International Union of Pharmacology. XXI. Structure, distribution, and functions of cholecystokinin receptors

…, J Bradwejn, KB Seroogy, M Hamon, BP Roques - Pharmacological …, 1999 - ASPET
The peptide cholecystokinin (CCK) 2 was originally discovered in the gastrointestinal tract (Ivy
and Oldberg, 1928) and has been shown to mediate pancreatic secretion and contraction …

First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses

…, H de Rocquigny, BP Roques - Journal of molecular …, 1995 - Elsevier
Retroviruses are a family of widespread small animal viruses about 110 nm in diameter,
composed of an inner core surrounded by an outer envelope formed of a lipid bilayer of cellular …

Inhibiting the breakdown of endogenous opioids and cannabinoids to alleviate pain

BP Roques, MC Fournié-Zaluski, M Wurm - Nature reviews Drug …, 2012 - nature.com
Chronic pain remains unsatisfactorily treated, and few novel painkillers have reached the
market in the past century. Increasing the levels of the main endogenous opioid peptides — …

Loss of morphine-induced analgesia, reward effect and withdrawal symptoms in mice lacking the µ-opioid-receptor gene

…, P Dollé, E Tzavara, J Hanoune, BP Roques… - Nature, 1996 - nature.com
… a 800-bp Pvull–Xbal cDNA fragment cloned into pBluescript, the PDYN probe from a
1,700-bp Psti–EcoRI fragment subcloned into pSP64, and the POMC probe from a 400-bp Notl–…

Unresponsiveness to Cannabinoids and Reduced Addictive Effects of Opiates in CB1 Receptor Knockout Mice

…, GA Bohme, A Imperato, T Pedrazzini, BP Roques… - Science, 1999 - science.org
… Basal blood pressure and heart rate were measured in … a sustained decrease in blood pressure
and heart rate in CB 1 +/+ … Mean blood pressure (MBP) and heart rate were monitored for …

The enkephalinase inhibitor thiorphan shows antinociceptive activity in mice

BP Roques, MC Fournie-Zaluski, E Soroca… - Nature, 1980 - nature.com
There is both theoretical and therapeutic interest in establishing whether the signals conveyed
by the enkephalins are turned off under the action of a specific peptidase which might, in …

[HTML][HTML] Absence of opiate rewarding effects in mice lacking dopamine D2 receptors

…, A Saiardi, O Valverde, TA Samad, BP Roques… - Nature, 1997 - nature.com
Dopamine receptors have been implicated in the behavioural response to drugs of abuse.
These responses are mediated particularly by the mesolimbic dopaminergic pathway arising …

The HIV-1 viral protein R induces apoptosis via a direct effect on the mitochondrial permeability transition pore

…, D Cointe, ZH Xie, JC Reed, BP Roques… - The Journal of …, 2000 - rupress.org
… of the FLAG-derived epitope (MDYKDDDDKS) plus sequence 5,141–5,153 of Lai]) and
VLCas (ATTTTCCTATATTCTATGATTACTATGGACC [5,737–5,707]), resulted in a 638-bp

[HTML][HTML] Disruption of the κ-opioid receptor gene in mice enhances sensitivity to chemical visceral pain, impairs pharmacological actions of the selective κ-agonist U …

…, I Kitchen, A Dierich, M Le Meur, BP Roques… - The EMBO …, 1998 - embopress.org
… ) by hybridization with a PCR product of 230 bp encoding the N-terminal part (amino acids
6–77) of mKOR and the position of the first coding exon was mapped by standard procedures …

High-affinity enkephalin-degrading peptidase in brain is increased after morphine

B Malfroy, JP Swerts, A Guyon, BP Roques… - Nature, 1978 - nature.com
CONSIDERABLE evidence now exists to suggest that the endogenous opioid pentapeptides
Met-enkephalin (Tyr-Gly-Gly-Phe-Met) and Leu-enkephalin (Tyr-Gly-Gly-Phe-Leu) function …