Abstract
SB-525334 (6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-1H-imidazol-4-yl]-quinoxaline) has been characterized as a potent and selective inhibitor of the transforming growth factor-β1 (TGF-β1) receptor, activin receptor-like kinase (ALK5). The compound inhibited ALK5 kinase activity with an IC50 of 14.3 nM and was ∼4-fold less potent as an inhibitor of ALK4 (IC50 = 58.5 nM). SB-525334 was inactive as an inhibitor of ALK2, ALK3, and ALK6 (IC50 > 10,000 nM). In cell-based assays, SB-525334 (1 μM) blocked TGF-β1-induced phosphorylation and nuclear translocation of Smad2/3 in renal proximal tubule cells and inhibited TGF-β1-induced increases in plasminogen activator inhibitor-1 (PAI-1) and procollagen α1(I) mRNA expression in A498 renal epithelial carcinoma cells. In view of this profile, SB-525334 was used to investigate the role of TGF-β1 in the acute puromycin aminonucleoside (PAN) rat model of renal disease, a model of nephritis-induced renal fibrosis. Orally administered doses of 1, 3, or 10 mg/kg/day SB-525334 for 11 days produced statistically significant reductions in renal PAI-1 mRNA. Also, the compound produced dose-dependent decreases in renal procollagen α1(I) and procollagen α1(III) mRNA, which reached statistical significance at the 10-mg/kg/day dose when compared with vehicle-treated PAN controls. Furthermore, PAN-induced proteinuria was significantly inhibited at the 10-mg/kg/day dose level. These results provide further evidence for the involvement of TGF-β1 in the profibrotic changes that occur in the PAN model and for the first time, demonstrate the ability of a small molecule inhibitor of ALK5 to block several of the markers that are predictive of fibrosis and renal injury in this model.
TGF-β isoforms are important regulators of extracellular matrix (ECM) remodeling (Bottinger and Bitzer, 2002). It has been shown that exogenous TGF-β1 stimulates an increase of ECM components in epithelial and mesangial cells, such as procollagen α1(I) and regulatory enzymes of ECM turnover, like PAI-1. Chronic or pathogenic levels of active TGF-β1 can lead to increased synthesis and decreased degradation of ECM resulting in a profibrotic state that alters normal physiological functions (Border and Noble, 1994). In transgenic mice overexpressing TGF-β1, there is an induction of glomerulosclerosis and rapid progression toward renal disease (Kopp et al., 1996; Bottinger and Kopp, 1998). It has been shown that neutralizing antibodies against TGF-β1 or soluble TGF-β type II receptor can prevent the accumulation of ECM in models of renal, lung, and liver fibrosis at the transcriptional level, thus in turn, causing a reversal or protection from pathological TGF-β levels (Border et al., 1990; Sharma et al., 1996; Ziyadeh and Sharma, 1996; George et al., 2000).
The activated TGF-β molecule signals through two highly conserved single transmembrane receptors with intracellular serine-threonine kinase domains. Specifically, TGF-β1 binds both receptors forming a heterotetrameric complex, which allows the activated type II TGF-β receptor to phosphorylate threonine residues in the glycine-serine-rich domain of the type I receptor (ALK5) (Wrana, 1998). The ALK5 receptor has been shown to activate the Smad and the p38 mitogen-activated protein kinase (MAPK) signaling pathways, which have both been implicated in the up-regulation of ECM proteins (Heldin et al., 1997; Hanafusa et al., 1999). When phosphorylated, Smad2 and/or Smad3 form a stable complex with Smad4 which translocates into the nucleus, recruits transcription factors, and initiates the transcription of specific TGF-β-related genes, some of which are essential for the integrity of the ECM architecture (Massague, 1996).
To investigate the role of TGF-β1 in renal fibrosis, we utilized the acute puromycin aminonucleoside (PAN) model in Sprague-Dawley rats. A single injection of PAN induces significant proteinuria and increases TGF-β1 gene expression in the kidney (Chandra et al., 1984; Van Goor et al., 1993; Yamazaki, 1995). The increase in TGF-β1 gene expression is accompanied by an increase in procollagen α1(I), collagen α1(III), and PAI-1 mRNA (Jones et al., 1992; Ma et al., 2004). A single injection of PAN can also induce podocyte depletion and an up-regulation of profibrotic genes, resembling early events in the development of human focal and segmental glomerulosclerosis (Eddy and Michael, 1988; Kim et al., 2001). Although the acute PAN-induced injury does not lead to histological fibrosis, it does model the early TGF-β1-induced transcriptional events that ultimately comprise fibrotic lesions.
The goal of our investigation was to characterize a novel inhibitor of ALK5 activity SB-525334, thereby, halting TGF-β1 signal transduction. Using a kinase assay, we measured the activity of SB-525334 against ALK5 compared with other kinases and established its ability to effect TGF-β1-specific processes in renal cells. Subsequently, in the PAN in vivo model, we demonstrated that SB-525334 can inhibit the transcription of TGF-β1 inducible ECM components and significantly lower urinary protein excretion. These results demonstrate the first use of a small molecular weight compound in the inhibition of TGF-β1 in a rat model that is predictive of renal fibrosis.
Materials and Methods
Cell Culture. A498 human renal carcinoma cells (American Type Culture Collection, Manassas, VA) were cultured on T-150 cm2 sterile flasks (Corning Glassworks, Corning, NY) in Eagle's minimum essential medium with Earl's salts/l-glutamine, 10% fetal bovine serum (FBS) (JRH Biosciences, Lenexa, KS), and 1% antibiotic-antimycotic. Human renal proximal tubule epithelial (RPTE) cells (Cambrex Bio Science Walkersville, Walkersville, MD) were cultured in T-150 cm2 sterile flasks in renal epithelial cell basal medium (Cambrex Bio Science Walkersville) containing 1% antibiotic-antimycotic. Starved conditions for A498 and RPTE cells were defined as deprivation of FBS in Eagle's minimum essential medium and deprivation of epidermal growth factor and FBS in renal epithelial basal medium, respectively.
Kinase Assay. To determine the potency of the ALK5 inhibitor SB-525334 at the enzyme level, purified GST-tagged kinase domain of ALK5 was incubated with purified GST-tagged full-length Smad3 in the presence of 33P-γATP and different concentrations of SB-525334 (Callahan et al., 2002). The readout is radioactively labeled Smad3.
To determine the selectivity of SB-525334, purified GST-tagged kinase domain of ALK2 and ALK4 were incubated with GST-tagged full-length Smad1 and Smad3, respectively, in the presence of different concentrations of SB-525334 (n = 3) (Laping et al., 2002). IC50 value determinations were calculated with GraphPad software (GraphPad Software Inc., San Diego, CA) using a sigmoidal dose-response curve.
Nuclear Localization. RPTE cells were seeded on microscope slides (Nalge Nunc International, Naperville, IL). The following day, the cells were starved by removal of epidermal growth factor and serum for 24 h prior to dosing. Cells were dosed with 10 ng/ml TGF-β1 or 1 μM SB-525334 or a combination of both. Slides were pretreated with SB-525334 or starve media for 3 h prior to a 1-h incubation at 37°C with TGF-β1 or starve media.
The cells were then fixed for 15 min in 4% ice-cold paraformaldehyde. The cells were permeabilized for 10 min in 0.3% Triton X-100/PBS at room temperature. The slides were incubated for 30 min in a blocking solution containing 0.3% bovine serum albumin, 10% FBS, 0.3% Triton X-100/PBS, and 5% milk in PBS. A 1:200 dilution of primary mouse anti-Smad2/3 antibody (BD Biosciences Discovery Labware, Bedford, MA) was applied to each slide for overnight incubation. A 1:200 dilution of anti-mouse IgG fluorescein secondary antibody (Vector Laboratories, Burlingame, CA) was applied to each slide for 30 min at room temperature.
The slides were then viewed using an argon blue 488 nM laser in a confocal microscope (Olympus, Melville, NY). Nuclear signal intensity was analyzed using 1D Image Analysis software (Eastman Kodak, Rochester, NY). The relative intensity was determined by mean intensity of the nucleus and expressed as percent control.
RNA Isolation and TaqMan. A498 cells were used to evaluate the inhibition of TGF-β1-induced extracellular matrix by SB-525334. The day prior to treatment, the cells were starved of FBS for 24 h, after which the cells were dosed accordingly with SB-525334 (10 to 0.0195 μM) and TGF-β1 (10 ng/ml). After a 24-h incubation, the media were aspirated, and 100 ml of RNA (Ambion, Austin, TX) was later added to each well. The ABI 6700 Automated Nucleic Acid Workstation (Applied Biosystems, Foster City, CA) was used to extract total mRNA from the cells and to make cDNA using Multiscribe RT and random primers.
The robotic workstation was also used to set up quantitative polymerase chain reaction (PCR) plates, adding the probes and primers to the cDNA along with TaqMan Universal PCR master mix. To each well, 20 μl of master mix was added containing 100 nM target probe, 200 nM forward target primer, and 200 nM reverse target primer. The target mRNA primer/probe sequences were human procollagen α1(I): forward primer sequence: CAGCCGCTTCACCTACAG, reverse primer sequence: GGTTTTGTATTCAATCACTGTCTTG, probe: 6FAM-ATGGCTGCACGAGTCACACCGGA-TAMRA; human PAI-1: forward primer sequence: CGGCACAACCCCACAGGAAC, reverse primer sequence: TGAAGGCGTCTTTCCCCAG, probe: 6FAM-TGGGCCAAGTGATGGGAACCCTGAC-TAMRA; human ribosomal protein-32 (RPL-32): forward primer sequence: CGCTCACAATGTTTCCTCCA, reverse primer sequence: TGACTCTGATGGCCAGTTGG, probe: VIC-CGCAAAGCCATCGTGGAAAGAGCT-TAMRA. Each probe and primer set was run separately in the 7700 Sequence Detector (Applied Biosystems).
Animal Model. To identify the optimal treatment length for puromycin aminonucleoside's (Sigma-Aldrich, St. Louis, MO) effect on extracellular matrix in the kidney, 18 Sprague-Dawley (SD) rats (200–250 g) were injected with 15 mg/100 g of puromycin aminonucleoside in 0.9% saline or sham 0.9% saline only intraperitoneally. Animals were sacrificed at 24 h (n = 3 + 2 control), day 4 (n = 3), day 8 (n = 3), day 10 (n = 3), day 15 (n = 2), and day 20 (n = 2).
A 24-h urine collection and plasma sample were taken at 9:00 AM everyday. Urine and plasma chemistry were measured at GlaxoSmithKline Laboratories Animal Science using an Olympus clinical analyzer (Olympus). Proteinuria was measured as a concentration (milligrams per deciliter) and then converted to total protein excreted over a 24-h period using urine flow (milliliters per 24 h). The creatinine clearance was calculated by multiplying urine creatinine levels (milligrams per milliliter) by urine flow (milligrams per milliliter per 100 g b.wt.) and then dividing that product by plasma creatinine (milligrams per milliliter).
To determine the effect of SB-525334 on renal disease in the PAN model, SD rats were pretreated by oral gavage with 1, 3, or 10 mg/kg/day of SB-525334 once a day. The following day, PAN was injected at 15 mg/100 g to the appropriate rats. Treatment groups continued to receive SB-525334. Ten days after PAN injection the rats were sacrificed, and blood, urine, and kidneys were collected at the termination point for analysis.
Tissue RNA Extraction and TaqMan. Kidney RNA was extracted using guanidinium thiocyanate and 5.7 M cesium chloride in a 50,000 rpm ultracentrifuge for 24 h. Two micrograms of RNA were used to generate cDNA using Superscript II enzyme (Invitrogen, Carlsbad, CA).
The ABI 6700 workstation was used to set up quantitative PCR plates (Applied Biosystems). To each well, 20 μl of master mix was added containing 100 nM target probe, 200 nM forward target primer, and 200 nM reverse target primer. The target mRNA primer/probe sequences were rat PAI-1: target probe: 6FAM-TTCATAGCGGGCCGCTCTGCA-TAMRA, forward primer: CTGCACAGGAAGGTAACGTGAA, reverse primer: TTTTTTTCCAGTGGAGATGTAACG; rat procollagen α1(I): target probe: 6FAM-TTGCATAGCTCGCCATCGCACA-TAMRA, forward primer: TATGCTTGATCTGTATCTGCCACAAT, reverse primer: TCGCCCTCCCGTTTTTG; rat procollagen α1(III): target probe: 6FAM-CTTTCCAGCCGGGCCTCCCAG-TAMRA, forward primer: CAGCTGGCCTTCCTCAGACT, reverse primer: TGCTGTTTTTGCAGTGGTATGTAA; rat RPL-32: target probe: 6FAM-CGCAAAGCCATCGTGGAAAGAGCT-TAMRA, forward primer: CGCTCACAATGTTTCCTCCA, reverse primer: TGACTCTGATGGCCAGTTGG. Matrix mRNA expression levels were normalized against the RPL-32 level to yield a comparative arbitrary value. Expression levels for the lean rats were set to an arbitrary value of 1.
Tissue Protein Extraction. Four hundred milligrams of rat kidney tissue was placed into a 0.5% Triton X-100, 0.2% sodium azide, and PBS solution and homogenized. After overnight incubation at 4°C, the homogenate was centrifuged at 14,000 rpm, 4°C for 15 min. The supernatant was collected and aprotinin was added to a final concentration of 3 U/ml.
Western Blot. Denatured protein (10 μg) was loaded on a 4 to 12% bis-Tris polyacrylamide gel with MES running buffer and then semidry transferred to nitrocellulose paper. A primary antibody for collagen I 1:250 (Sigma-Aldrich) was applied overnight in 5% milk/PBS. A goat anti-rabbit IgG horseradish peroxidase secondary antibody 1:2000 was applied for 1.5 h. The blot was washed in PBS/Tween 20, and enhanced chemiluminescent reagents were used to examine the blot on film. The bands were quantified on a densitometer.
Histology. Kidneys were removed at the termination of the study, fixed in formalin for 24 h, and stored in 70% ethanol. Kidney slices 10-μm thick were fixed onto slides, hydrated, washed, and stained with trichrome dye. All slides were independently analyzed, blinded two different times on separate occasions for consistency. The endpoints examined were collagen deposition, tubular dilation, and cast formation.
Data Analysis. Statistical analysis was performed on the data with the GraphPad Prism 4 software (GraphPad Software Inc.). Statistical significance was determined by one-way ANOVA followed by Tukey post hoc test or by the Student's t test. Group data are reported as mean ± S.E.M.
Results
SB-525334 inhibited ALK5 phosphorylation of Smad3 with an IC50 value of 14.3 nM (Fig. 1). ALK4 phosphorylation of Smad3 was inhibited by SB-525334 with an IC50 value of 58.5 nM, and ALK2 phosphorylation of Smad1 exhibited an IC50 value greater than 10 μM. Furthermore, the phosphorylation of activating transcription factor-2 by p38α mitogen-activated protein kinase was inhibited by SB-525334 with an IC50 value of 1.5 μM demonstrating that the inhibitor is more than 200-fold more selective for ALK5 than p38α (Fig. 2). To further characterize the selectivity of SB-525334 for ALK5, it was screened against a panel of various kinases at 10 μM (Table 1). SB-525334 showed less than 30% inhibition suggesting IC50 values greater than 10 μM for all kinases in this panel.
TGF-β1-induced Smad2/3 nuclear localization in RPTE cells treated with TGF-β1 in the presence or absence of SB-525334 was measured by immunofluorescence (Fig. 3). Addition of TGF-β1 significantly increased mean nuclear fluorescence by 2-fold compared with control (Fig. 4). Addition of SB-525334 to TGF-β1-induced cells reduced the mean nuclear fluorescence back to control levels. Addition of SB-525334 to the control cells showed a slight attenuation from the untreated control cells, suggesting a possible reduction in endogenous TGF-β1 signaling.
To determine whether SB-525334 can inhibit TGF-β1-induced effects on extracellular matrix, A498 renal carcinoma cells were stimulated with TGF-β1 for 24 h and treated with varying concentrations of SB-525334 (1 nM to 1 μM). SB-525334 inhibited TGF-β1-induced PAI-1 and procollagen α1(I) mRNA expression as determined by TaqMan RT-PCR with IC50 values less than 100 nM (Fig. 5).
To address the concern of nonspecific toxicity induced by the inhibition of unrelated kinases, an XTT cytotoxicity assay was performed. The XTT assay measures mitochondrial activity as an index of cell viability. A498 cells were exposed to SB-525334 for 48 h at varying concentrations (data not shown). At 30 μM, there was no effect on cell viability, a concentration significantly higher than the 100 nM needed to see a biological effect with SB-525334.
We have demonstrated that SB-525334 is an inhibitor of ALK5 and TGF-β1 signaling, but our overall goal is to identify an inhibitor which decreases ECM in vivo and protects against disease. To establish a short-term PAN model in Sprague-Dawley rats, we investigated the changes in proteinuria and ECM over 20 days following PAN administration. By day 4 following PAN injection there was a marked increase in urinary protein excreted over 24 h with a maximal excretion by day 10 (Fig. 6A). Creatinine clearance was increased by approximately 50% by day 4 and then gradually decreased to 50% of control levels by day 15, which was maintained through day 20 (Fig. 6B). The hyperfiltration observed at day 4 is likely due to the initial PAN-induced degeneration of the podocytes, resulting in enhanced permeability.
Three ECM marker genes in the kidney were profiled: procollagen α1(I), PAI-1, and fibronectin (Figs. 7 and 8). Eight days after PAN injection, there was an increase in PAI-1 mRNA levels with parallel increases in procollagen α1(I) and fibronectin mRNA. At day 10, there was a maximal increase in all three markers examined, which then decreased almost back to control levels by day 20. TGF-β1 and procollagen α1(I) expression exhibited a close correlation (data not shown). Fibronectin protein levels examined by Western blot mirrored changes in fibronectin mRNA expression (Fig. 8).
The profiles of changes in the PAN-treated SD rats indicated a maximal induction of ECM markers and proteinuria by day 10. Therefore, PAN-injected SD rats were treated with SB-525334 at 1, 3, and 10 mg/kg/day for 10 days to determine whether ECM markers can be decreased with an ALK5 inhibitor. SB-525334 is orally bioavailable (87%) and has a plasma half-life of 115 min in the rat (data not shown). At 3 mg/kg, the plasma levels of SB-525334 were 1.8 μM, 1.1 μM, and 4 nM at 1, 8, and 24 h postdosing, respectively (Fig. 9). At 10 mg/kg, the plasma levels of SB-525334 were 4.4 μM, 3.6 μM, and 30 nM, respectively. The 3-mg/kg dose was below the cellular IC50 by 24 h, however, the 10-mg/kg dose was equal to the cellular IC50 for collagen Iα1 in A498 cells.
To determine the effect of SB-525334 on PAN-induced glomerular damage, a 24-h urine collection was performed to measure proteinuria and creatinine clearance. There was a significant increase in proteinuria after PAN administration. Urinary protein exhibited a dose-dependent decrease in excretion with SB-525334 administration (Fig. 10A). At 10 mg/ kg, there was a significant decrease in proteinuria compared with the PAN only group, yet the levels were still above control. In the SD rat, creatinine clearance is normally maintained at a rate of 1 ml/min/100 g. At day 10 following PAN administration, there was approximately a 25% reduction in clearance without any improvement due to SB-525334 (Fig. 10B). The overall change in creatinine clearance was not significant from the control group.
The PAN-induced procollagen α1(I) mRNA in the kidney was approximately 4-fold higher than control (Fig. 11A). With SB-525334 administration there was a dose-dependent decrease in procollagen α1(I) mRNA, with a significant decrease at 10 mg/kg/day. A similar dose-dependent decrease was seen with procollagen III mRNA, which also exhibited a significant reduction at the 10-mg/kg dose (Fig. 11B). PAI-1 mRNA was increased by approximately 7.5-fold with PAN administration and was significantly decreased at all three SB-525334 doses (Fig. 12). PAN-induced up-regulation of TGF-β1 and fibronectin mRNA were not affected by SB-525334 (data not shown).
To analyze changes in ECM proteins within the kidney, collagen I proteins were measured by Western blot from three of the groups: control, PAN only, and 10 mg/kg/day SB-525334 with PAN. The collagen I antibody produced a double band at the molecular weight equal to a collagen positive control (Fig. 13). The kidney homogenates from the PAN only group show a greater amount of collagen I protein when compared with control groups. At a dose of 10 mg/kg, SB-525334 decreased collagen I protein compared with the PAN-treated group.
To corroborate our Western results, a trichrome stain was used to analyze collagen deposition and pathology in the kidney. Independent analysis using a scoring methodology verified that PAN administration caused increased pathology and focal fibrosis (data not shown). Representative images from the control, PAN only, 1 mg/kg/day SB-525334 + PAN, and 10 mg/kg/day SB-525334 + PAN were chosen for a visual comparison (Fig. 14). Panel A shows the normal morphology of a rat kidney with visible glomeruli, proximal tubule structures, and no blue stained collagen. At the 10-day point following PAN administration (panel B), there was an increase in focal collagen deposition, tubular dilation, and cast formation. The pathological features of PAN-induced rats persisted in the SB-525334-treated, however, there was no detectable collagen deposition in the 10-mg/kg group (panels C and D). These results verify that besides affecting collagen mRNA expression, SB-525334 also inhibited collagen deposition in the kidney.
Discussion
The purpose of this study was to characterize the activity of a potent low molecular weight inhibitor of TGF-β1 signaling SB-525334 in an in vivo model predictive of renal disease. It has been previously demonstrated that the inactivation of TGF-β1 with either a neutralizing antiserum or the putative inhibitor decorin markedly suppressed renal ECM accumulation in rat models of renal fibrosis (Border et al., 1990; Border, 1992). These data clearly implicate TGF-β1 in the pathological changes that occur in the rat kidney during renal disease. The administration of PAN to the rat results in an increase in circulating TGF-β1 and the up-regulation of ECM mRNA in the kidney (Jones et al., 1992; Eddy, 1994). As a result, it was determined that the PAN model offered the appropriate disease endpoints to analyze the ability of SB-525334 to inhibit ALK5 in a model of renal TGF-β1-induced ECM production.
Several biochemical and cellular assays were used to determine the selectivity and potency of ALK5 inhibition by SB-525334. The compound is a potent inhibitor of ALK5 kinase activity with 4-fold selectivity over ALK4 and greater than 1000-fold selectivity over ALK2, ALK3, and ALK6. There is a large degree of homology between ALK4 and ALK5, explaining the similar activity the compound has for these receptors. Also, it has been demonstrated that the TGF-β1-activated type I receptors ALK4 and ALK5 phosphorylate Smad2 and Smad3, unlike the bone morphogenetic protein-activated type I receptors ALK2, ALK3, and ALK6, which phosphorylate Smads 1, 5, and 8 (Heldin et al., 1997). Considering that homology has mirrored activity, there is no evidence that ALK1 would be inhibited by SB-525334 since it shares the greatest homology with ALK2 and ALK3 (ten Dijke et al., 1993). Besides ALK4 and ALK5, p38α was the only other protein exhibiting inhibitory activity below 10 μM. However, the IC50 for p38α was 200-fold higher than for ALK5, thus allowing a large enough window to examine a selective ALK5 inhibition.
As a consequence of inhibiting the ALK5 receptor, SB-525334 suppressed Smad2/3 nuclear localization in RPTE cells. It follows that by inhibiting Smad2/3 translocation into the nucleus, TGF-β1-induced ECM mRNA should be reduced. Treating A498 cells with elevated levels of TGF-β1 mimics fibrotic disease in the kidney stimulating an accumulation of matrix and suppressing matrix degradation by increasing PAI-1 expression (Border and Noble, 1994). TGF-β1 caused marked increases in procollagen α1(I) and PAI-1 mRNA in A498 cells, which were blocked by low nanomolar concentrations of SB-525334. Therefore, it is expected that such an inhibitor would prevent the expression of ECM components in TGF-β1-driven nephrotic models.
A single injection of PAN to the rat produces a nephrotic syndrome characterized by ultrastructural changes in glomerular visceral epithelium (podocytes), an increase in ECM mRNA, and proteinuria (Jones et al., 1992; Van Goor et al., 1993). Supporting prior observations in a 20-day profile of PAN administration in the Sprague-Dawley rat, we saw a large initial induction of proteinuria, which declined by day 15. Furthermore, creatinine clearance showed compensatory hyperfiltration at day 4 and an eventual reduction in clearance by day 15. From the profile of kidney function and ECM mRNA changes after PAN administration, it was determined that a 10-day study using PAN and SB-525334 should be sufficient to observe changes due to ALK5 inhibition.
SB-525334 showed acceptable bioavailability and plasma half-life in the SD rat for dosing up to 10 mg/kg/day. Ten days after PAN administration, there was an increase in procollagen α1(I), procollagen III, and PAI-1 mRNA levels in the kidney, which were prevented by the ALK5 inhibitor SB-525334. In glomerulosclerosis, the progressive accumulation of these ECM proteins has been directly linked to chronic renal disease (Border and Noble, 1994). Furthermore, the inhibition of collagen gene expression translated into a reduction in collagen quantity and deposition in the kidneys of the 10-mg/kg treated group. The increase in collagen deposition and the reduction of plasmin activity by PAI-1 results in a profibrotic state in the PAN-treated kidney (Roberts et al., 1992). By decreasing the expression of collagen, PAI-1, and collagen deposition, these results demonstrated that the TGF-β-driven features of the PAN model were inhibited.
There was an increase in TGF-β1 and fibronectin mRNA in the PAN-treated rats that was not affected by SB-525334 administration. In this model, a TGF-β1-positive feedback loop does not seem to be the driving force behind TGF-β1 and fibronectin mRNA expression, which may be regulated by another factor such as platelet-derived growth factor-BB (Kawano et al., 2003; Zhan et al., 2003). Furthermore, it has been shown that the predominance of TGF-β1 expression in the kidney after PAN treatment is due to infiltrating glomerular macrophages (Ding et al., 1994). Considering that macrophages have a high level of TGF-β1 expression in the unactivated state, it is plausible that the increase in glomerular macrophages could result in elevated TGF-β1 levels.
Analysis of total urinary protein excretion showed a large increase with PAN and a dose-dependent decrease when SB-525334 was administered. At 10 mg/kg/day there was a significant reduction in total protein compared with the PAN only group, but it did not return to control levels. A longer PAN study would have to be conducted to determine whether a return to control level proteinuria could have been reached. However, early podocyte depletion has been directly correlated to proteinuria in this model, and considering that the early nephrotoxic effect of PAN is not TGF-β driven, it is unlikely that SB-525334 would have a direct effect on proteinuria (Kim et al., 2001). Considering the short length of the study, an explanation for the decrease in proteinuria with SB-525334 treatment is difficult to explain. It is possible that at the high dose of SB-525334, ECM accumulation is decreased enough to show a change in proteinuria. However, there still may be an indirect effect of SB-525334 that has yet to be described.
Because the timing of termination was early to minimize loss of detection of mRNA changes, there was only a slight attenuation in creatinine clearance in PAN-treated rats at 10 days after PAN administration. As a result, an improvement in creatinine clearance with SB-525334 treatment was not detectable. To fully investigate changes in renal function with TGF-β1 inhibition, multiple injections of PAN might be needed to significantly decrease creatinine clearance (Ma et al., 2004).
In summary, SB-525334 inhibited TGF-β1-induced nuclear localization of Smad2/3 and TGF-β1-induced mRNA expression in kidney cells. In the PAN rat model, SB-525334 decreased procollagen α1(I), procollagen III, and PAI-1 mRNA in the kidney and significantly decreased proteinuria at the 10-mg/kg/day dose compared with the PAN only group. Therefore, ALK-5 inhibition may be a therapeutic intervention for nephrotic syndrome and fibrosis in progressive renal diseases. By altering pathological inducers of fibrosis and decreasing ECM expansion, renal function may increase over an extended period of treatment. It is anticipated that ALK5 inhibition may improve renal function in progressive renal diseases, such as diabetic nephropathy.
Acknowledgments
We thank Nicola Browne for assisting with RNase assays and Dr. Kendall S. Frazier for performing histological scoring.
Footnotes
-
All research for this manuscript was supported by GlaxoSmithKline.
-
doi:10.1124/jpet.104.082099.
-
ABBREVIATIONS: TGF, transforming growth factor; ECM extracellular matrix; PAI-1, plasminogen activator inhibitor-1; ALK, activin receptor-like kinase; MAPK, mitogen-activated protein kinase; PAN, puromycin aminonucleoside; FBS, fetal bovine serum; RPTE, renal proximal tubule epithelial; SB-525334, 6-[2-tert-butyl-5-(6-methyl-pyridin-2-yl)-1H-imidazol-4-yl]-quinoxaline; GST, glutathione S-transferase; PBS, phosphate-buffered saline; RT, reverse transcriptase; PCR, polymerase chain reaction; SD, Sprague-Dawley; bis-Tris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; MES, 4-morpholineethanesulfonic acid; ANOVA, analysis of variance.
- Received December 10, 2004.
- Accepted March 10, 2005.
- The American Society for Pharmacology and Experimental Therapeutics