Article Figures & Data
Figures
- Fig. 1.
APAP attenuates the inflammatory response to HDM. (A) HDM model timeline with APAP administration either for 5 days during week 1 or 4 days during week 2. Mice were administered either a 1.25 or 10 µg dose of HDM in either of the weeks of the 2-week protocol. Mice were euthanized and BAL was performed on day 12. Black arrows above the timeline represent days mice received doses of HDM and or APAP. (B) BAL cells of mice administered either vehicle control (HDM control), APAP during week 1 (HDM + APAP Wk1), or APAP during week 2 (HDM+APAP Wk2), and a 1.25 or 10 µg dose of HDM (intranasal). Differential cell count data are presented as mean cells/ml ± S.E.M. (n = 5 mice/group, except for HDM+APAP Wk2 1.25 µg, where n = 4). (C) Protein levels represented as mean percent of control ± S.E.M. in BAL fluid supernatants (n = 5 mice/group). The black line at y = 100% represents the mean of the pooled control values (n = 10 mice/group) and the dotted lines represent ± the S.E.M. Controls averaged 116.6 ± 4.0 µg/ml total protein. Data were analyzed by analysis of variance followed by Newman-Keuls test. Separate analyses were performed for the 1.25 and 10 µg dose groups. Groups with differing superscripts differ from each other at the P < 0.05 level. All data are representative of two independent experiments.
- Fig. 2.
Time course of the effect of APAP on the HDM-induced inflammatory response. Mice were administered APAP during week 2 (days 8–11), along with a 1.25 µg dose of HDM following the same dosing regimen as in (A). BAL fluid was collected from separate groups of mice during each day of week 2. (A–D) BAL cell data are presented as mean cells/ml ± S.E.M. (n = 4–6 mice/group) [* P < 0.05 compared with HDM; analysis of variance (ANOVA) with Newman-Keuls test]. No inflammatory cell types were observed in control groups. (E) Protein levels in BAL fluid supernatants represented as mean percent of control ± S.E.M. (n = 5 mice/group). The vehicle control and APAP alone groups were not significantly different; therefore, they were pooled to form the control group (black line at y = 100%, n = 10 mice/group). Controls averaged 113.1 ± 4.2 µg/ml total protein. Dotted lines represent control mean ± S.E.M. Data were analyzed by ANOVA followed by Newman-Keuls test; line and bars with differing superscripts differ from each other at the P < 0.05 level. All data are representative of two independent experiments.
- Fig. 3.
Time courses of gene induction in the lung for selected genes modulated by HDM and APAP: (A) Il-4, (B) Il-5, (C) Muc5AC, (D) Mip2, and (E) Cyp2E1. Lung tissue was collected from groups of mice on days 8, 10, and 12 of the time course experiment. For all genes analyzed, the vehicle control and APAP alone groups did not differ significantly; therefore, they were combined to form a pooled control group for statistical analysis. Individual gene names are indicated at the top of each graph, and data are presented as mean fold increase ± S.E.M. over pooled control (black line at y = 1). Dotted line represents control mean ± S.E.M. Lines and bars with differing superscripts differ at the P < 0.05 level (analysis of variance with Newman-Keuls test). Data are representative of two independent experiments (n = 4–6 mice/group).
- Fig. 4.
Effect of P450 inhibition on attenuation of HDM response by APAP. Treatment of animals with 5-PP 1 hour prior to APAP treatment began once per day on day 8 and ended on day 9. BAL was performed on day 10. A 1.25 µg dose of HDM was used. (A–D) Differential cell count data are presented as mean cells/ml ± S.E.M. (n = 4–6 mice/group). Bars with differing superscripts differ at the P < 0.05 level (analysis of variance with Newman-Keuls test). No inflammatory cell types were observed in control groups and data are representative of two independent experiments.
- Fig. 5.
HDM-exposed mice demonstrate moderate perivascular/peribronchiolar inflammation, which is largely absent in APAP-treated mice. Lungs were fixed in formalin, sectioned, and stained with hematoxylin and eosin (H&E) or PAS. (A–D) Arrows indicate examples of perivascular/peribronchiolar inflammation (H&E × 200). (E–H) Arrows indicate examples of mucus production by airway goblet cells (PAS × 200). Images are representative of lungs from each group indicated above each image column, and two independent experiments (n = 3 mice/group).
Tables
Gene Name Function Reference Il-4 Interleukin 4 Th2-type cytokine response Lambrecht and Hammad (2015) Il-5 Interleukin 5 Th2-type cytokine response Lambrecht and Hammad (2015) Il-13 Interleukin 13 Th2-type cytokine response Lambrecht and Hammad (2015) CaSR Calcium-sensing receptor Airway inflammation, hyper-responsiveness Yarova et al. (2015) Muc5AC Mucin 5AC Airway mucus gel formation Evans et al. (2015) Mip2 Macrophage inflammatory protein 2 Neutrophil chemotactic factor Wolpe et al. (1989) iNos Inducible nitric oxide synthase Mast cell activation, smooth muscle tone Coleman (2002) Cyp2E1 Cytochrome P450, family 2, subfamily E APAP metabolism to NAPQI Hinson et al. (2010) Nqo1 NAD(P)H dehydrogenase, quinone 1 Detoxification of NAPQI Moffit et al. (2007) NAPQI, N-acetyl-p-benzoquinone-imine.
Gene Forward Reverse β-Actin GCAACGAGCGGTTCCG CCCAAGAAGGAAGGCTGGA Il-4 CGAGCTCACTCTCTGTGGTG TGAACGAGGTCACAGGAGAA Il-5 CTCTGTTGACAAGCAATGAGACG TCTTCAGTATGTCTAGCCCCTG Il-13 CCTGGCTCTTGCTTGCCTT GGTCTTGTGTGATGTTGCTCA CaSR AGCAGGTGACCTTCGATGAGT ACTTCCTTGAACACAATGGAGC Muc5AC CTGTGACATTATCCCATAAGCCC AAGGGGTATAGCTGGCCTGA Mip2 CCAACCACCAGGCTACAGG GCGTCACACTCAAGCTCTG iNos TGAAGAAAACCCCTTGTGCT TTCTGTGCTGTCCCAGTGAG Cyp2E1 GGGACATTCCTGTGTTCCAG CTTAGGGAAAACCTCCGCAC Nqo1 TTTAGGGTCGTCTTGGCAAC GTCTTCTCTGAATGGGCCAG
Data Supplement
Files in this Data Supplement:
- Supplemental Figures -
Supplemental Figure 1 - HDM produces a dose-dependent increase in BAL cellularity
Supplemental Figure 2 - Time courses of gene induction in the lung for selected genes modulated by HDM and APAP
- Supplemental Figures -
In this issue
Acetaminophen Attenuates Allergic Airway Disease
