Abstract
Histamine exerts its numerous physiological functions through interaction with G protein-coupled receptors. Three such receptors have been defined at both the pharmacological and molecular level, while pharmacological evidence hints at the existence of further subtypes. We report here the cloning and characterization of a fourth histamine receptor subtype. Initially discovered in an expressed-sequence tag database, the full coding sequence (SP9144) was subsequently identified in chromosome 18 genomic sequence. This virtual coding sequence exhibited highest homology to the H3histamine receptor and was used to generate a full-length clone by polymerase chain reaction (PCR). The distribution of mRNA encoding SP9144 was restricted to cells of the immune system as determined by quantitative PCR. HEK-293 cells transiently transfected with SP9144 and a chimeric G protein α-subunit (Gαq/i1,2) exhibited increases in intracellular [Ca2+] in response to histamine but not other biogenic amines. SP9144-transfected cells exhibited saturable, specific, high-affinity binding of [3H]histamine, which was potently inhibited by H3 receptor-selective compounds. The rank order and potency of these compounds at SP9144 differed from the rank order at the H3 receptor. Although SP9144 apparently coupled to Gαi, HEK-293 cells stably transfected with SP9144 did not exhibit histamine-mediated inhibition of forskolin-stimulated cAMP levels. However, both [35S]GTPγS binding and phosphorylation of mitogen-activated protein kinase were stimulated by histamine via SP9144 activation. In both of these assays, SP9144 exhibited evidence of constitutive activation. Taken together, these data demonstrate that SP9144 is a unique, fourth histamine receptor subtype.
Histamine is an endogenous, biogenic amine that is known to mediate numerous physiological processes. Since its first description in 1910 (Barger and Dale, 1910), the list of activities ascribed to histamine has steadily grown to include activities in inflammation, gastric acid secretion, and neurotransmission. The diversity of physiology affected by histamine has led to the progressive development of antihistaminergic compounds that saw utility first as pharmacological tools and ultimately as therapeutic agents. The continued expansion of this pharmacological “toolbox” allowed detailed pharmacological studies to be carried out that revealed the existence of three types of histamine receptor: H1, H2, and H3. In addition, several studies have described physiological responses to histamine whose pharmacology does not clearly correspond to H1, H2, or H3 receptors. The H1, H2, and H3 receptor subtypes have subsequently been confirmed by molecular cloning of cDNAs encoding G protein-coupled receptors (GPCRs) that exhibit corresponding pharmacological properties (Gantz et al., 1991; Yamashita et al., 1991; Lovenberg et al., 1999); however, the molecular identity of other pharmacologically defined sites has remained elusive.
Recent efforts to determine the complete sequence of the human genome, both by sequencing of expressed-sequence tags (ESTs) and large scale genomic sequencing, have uncovered many novel members of the GPCR superfamily. Using the sequence of receptors for known biologically active substances, it has been possible to discover new members of receptor subfamilies that were not previously detected by pharmacological methods (Sibley and Monsma, 1992; Kroeze and Roth, 1998). With the addition of these novel receptor subtypes, many new insights into the function of the respective ligand/receptor systems have been gained.
The current study describes the discovery and characterization of a novel GPCR, designated SP9144, which appears to be a member of the histamine receptor family. SP9144 is most similar to the recently cloned H3 histamine receptor but is preferentially expressed in leukocytes. During the preparation of this manuscript, Oda et al. (2000) described the cloning of a novel histamine receptor that is essentially identical in sequence, expression pattern, and pharmacology to SP9144. The identification and further characterization of this receptor will likely provide new insights into the role of histamine in the modulation of immunological function.
Experimental Procedures
Materials.
Human mRNA was obtained from Clontech (Palo Alto, CA). cDNA synthesis kits and all cell culture and transfection reagents were obtained from Life Technologies (Gaithersburg, MD). The vector pcDNA3.1 was obtained from Invitrogen (Carlsbad, CA). Reagents for DNA sequencing and quantitative PCR were from PE-Biosystems (Foster City, CA). The sources of compounds were Schering-Plough Department of Chemical Research for burimamide, R(−)-α-methylhistamine, thioperamide, dimaprit, chlorpheniramine, and cimetidine; Smith, Kline, and French Laboratories (Philadelphia, PA) for impromidine; Sigma/Research Biochemicals International (St. Louis, MO) for histamine, imetit, clobenpropit,Nα-methylhistamine,S(+)-α-methylhistamine, probenecid, and Fluo 3-AM. [3H]Histamine (15 Ci/mmol) was from DuPont NEN (Boston, MA).
Molecular Cloning.
The amino acid sequences of known GPCRs were used to conduct a BLAST search of nucleotide databases. The search identified a 200-base pair nucleotide sequence as being a putative GPCR, with homology to the sixth transmembrane domain of the 5HT1B receptor. The corresponding cDNA clone (designated SP9144) was obtained and sequenced further to reveal the sixth and seventh transmembrane domains.
Searching of public sequence databases with SP9144 identified an identical sequence on a fragment of chromosome 18 deposited in GenBank (accession number AC007922). Analysis of this chromosomal fragment identified several discontinuous sequences that, when translated, exhibited characteristics of GPCRs. Comparison of the predicted amino acid sequence of this assemblage with known GPCRs revealed highest homology to the recently cloned H3 histamine receptor (Lovenberg et al., 1999). A putative ATG translation initiation codon was identified in this sequence, as well as a putative downstream stop codon (originally identified in the cDNA sequence).
Specific sense and antisense oligonucleotide primers were synthesized beginning with the initiating ATG and covering the stop codon. The sequence of the primers are: Oligo 9144–5′, ATGCCAGATACTAATAGCACA; Oligo 9144–3′, CAGAGGTGAGAAAATTGTCTTTAAGAAGAT. These primers were used for PCR with cDNA prepared from eosinophil mRNA by reverse transcriptase. PCR thermal cycling conditions used were as follows: 35 cycles of 95°C, 30 s; 62°C, 30 s; 68°C, 2 min. A single band at 1.2 kb was detected from this reaction. This band was cloned into the vector pCR3.1 (Invitrogen) to form the expression construct pCR3.1-SP9144. Sequencing of the insert in pCR3.1-SP9144 identified a single open reading frame of 1,173 nucleotides encoding a predicted protein sequence of 390 amino acids.
Transfection of Cells.
HEK-293 cells were seeded 24 h before transfection in DMEM with 10% fetal bovine serum, then transiently transfected overnight using LipofectAMINE 2000 (Life Technologies). Where indicated, cells were cotransfected with SP9144 (1 μg/10 mm2), chimeric G protein α-subunits (Conklin et al., 1993; Coward et al., 1999), and Gα16, either individually or as mixtures (as 10% of total DNA used for transfection). The chimeric Gα subunits used consist of Gαq with the five C-terminal amino acids replaced by those of Gαi1 (which are identical in Gαi2), Gαi3, Gαo, and Gαz (referred to as Gαq/i1,2, Gαq/i3, Gαq/o, and Gαq/z). G protein mix 1 included equal amounts of Gα16and Gαq/o; G protein mix 2 included equal amounts of Gαq/z, Gαq/i3, and Gαq/i1,2. Cells were used for experiments 48 h following transfection.
Intracellular Calcium ([Ca2+]i) Mobilization Assay.
Cells were harvested 24 h post-transfection without trypsin and seeded at 2.5 × 105 cells/well in DMEM with 10% fetal bovine serum in poly(d-lysine)-treated 96-well clear bottom black plates (Becton Dickinson, Franklin Lakes, NJ). Experimental compounds were diluted in Hanks' balanced salt solution, 20 mM HEPES, 2.5 mM probenecid, 1% bovine serum albumin (wash buffer). Forty-eight hours post-transfection, cells were loaded for 1.5 h with 2 μM Fluo 3-AM (F-6142; Sigma), 2.5 mM probenecid, and 20 mM HEPES in DMEM with 10% fetal calf serum. Cells were washed extensively with wash buffer to remove excess dye and evaluated for ligand-induced [Ca2+]i release using the fluorometric imaging plate reader (FLIPR) (Molecular Devices, Sunnyvale, CA). Results are given as the relative change in fluorescence from the initial reading and measured over a 3-min period following addition of compound.
Membrane Preparation.
HEK-293 cells transfected with SP9144 as described above were harvested by incubating in 5 mM EDTA/phosphate-buffered saline followed by repeated pipetting. The cells were centrifuged for 5 min at 1000g. The EDTA/PBS was decanted, and an equal volume of ice-cold 50 mM Tris-HCl, pH 7.5, was added and cells were broken up with a Polytron homogenizer (PT-10 tip, setting 5, 30 s). Nuclei and unbroken cells were sedimented at 1,000g for 10 min and then the supernatant was centrifuged at 50,000g for 10 min. The supernatant was decanted, the pellet was resuspended by Polytron homogenization, a sample was taken for BCA protein assay (Pierce, Rockford, IL), and the tissue was again centrifuged at 50,000g. Pellets were stored frozen at −20°C.
Radioligand Binding.
For saturation binding, increasing concentrations of [3H]histamine (30–60 Ci/mmol; Amersham Pharmacia Biotech, Piscataway, NJ) were incubated without and with 10−5 M histamine in triplicate with 40 to 60 μg of membrane protein in a total volume of 200 μl of 50 mM Tris-HCl, pH 7.5, for 1 h at 30°C. The bound radioactivity was separated by filtration through Unifilter-96 GF/B filters (Packard, Meriden, CT) pretreated with 0.1% polyethyleneimine (Sigma). The filters were washed eight times with 400 μl of ice-cold 50 mM Tris-HCl (pH 7.5), and radioactivity retained on the filters was quantitated by liquid scintillation counting in a Topcount (Packard) at 34% efficiency. For competition binding assays, five concentrations of compounds were incubated in triplicate with 18 nM [3H]histamine and 70 μg of membrane protein under the conditions as described above. Samples were filtered through Whatman (Clifton, NJ) GF/B filters and washed three times with 2 ml of cold Tris buffer. Filters were dried in a microwave oven, impregnated with Meltilex wax scintillant (PerkinElmer-Wallac Inc., Gaithersburg, MD), and counted at 45% efficiency. Binding data were analyzed by nonlinear least-squares curve-fitting to appropriate models with Prism software (GraphPad, San Diego, CA), andKi values were calculated from IC50 values according to Cheng and Prusoff (1973).
cAMP Assay.
Cells were transfected as previously described and assayed 48 h post-transfection. Cells that were subjected to pertussis toxin pretreatment were incubated overnight before the assay with pertussis toxin (100 ng/ml) in full serum media. On the day of the assay, cells were harvested in 2 mM EDTA/PBS and resuspended to a final concentration of 5 × 106 cells/ml in cold (4°C) adenylate cyclase buffer (AC buffer) (250 mM sucrose, 75 mM Tris-HCl, 12.5 mM MgCl2, 1.5 mM EDTA, pH 7.4) to which ascorbic acid (10 mg/50 ml) and dithiothreitol (31 mg/50 ml) were added fresh daily. The phosphodiesterase inhibitor Ro 20-1724 (4-[(3-butoxy-4-methoxyphenyl)methyl]-2-imidazolidinone) was added at a final concentration of 100 μM, and the cells were incubated for either 15 min (room temperature) or 30 min (on ice). Drugs were prepared at 2× final concentrations in AC buffer ± forskolin (10 μM for Chinese hamster ovary cells; 100 nM for the HEK-293 cells). For the assay, 50 μl of drug solution was added to 50 μl of cell suspension in a 1 ml × 96-well assay block, incubated at 37°C in an incubator-shaker for 15 min, boiled for 3 min, and then cooled on ice. The cell lysates were then assayed for total cyclic AMP using the NEN cyclic AMP Flashplate Assay (New England Nuclear Life Science Products, Inc., Boston, MA) according to the manufacturer's protocol. Total cAMP produced for each condition was determined as follows: %B/Bo for each sample = (average net counts for sample or standard × 100)/average net counts of zero standard. A standard curve was generated by plotting the %B/Bo for each standard versus log[pmol of cAMP]. The concentration of cAMP for each sample could be interpolated from the standard curve. Results are expressed as femtomoles of cAMP/well.
MAP Kinase Assay.
Cells were transfected as described above. Twenty-four hours post-transfection, cells were harvested and reseeded at a density of 1 × 106 cells/well in six-well dishes. Full serum media was replaced 5 to 8 h after seeding with 0.5% serum media overnight. Cells that were subjected to pertussis toxin pretreatment were incubated overnight before the assay with pertussis toxin at 100 ng/ml in 0.5% serum media. One hour before the drug challenge, cells were placed in media without serum to reduce background MAP kinase activation. Drug was then added at the appropriate concentration and incubated for 5 min at 37°C. Cells were then washed once with cold PBS and lysed in 100 μl of cold lysis buffer [150 mM NaCl, 50 mM Tris pH 8.0, 5 mM EDTA pH 8.0, 10 mM NaF, 10 mM dibasic sodium pyrophosphate, 1% (v/v) Nonidet P-40, 0.5% (w/v) sodium deoxycholate (RIPA)] containing one Complete protease inhibitor cocktail tablet/50 ml (Roche Molecular Biochemicals, Indianapolis, IN). Cell lysates were collected in microfuge tubes and spun at 13,000g for 15 min at 4°C to pellet cellular debris. The protein concentration of the lysates was determined using the BCA protein assay. Twenty micrograms of protein was added to an equal volume of 2× SDS polyacrylamide gel electrophoresis sample buffer and boiled for 5 min, then separated on a 10% Tris-glycine polyacrylamide gel (Novex, Carlsbad, CA). Proteins in the gel were transferred to a nitrocellulose membrane in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3) using a semidry transfer apparatus (Bio-Rad, Hercules, CA). Membranes were incubated in blocking solution [50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% (v/v) Tween 20 (TTBS)] containing 5% (w/v) milk for 1 h or more at room temperature. Membranes were rinsed three times with TTBS then developed using the PhosphoPlus p44/42 MAP Kinase (Thr202/Tyr204) Antibody Kit (Cell Signaling Technology, Inc., Beverly, MA) according to the manufacturer's instructions.
[35S]GTPγS Binding Assay.
A scintillation proximity assay was used for [35S]GTPγS binding assays. For each assay point, 2 to 3 μg of membranes, prepared essentially as previously described (excluding phosphatase inhibitors) (Hipkin et al., 2000), were preincubated for 15 min at room temperature with 300 μg of wheat germ agglutinin-coated scintillation proximity assay beads (WGA-SPA; Amersham, Arlington Heights, IL) in SPA binding buffer (50 mM HEPES, 1 mM CaCl2, 5 mM MgCl2, 50 mM NaCl, 0.002% NaN3) containing 0.1% bovine serum albumin (Factor V, lipid free) and 3.75 μM GDP (Sigma). The beads and membranes were transferred to a 96-well Isoplate (Wallac, Gaithersburg, MD) and incubated for 60 min at room temperature with 50 pM [35S]GTPγS (tetraethylammonium salt, specific activity = 1250 Ci/mmol; NEN) in the absence or presence of histamine and/or thioperamide. Membrane-bound [35S]GTPγS was measured by scintillation proximity assay using a 1450 Microbeta Plus liquid scintillation counter (Wallac).
Messenger RNA Expression Analysis.
Expression of SP9144 mRNA was examined using dot blots and Northern blots obtained from a commercial source (Clontech). Hybridization to blots was carried out using a PCR-generated DNA fragment encompassing 400 base pairs at the 3′-end. The DNA fragments were random-prime labeled with [32P]dCTP, and the blots were hybridized for 14 h in ExpressHyb (Clontech) containing ∼2 million cpm/ml of radiolabeled probe. The following day the blots were washed and exposed to Kodak Biomax MS film (Eastman Kodak, Rochester, NY for 3 days at −70°C. The films were analyzed for relative expression levels using the MCID M4 image analysis system (Imaging Research, Ontario, Canada).
In addition to the dot blots, cDNAs prepared from various tissues and clonal cell lines were assayed for SP9144 expression using real-time quantitative PCR. Briefly, 5 μg of total RNA was reverse transcribed, and 20 ng of the resulting cDNA was analyzed for the expression of human SP9144 using a specific set of TaqMan primers and probe (PE-Biosystems) on a Perkin-Elmer GeneAmp 5700 Sequence Detection System (PE-Biosystems). A separate set of identical cDNAs was analyzed for the expression of hypoxanthine phosphoribosyltransferase (hprt; PE-Biosystems) as an internal control for quantification of the total amount of cDNA. For the TaqMan assay, the following primer and fluorogenic probe (TaqMan) set was used: forward primer, 5′-AGAGTCTTGGAAGGATGAAGGTAGTG-3′; reverse primer, 5′-TCAGTCCAGGATGGCTTTGG-3′; TaqMan probe 5′-AGCCTGTGGAAGCGTGATCATCTCAGTAG-3′. The TaqMan probe was labeled with the dye 6-carboxyfluorescein (6-FAM) at the 5′-end of the sequence and with the quencher 6-carboxytetramethylrhodamine (TAMRA) at the 3′-end. Both primers and the labeled probe were obtained from PE-Biosystems. Before running the cDNAs, the primer concentrations were optimized according to Perkin-Elmer specifications. The final concentration of the primers was 200 nM, and the probe concentration was 100 nM. The PCRs were carried out in 96-well plates. Each 50-μl well contained 50 ng/10 μl of each cDNA, 25 μl of 2× TaqMan Universal PCR Master Mix, 2.5 μl of the primer/probe mix, and 12.5 μl of diethyl pyrocarbonate-treated water. The cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min.
The quantification of the amplicons in each well was determined according to the comparative Ct (threshold cycle number) method as previously described (Hedrick et al., 2000). Briefly, for each sample well, the formula used is 2E − (Cttarget − Ctstandard). This yields a quantification of the target PCR products in the experimental wells relative to the PCR products for the internal calibration (hypoxanthine phosphoribosyltransferase) probes. These results were then plotted on a log scale. Any value of ≤10−5 required 35 or more cycles of amplification to detect a product.
Results
Using a set of biogenic amine receptor sequences, public and proprietary EST databases were searched by BLAST (Altschul et al., 1990) to look for novel members of this GPCR family. One proprietary EST was identified that exhibited significant homology with transmembrane region seven of biogenic amine receptors. Subsequently, a matching fragment of nucleotide sequence from chromosome 18 was identified in GenBank (accession number AC007922). From this genomic sequence, a virtual transcript exhibiting high homology to the cloned H3 histamine receptor (Lovenberg et al., 1999) was identified. This sequence was used to design PCR primers to the predicted amino and carboxy termini that amplified a 1173-base pair fragment from eosinophil cDNA. Sequence analysis of the cloned fragment confirmed its identity to the predicted transcript. Hydrophobicity analysis of the predicted 390-amino acid protein indicated the presence of seven hydrophobic, putative transmembrane regions, a feature common to G protein-coupled receptors. BLAST analysis with this protein sequence revealed homology to known GPCRs with the highest degree of similarity to the H3 histamine receptor. Furthermore, a phylogenetic analysis (Wisconsin Package, Genetics Computer Group, Madison, WI) with the amino acid sequences of all known human biogenic amine receptors and SP9144 showed that SP9144 clustered with the H3 histamine receptor (results not shown). Sequence alignment analysis using the Clustal V method (Higgins et al., 1992) (Fig. 1) showed 43% identity overall between SP9144 and the H3histamine receptor and 58% within the predicted transmembrane regions. The identity to the H1 and H2 receptors was 29 and 31%, respectively. These analyses suggest that the protein encoded by the SP9144 open reading frame could be a novel receptor for histamine.
To identify the ligand for SP9144, the cDNA was transiently transfected into HEK-293 cells with and without chimeric G protein α-subunits representing Gαq with the five C-terminal amino acids replaced with those of the α-subunits Gαi1,2, Gαi3, Gαo, or Gαz. Coexpression of a GPCR and the chimeric G protein mix allows receptors not normally coupled to Gαq to be assayed by monitoring mobilization of [Ca2+]i (Conklin et al., 1993; Coward et al., 1999). The mobilization of [Ca2+]i due to agonist addition was monitored in a FLIPR. HEK-293 cells transfected with SP9144 and chimeric G proteins were exposed to a variety of potential agonist molecules, including histamine, dopamine, serotonin, epinephrine, and norepinephrine, all at 10 μM final concentration. Of these agonists, only histamine mobilized [Ca2+]i in SP9144-transfected cells (Fig. 2A). Furthermore, [Ca2+]imobilization in response to histamine was only observed when SP9144 was cotransfected with a mixtures of chimeric G proteins (G mix 1 or G mix 2, Fig. 2B). To determine the G protein specificity of this receptor, individual chimeric G proteins were cotransfected with SP9144. Under these conditions, histamine-induced [Ca2+]i mobilization was observed only when SP9144 and Gαq/i1,2, Gαq/i3, or Gα16 were cotransfected. No response was observed with G proteins alone or when SP9144 was cotransfected with Gαq/o or Gαq/z (Fig. 2B).
The initial pharmacological characterization of SP9144 was carried out by examining responses to the histamine derivativesR(−)-α-methylhistamine,S(+)-α-methylhistamine, andNα-methylhistamine. Analysis of the potency of histamine and these derivatives (Fig.3A) revealed a rank order of histamine >Nα-methylhistamine >R(−)-α-methylhistamine ≫S(+)-α-methylhistamine (Table1). Furthermore, bothNα-methylhistamine andR(−)-α-methylhistamine behaved as full agonists in this assay. S(+)-α-Methylhistamine was found to be completely inactive up to 10 μM (data not shown).
The pharmacology of SP9144 was further characterized by comparison to that of the known histamine receptors using compounds selective for each histamine receptor subtype. Neither the H1 antagonist chlorpheniramine nor the H2 antagonist cimetidine had any effect on histamine-induced [Ca2+]imobilization in SP9144/Gαq/i1,2-cotransfected cells (Fig. 3C). In contrast, a number of compounds known to interact selectively with the H3 histamine receptor were also active at SP9144. Thus, as described above, the H3-selective agonistR(−)-α-methylhistamine was able to induce [Ca2+]i mobilization in SP9144/Gαq/i1,2-cotransfected cells, although with significantly less potency than that reported for the H3 receptor (Lovenberg et al., 1999). Imetit, another H3-selective agonist, also exhibited agonism at SP9144, albeit with reduced efficacy as compared with histamine (Fig. 3B). Several H3-selective antagonists were also active at SP9144; however, unlike their action at the H3 receptor, they exhibited partial agonist activity at SP9144 (Fig. 3B). The rank order of potency for these compounds in the [Ca2+]iassay was clobenpropit > imetit > impromidine > burimamide. In contrast, the H3-selective antagonist thioperamide was also an antagonist at SP9144 in this assay (Fig. 3C). The EC50, efficacy, andKi values for these compounds are summarized in Table 1.
To confirm the pharmacology of SP9144, the binding of [3H]histamine was examined in wild-type and SP9144-transfected HEK-293 cells. Saturation binding analysis revealed the presence of high-affinity, saturable, specific [3H]histamine binding in cells transfected with SP9144 (Fig. 4A) but not in cells transfected with empty vector (data not shown). TheKd determined by Scatchard analysis was 15.3 (±3, n = 4) nM, with aBmax of 920 (±130, n= 4) fmol/mg of protein. The pharmacology of [3H]histamine binding to SP9144-transfected cells was further examined by inhibition of [3H]histamine binding by various histaminergic compounds. As indicated by the FLIPR assay, the H1 antagonist chlorpheniramine did not inhibit [3H]histamine binding at concentrations ≤10−5 M, whereas the H2antagonist cimetidine exhibited weak activity with an IC50 of approximately 1 μM (data not shown). In contrast, compounds with H3 receptor selectivity were able to potently inhibit [3H]histamine binding to SP9144 with the following rank order: imetit > clobenpropit > burimamide > thioperamide (Fig. 4C, Table1).
Since each of the known histamine receptors interact with different G proteins and second messenger systems, it was of interest to investigate the second messenger coupling of SP9144. The ability of the chimeric Gαq/i proteins to interact with SP9144 suggested that agonist stimulation of SP9144 should lead to the inhibition of stimulated adenylyl cyclase activity via interaction with Gαi. The ability of histamine to modulate cAMP levels was examined in HEK-293 cells stably transfected with FLAG-tagged SP9144 (without chimeric G proteins). Although these cells expressed functional SP9144 as verified by flow cytometry, [3H]histamine binding, and histamine-induced [Ca2+]i mobilization (when transiently transfected with Gαq/i1,2), exposure to histamine did not cause inhibition of forskolin-stimulated cAMP levels at concentrations up to 10 μM (Fig.5). Interestingly, forskolin-stimulated cAMP levels were consistently lower in SP9144-transfected cells as compared with wild-type cells, and basal cAMP levels also tended to be lower (Fig. 5). Additional experiments using transiently transfected HEK-293 and Chinese hamster ovary cells yielded similar results (data not shown).
Given that SP9144 did not appear to modulate cAMP production, potential interaction with G proteins was determined by examining the stimulation of [35S]GTPγS binding following agonist stimulation of SP9144. As shown in Fig.6A, histamine had no effect on [35S]GTPγS binding in wild-type HEK-293 cells, whereas in HEK-293 cells stably transfected with SP9144, histamine potently stimulated [35S]GTPγS binding, with an EC50 of 9 (±5) nM. Interestingly, basal levels of bound [35S]GTPγS tended to be higher in SP9144-transfected cells as compared with wild types. As shown in Fig.6B, preincubation with the H3 antagonist thioperamide shifted the histamine dose-response curve to the right, although the maximal level of stimulation was not diminished. In addition, thioperamide decreased the basal level of [35S]GTPγS binding in the absence of histamine (Fig. 6C), thus indicating that thioperamide acts as an inverse agonist at SP9144.
To further investigate the intracellular signaling pathways affected by SP9144, the phosphorylation of MAP kinase in response to histamine was examined. In HEK-293/SP9144 cells, histamine potently stimulated phosphorylation of MAP kinase in a dose-dependent manner (Fig.7), whereas only a slight response to histamine was observed in control cells. Pretreatment of the cells with pertussis toxin essentially abolished the ability of 10 μM histamine to stimulate SP9144-mediated MAP kinase phosphorylation (Fig. 7).
The potential physiological function of SP9144 was investigated by determining the distribution of SP9144 mRNA in human tissues by using both hybridization and quantitative reverse transcriptase-PCR. Using randomly primed 32P-labeled probes specific for SP9144, a human multitissue dot blot was probed for SP9144 expression. After 3 days of exposure at −80°C, low-level expression was detected in several tissues including bone marrow, peripheral leukocytes, spleen, testis, small intestine, lymph node, heart, and kidney (Fig.8A). Although expressed at low levels, SP9144 does appear to be preferentially distributed in tissues of immunological relevance. To examine the distribution of SP9144 mRNA in greater detail, quantitative PCR was used to examine SP9144 expression in a collection of cDNA libraries prepared from various lymphoid cells and tissues, as well as a collection of mRNA from various brain regions. Whereas no evidence of SP9144 expression was observed in any of the brain mRNA samples examined (data not shown), SP9144 was found to be selectively expressed in several types of immune cells (Fig. 8B), including T cells, dendritic cells (DC), monocytes, mast cells, neutrophils, and eosinophils. Furthermore, it was apparent that the expression of SP9144 in mononuclear cells is regulated upon cellular activation, depending on the specific cell type.
Discussion
The current study describes the cloning and characterization of a novel receptor for histamine that is most similar to the recently described histamine H3 receptor in primary sequence and pharmacology. The degree of homology between SP9144 and the H3 receptor (43%) contrasts with the relatively low level of relatedness between the other histamine receptors. However, SP9144 differs from the H3receptor in several respects. For example, the potency of the agonists histamine and R(−)-α-methylhistamine is reversed at SP9144 in comparison with H3, with histamine being more potent than R(−)-α-methylhistamine at SP9144, whereas R(−)-α-methylhistamine is more potent at the H3 receptor (Lovenberg et al., 1999). Furthermore, several compounds generally recognized to be antagonists at the H3 receptor, clobenpropit, burimamide, and impromidine, exhibit partial agonism at SP9144, while thioperamide exhibits antagonism at both receptors. These data indicate that while SP9144 is structurally similar to the H3receptor, it possesses a unique pharmacological profile.
The H3 receptor has been shown to be a Gαi-linked receptor that is able to inhibit forskolin-stimulated adenylyl cyclase activity (Lovenberg et al., 1999). While SP9144 shares several properties of Gαi-linked receptors, such as stimulation of [35S]GTPγS binding, activation of MAP kinase phosphorylation, and pertussis toxin sensitivity, it has not been possible to demonstrate modulation of cAMP levels, even under conditions where other Gαi-linked receptors are active. Despite the apparent preference for the Gαq/i chimeric G proteins, the precise identification of the G protein species interacting with SP9144 will require further investigation.
The data presented in the present study also suggest that SP9144 exhibits a significant level of constitutive activity. This is indicated by the elevated basal levels of both [35S]GTPγS binding and MAP kinase phosphorylation seen in cells expressing SP9144 as compared with wild-type cells. In this regard it is interesting to note that in the [35S]GTPγS assay, thioperamide acts as an inverse agonist at SP9144. It is unlikely that the constitutive activity observed for SP9144 is due to over-expression of this receptor, as similar results are obtained from both transient transfections and from a stable cell line expressing relatively low levels of receptor. Furthermore, both the H1 and H2 histamine receptors (Alewijnse et al., 1998;Bakker et al., 2000), and more recently the H3receptor (Morisset et al., 2000), have been shown to exhibit constitutive activity. Interestingly, the study by Morriset et al. demonstrates that the constitutive activity of the H3 histamine receptor exists in vivo and plays a role in regulation of histaminergic neurons in rodent brain. In the case of SP9144 however, it remains to be determined if in its native cellular environment it exhibits a similar degree of constitutive activity, and if so, what is the functional significance of such activity.
The tissue distribution of SP9144 and the H3receptor exhibit striking differences. Whereas the H3 receptor is primarily expressed in the central nervous system, SP9144 is not found in the central nervous system and elsewhere has a very limited distribution, primarily in lymphoid tissues. In particular, SP9144 is expressed in T cells, DC, monocytes, mast cells, neutrophils, and eosinophils. Interestingly, it appears that SP9144 expression is either up-regulated or down-regulated upon activation and that this regulation may depend on the presence of IL-10 or IL-13. For example, activated monocytes expressed SP9144 only in the presence of neutralizing antibody to IL-10, and activated Th2 cells, which express IL-10 and IL-13, down-regulate SP9144 expression. Regulation of SP9144 expression in DC is also associated with IL-10/IL-13. Resting bone marrow-derived DC express SP9144; however this expression was dramatically decreased upon activation of these cells with phorbol-12-myristate-13-acetate and ionomycin. This strong stimulation has been shown to increase IL-13 expression in these cells (de Saint-Vis et al., 1998). The situation with monocyte-derived DC is more complex and depends not only on the type of stimulation used but also on maturation of the DC. A more complete understanding of SP9144 regulation in these cells will require more extensive studies in the future.
The expression of SP9144 in immune system cells is potentially significant since histamine has been shown to exhibit activity at various types of leukocytes. While many of these effects may be attributed to the expression of H1 and/or H2 receptors (Leino et al., 1993), the existence of at least one additional, novel histamine receptor has been postulated based on differential pharmacology in human eosinophils (Raible et al., 1994). The pharmacological profile of this eosinophil receptor is qualitatively similar to that found for SP9144 in the present study, although the potency of most compounds examined is lower in eosinophils as compared with heterologously expressed SP9144. Whether this discrepancy is due to the different cellular environments and signaling pathways or indicates the existence of yet another histamine receptor remains to be determined. During the preparation of this manuscript, Oda et al. (2000) reported the cloning and characterization of a novel histamine receptor that is essentially identical to SP9144. The sequence reported by Oda et al. (2000)(GenBank accession number AB0044934) differs from that of SP9144 by three nucleotides, resulting in three different amino acid residues (residue 138 in transmembrane region 4, residues 206 and 253 in intracellular loop 3). However, the nucleotide sequence determined for SP9144 exactly matches the reported chromosome 18 sequence (AC007922) at these positions. Thus, it remains to be determined if the alternate sequences reported by Oda et al. (2000) arise from sequencing errors or real variation in this receptor in the human population. In other respects, the mRNA expression pattern and pharmacology of SP9144 correlate well with those reported by Oda et al. (2000).
The data presented in the present study clearly indicate that SP9144 represents a fourth histamine receptor with a unique pharmacological profile and tissue distribution. Based on these unique properties, it is proposed that this receptor be referred to as the H4 histamine receptor. It is anticipated that identification of SP9144 as an H4 histamine receptor expressed in leukocytes will result in an improved understanding of the role of histamine in the modulation of immune function.
Footnotes
-
Send reprint requests to: Dr. Frederick J. Monsma, Jr., Human Genomics Research, Schering-Plough Research Institute, K15-1, 1945, 2015 Galloping Hill Rd., Kenilworth, NJ 07033. E-mail:frederick.monsma{at}spcorp.com
-
This research was funded entirely by Schering-Plough Corporation.
- Abbreviations:
- GPCR
- G protein-coupled receptor
- HEK
- human embryonic kidney
- MAP kinase
- mitogen-activated protein kinase
- cAMP
- adenosine 3′:5′-cyclic monophosphate
- PCR
- polymerase chain reaction
- EST
- expressed-sequence tag
- FLIPR
- fluorometric imaging plate reader
- BLAST
- basic local alignment search tool
- DMEM
- Dulbecco's modified Eagle's medium
- PBS
- phosphate-buffered saline
- AC buffer
- adenylate cyclase buffer
- GTPγS
- guanosine-5′-O-(3-thio)triphosphate
- DC
- dendritic cells
- IL
- interleukin
- [Ca2+]i
- intracellular calcium
- Received November 3, 2000.
- Accepted December 19, 2000.
- The American Society for Pharmacology and Experimental Therapeutics