added, and fluorescence was monitored at 485 nm excitation, 510 nm emission in a Tecan Infinite M1000 Pro microplate reader at 24°C. Experiments were done on three different days each in duplicate, and results were averaged. Rate constants and t1/2 were determined by fitting results to the equation Y = Y0 + (Ymax − Y0)*(1 − e−k*t) in GraphPad Prism v. 8, in which Y0 was constrained to be shared between the WT and R209H mutant data sets.
Risperidone Effects on Motor Behavior.
Naïve 8–12-week-old Gnao1 +/R209H and Gnao1 +/+ littermates of either sex were tested for effects of risperidone on their activity in the open field arena. The study was run over 5 days: On day 1, mice underwent the open field protocol described above to establish a baseline. On day 3, mice were habituated in the experimental room for 10 minutes and then given a single intraperitoneal dose of 2.0 mg/kg risperidone (Cayman Chemical, Ann Arbor, MI) or vehicle control. Risperidone was dissolved in DMSO at a concentration of 5 mg/ml, and further dilutions were done in deionized water. Thirty minutes following injection, mice were placed in the open field arena for a 30-minute testing time. On day 5, mice were retested in the same open field protocol without injection to assess drug washout. A week later, the same protocol was followed to test the effects an intraperitoneal dose of 0.5 mg/kg risperidone had on the WT and R209H mice.
Statistical Analysis.
Data were analyzed with unpaired Student’s t test or Mantel-Cox and two-way ANOVA with Bonferroni corrections as appropriate using GraphPad Prism 7.0 (GraphPad, La Jolla, CA). A P < 0.05 was considered the cutoff for significance throughout. Detailed discussion of statistical analyses can be found within figure legends.
Results
Gnao1+/R209H Mice Are Produced at the Expected Frequency and Have Normal Viability.
Two founder Gnao1+/R209H mice, one male and one female, were crossed with C57BL/6J mice. Out of 98 offspring of a cross of Gnao1+/R209H with WT mice, 51 heterozygotes and 47 WT were observed. Gnao1+/R209H mice exhibit no overt postural or movement abnormalities or seizures under normal housing conditions. Adult mice showed no statistically significant differences in weight between WT and Gnao1+/R209H genotypes of either sex.
Both Male and Female Gnao1+/R209H Show Significant Hyperactivity in the Open Field Arena but No Significant Differences on the Rotarod or Grip Strength Test.
Patients with R209H mutations present with hyperkinetic movement disorders (Ananth et al., 2016; Dhamija et al., 2016; Menke et al., 2016). To detect motor abnormalities, Gnao1+/R209H mice were subjected to a battery of behavioral tests. The open field arena was used to test overall locomotor activity. We divided the test into two sections reflecting activity in a novel environment (0–10 minutes) and then sustained activity (10–30 minutes). Gnao1+/R209H mice of both sexes showed markedly increased activity in the sustained activity period compared with their wild-type littermates (Fig. 2B). Females also had significantly increased activity in the first 10 minutes (novelty period, Fig. 2B). As a potential indicator of anxiety-like behavior, male and female Gnao1+/R209H mice also displayed reduced time in center (Fig. 2, A and B).
An accelerating RotaRod test was used to assess motor coordination and balance. Neither male nor female Gnao1+/R209H mice displayed impaired performance (Fig. 2C). Also, grip strength showed no differences between Gnao1+/R209H and wild-type littermates of either sex (Fig. 2D).
Male Gnao1+/R209H Mice Display a Modestly Reduced Stride Length.
Gait patterns were assessed using DigiGait analysis. Male Gnao1+/R209H mice (Fig 3, B) showed a highly significant genotype effect with reduced stride length compared with wild-type littermates (P < 0.001, two-way ANOVA), but the magnitude of the effect was modest (5.6% decrease averaged across all speeds). In posttest analysis, only the top speed (36 cm/s) reached significance individually (P < 0.01). Female Gnao1+/R209H mice did not show significant differences in stride length from WT (Fig. 3, A). However, as previously reported for G203R mutant mice, the female Gnao1+/R209H showed a significantly reduced maximum run speed on the treadmill (Fig. 3E P < 0.01, t test). This was not due to reduced body size because length, as detected by the DigiGait system (WT 9.54 cm: vs. R209H 10.17 cm), and weights were not significantly different. There was no significant difference in paw angle variability for either males or females. All parameters of DigiGait analysis are shown in Supplemental Tables 3 and 4, and false discovery rate calculation probed of significantly different parameters from the DigiGait data in Gnao1+/R209H mice is shown in Supplemental Fig. 2.
Gnao1+/R209H Mice Are Not Sensitive to PTZ Kindling.
Repeated application of a subthreshold convulsive stimulus leads to the generation of full-blown convulsions in a process called kindling (Dhir, 2012). GNAO1 variants differ in their ability to cause epileptic seizures in patients. Those carrying the R209H mutant allele do not exhibit a seizure disorder (Ananth et al., 2016; Kulkarni et al., 2016; Menke et al., 2016). In accordance with the patients’ pattern, Gnao1+/R209H mice did not show increased susceptibility to kindling-induced seizures (Fig. 4). This contrasts with our previous report of increased kindling sensitivity in male G203R and female G184S mutant mice (Kehrl et al., 2014; Dhamija et al., 2016; Feng et al., 2019).
Gnao1+/R209H Mice Have Normal Gαo Protein Expression in the Brain.
To understand why R209H mutant mice do not show a phenotypic difference in the kindling test while G203R mutants do, we assessed Gαo protein expression levels. Cortex, hippocampus, striatum, cerebellum, brain stem, and olfactory bulb were harvested and homogenized to measure the effect of the R209H mutation on Gαo protein expression. Western blots showed no difference in Gαo protein expression between WT and Gnao1+/R209H mice in any of the measured brain regions (Fig. 5, A and B). This is consistent with our previous analysis of protein expression in HEK293T cells with transiently transfected Gαo R209H plasmid (Feng et al., 2017). The normal expression of the R209H mutant contrasts with the reduced expression of Gαo in brains of Gαo +/G203R mutant mice (Feng et al., 2019).
Kinetics of Nucleotide Binding to Mutant Gαo.
Both patients and mice heterozygous for the Gαo R209H mutation display movement phenotypes; however, the mutant Gαo supports normal cAMP regulation in the cell-based cAMP assay (Feng et al., 2017). To consider possible mechanisms for this discrepancy, we measured the rate of GDP release from mutant Gαo using the BODIPY-GTPγS binding kinetics method (McEwen et al., 2002). The rate of GTPγS binding to WT Gαo was slow (T1/2 1261 seconds, Fig. 5C), as expected. The R209H mutant Gαo showed markedly faster binding of BODIPY-GTPγS (T1/2 203 seconds 6.2× faster than WT, Fig. 5, C and D), suggesting a faster rate of GDP release. In addition to the faster rate of binding, the amplitude of binding was lower for the R209H mutant. Though this lower amplitude of binding might be due to either a lower affinity of the mutant for the BODIPY-GTPγS or to instability under the binding conditions, we do show that the R209H mutant definitely does have abnormal interactions with nucleotides—GDP and/or GTP.
Risperidone Treatment Attenuated the Hyperactivity of Gnao1+/R209H Mice.
Patients with GNAO1 mutations were tried on multiple drugs to alleviate motor symptoms (Supplemental Table 1). Risperidone, an atypical antipsychotic drug, showed beneficial effects in one of the patients. It has also been effective in drug-induced dyskinesia (Carvalho et al., 2003). We show that Gnao1+/R209H mice exhibit complete abrogation of movement at 2 mg/kg risperidone, which recovered upon retesting 2 days later (Fig. 6, A and C). WT mice also show a significant decrease in locomotion after 2 mg/kg risperidone treatment (Fig. 6A). After a single 0.5 mg/kg dose of risperidone, both WT and Gnao1+/R209H mice exhibit a decrease in locomotion compared with vehicle-treated littermates (Fig. 6B). As expected, hyperactivity of mutant mice was observed during baseline testing on day 1, and the hyperactivity had returned on day 5 following the 2-day washout period after the risperidone doses (Fig. 6C). Neither 2.0 mg/kg nor 0.5 mg/kg selectively affected Gnao1+/R209H, as assessed by percent suppression of distance traveled (Supplemental Fig. 1).
Discussion
We have developed a novel mouse model carrying an R209H mutation in the Gnao1 gene that leads to a serious movement disorder (Ananth et al., 2016; Dhamija et al., 2016). Though GNAO1 mutations are rare in humans, the R209H mutation is the second most common found in patients with GNAO1-related disorders. The mice have a clear movement phenotype confirming the pathologic nature of this mutation despite earlier work showing that it could normally support receptor-mediated regulation of cAMP in HEK cells (Feng et al., 2017). This model will provide a powerful tool to both understand neural mechanisms of the dysfunction of the R209H Gαo protein as well as permit preclinical drug repurposing studies.
The goal of personalized medicine is to define treatments for an individual patient. Knowing which gene is involved is beneficial, but different mutant alleles, even in the same gene, can produce quite distinct effects. Here we report a second mouse model of GNAO1-related neurologic abnormalities. The Gnao1 R209H mutant mice display motor abnormalities but no seizures, which differs from our previous Gnao1 G203R mouse model (Feng et al., 2019). This is consistent with the clinical pattern of patients with GNAO1 R209H, who present with neurodevelopmental delay with involuntary movements without seizures (Ananth et al., 2016; Dhamija et al., 2016).
The specific movement abnormalities seen with the Gnao1 R209H mutant mice were somewhat unexpected; our previous mouse model, Gnao1+/G203R, showed significant motor impairments in RotaRod and DigiGait but had no changes in the open field test (Feng et al., 2019). In contrast, the Gnao1 R209H mutant mice reported here have profound hyperactivity in the open field test and either no or only modest deficits in RotaRod and DigiGait analysis. Patients with the G203R or R209H mutations both display movement disorder, with choreathetosis and dystonia as the most common patterns (Saitsu et al., 2016; Feng et al., 2018). Interestingly, patients with the R209H mutation have somewhat more choreoathetosis compared with those with the G203R mutation, although they display similar frequencies of dystonia (Feng et al., 2018). Such differences in patient phenotype may relate to the differences in the animal models’ behavior. In looking at the behavior of the R209H model specifically, the striking hyperactivity of the male R209H mutant mice points to increased dopamine signaling in the striatum as a possible mechanism. Suppression of that hyperactivity with risperidone is consistent with that mechanism.
The two movement disorder–associated GNAO1 mutations R209H and G203R also have different patterns in in vitro studies of cAMP regulation in HEK293T cells (Feng et al., 2017). Interestingly, the Gαo R209H mutant supports normal cAMP regulation and is expressed at normal levels both in HEK cells (Feng et al., 2017) and in the brain (this study). In contrast, the G203R mutant is expressed at lower levels both in HEK cells (Feng et al., 2017) and in the mouse brain (Feng, H. Unpublished doctoral dissertation). Despite lower expression, it signals more strongly (GOF) in the HEK cell assay.
We also present two new pieces of information that provide insights into the pathogenicity of the R209H mutant Gαo, despite its normal function in the HEK cell cAMP assay. Using a fluorescent nucleotide exchange assay with pure R209H mutant Gαo, we demonstrate that the rate of binding of the GTP analog is ∼6.2× faster than that of WT. This is typical for many hyperactive G protein mutants, since GDP release is the rate-limiting step for activation. Indeed, receptors enhance GDP release rates to activate the G protein (Iiri et al., 1994; Leyme et al., 2014; Toyama et al., 2017). Constitutive activation of Gαo by the R209H mutant could lead to enhanced signaling in the indirect pathway, D2 dopamine receptor neurons in striatum. The striatum is a site of substantial Gαo expression, and enhanced Gαo signaling could contribute to the hyperactivity phenotype seen in our studies. More detailed mechanistic studies of striatal neurons will be needed to further elucidate the downstream signaling mechanisms protein (e.g., ion channels, synaptic vesicle release, or neurite outgrowth) engaged by the mutant Go in these mice and in patients.
Effective treatments are a key goal, as patients with the R209H mutation experience repeated hospitalizations (Ananth et al., 2016; Marecos et al., 2018; Schirinzi et al., 2019). Deep brain stimulation in the internal globus pallidus has proven effective in patients with GNAO1 in attenuating the movement disorder (Kulkarni et al., 2016; Yilmaz et al., 2016; Honey et al., 2018; Koy et al., 2018). However, that invasive treatment is reserved for patients who are refractory. Risperidone is one of the oral treatments that has proven to be beneficial, specifically in a patient with the R209H mutation (Ananth et al., 2016). Risperidone is an atypical neuroleptic that antagonizes D2 and 5-HT receptors. Gαo couples to myriad G protein–coupled receptors, including the dopamine D2 receptor, which is involved in movement control (Neve et al., 2004). In our study, risperidone was able to significantly decrease the hyperlocomotion seen in our Gnao1+/R209H mouse model. At both the 0.5 and 2.0 mg/kg doses of risperidone, hyperactivity was attenuated in our R209H mouse model. However, this response was not selective for the Gnao1+/R209H mutant mice because the WT mice also displayed a significant decrease in locomotion. This outcome suggests that risperidone treatment may be effective in repressing global movement while not specifically targeting a Gnao1 R209H mechanism.
The new mouse model described here should provide a valuable tool for future mechanistic studies of GNAO1 encephalopathies. The fact that the mouse had very distinct behavioral changes compared with our previous Gnao1 mutant mouse models (R209H and G184S) indicates that it is very important to consider the mutant allele as well as the mutant gene in considering genetic disorders and personalized therapies.
Acknowledgments
The authors thank Dr. Michelle Mazei-Robison for her advice on organizing the behavioral battery experiments on our mutant mouse models.
Authorship Contributions
Participated in research design: Larrivee, Feng, Shaw.
Conducted experiments: Larrivee, Feng, Quinn, Shaw, Leipprandt.
Contributed new reagents or analytic tools: Demireva, Xie.
Performed data analysis: Larrivee, Feng, Shaw.
Wrote or contributed to the writing of the manuscript: Larrivee, Feng, Demireva, Neubig.
Footnotes
- Received September 28, 2019.
- Accepted December 27, 2019.
This work was supported by a grant from the Bow Foundation [2], Michigan State University’s (MSU’s) department of Comparative Medicine and Integrative Biology, and the MSU discretionary funding initiative [34149].
↵This article has supplemental material available at jpet.aspetjournals.org.
Abbreviations
- BODIPY
- boron-dipyrromethene
- GOF
- gain-of-function
- gRNA
- guide RNA
- HEK
- human embryonic kidney
- PCR
- polymerase chain reaction
- PTZ
- pentylenetrazol
- RIPA
- radioimmunoprecipitation assay
- ssODN
- single-stranded oligodeoxynucleotide
- WT
- wild type
- Copyright © 2020 by The American Society for Pharmacology and Experimental Therapeutics