Rhesus monkey α7 nicotinic acetylcholine receptors: Comparisons to human α7 receptors expressed in Xenopus oocytes
Introduction
The α-bungarotoxin sensitive α7-type nicotinic acetylcholine receptor is expressed throughout the brain and also in the peripheral nervous system and some peripheral tissues (Sharma and Vijayaraghavan, 2002). In the brain, α7 nicotinic acetylcholine receptor are located in high concentrations in the hippocampus, neocortex, and hypothalamus as seen by binding sites (Clarke et al., 1985). The use of nicotinic agonists has improved delay matching in primates (Terry et al., 2002), eye blink memory in rabbits, and spatial-memory related behavior in rats, as well as social memory relationships in rats (Arendash et al., 1995a, Arendash et al., 1995b, Meyer et al., 1994, Van Kampen et al., 2004). Some mutations and/or splice variants of the α7 gene have been linked to a decrease in hippocampal auditory gating, which is a symptom of some schizophrenics and approximately 50% of their family members (Freedman et al., 1994, Freedman et al., 2000). This may be due to the roles played by α7 nicotinic acetylcholine receptor in the activation of GABAergic inhibitory interneurons in hippocampus (Adler et al., 1998, Frazier et al., 2003). The α7 nicotinic receptor may also be involved with the etiology and/or possible treatment of other conditions such as Alzheimer's Disease and Down's Syndrome. Nicotinic receptor agonists have been shown to improve memory and are neuroprotective. Moreover, α7 has been found to coprecipitate with the Aβ1-42 within the histopathological amyloid beta plaques (Wang et al., 2000) and the functional interactions between Aβ1-42 and α7 nicotinic acetylcholine receptor (Liu et al., 2001) further support α7 nicotinic acetylcholine receptor as a therapeutic target for Alzheimer's Disease.
The adverse side effects of nicotine or other non-selective cholinergic agonists have promoted the development of more selective α7 agonists for therapeutics. GTS-21 (2,4-dimethoxybenzylidene anabaseine or DMBX), one such selective agonist was tested in phase 1 clinical trials and was found to have no adverse side effects and to increase cognitive functioning in healthy subjects (Kitagawa et al., 2003). With the identification of α7 nicotinic receptors as potential therapeutic targets has also come the need to develop animal models for the testing of novel therapeutic agents. While rodent models are most commonly used, there are numerous pharmacological differences between rat and human α7 nicotinic receptors (Papke and Papke, 2002). Monkey models have the intrinsic advantage of being amenable to more complex behavioral testing than rodents and therefore may have special usefulness for evaluating potential drugs for human therapeutics. We report the cloning and functional characterization of a Rhesus monkey (Macaca mulatta) α7 nicotinic acetylcholine receptor (mkα7) in regard to its responses to a series of nicotinic agonists including acetylcholine (acetylcholine), choline, and cytisine, as well as the α7-selective agonists 4OH-GTS-21 (4-hydroxy 2-methoxybenzylidene anabaseine), TC-1698 (2-(3-pyridyl)-1-azabicyclo[3.2.2]nonane) and AR-R17779 ((−)-spiro[1-azabicyclo[2.2.2]octane-3′,5′-oxazolidin-2′-one) (Marrero et al., 2003, Meyer et al., 1998, Papke et al., 2004). These agonists had lower EC50s for activating human α7 (hα7) nicotinic receptors than for monkey α7 (mkα7) nicotinic receptors. Only two amino acids differ between the mkα7 and hα7 sequence in the extracellular domain. Mutations were made of mkα7 sequence to the amino acids present in hα7, and the resulting mutants were tested to determine if changing either or both of the amino acids shifted the concentration–response relationships towards that of hα7.
Section snippets
Rapid amplification of cDNA ends (RACE) for the 5′- and, 3′-ends of rhesus monkey α7
To identify the 5′- and 3′-ends of rhesus monkey α7, four primers, mkα7-5′R (CTCATCTCCACGCTGGCCAGGTGCAG), mkα7-5′N (CGCACCTTATCCTCTCCCGGCCTCTTCATG), mkα7-3′R (CATGAAGAGGCCGGGAGAGGATAAGGTGCG) and mkα7-3′N (CTGCACCTGGCCAGCGTGGAGATGAG), were designed based on Genbank sequence AJ245976 and a polymerase chain reaction (PCR) was used with a Gene Racer cDNA library generated using rhesus monkey brain mRNA (Biochain). The cDNA fragments from the nested PCR were cloned and sequenced. The 3′ fragment
The sequence of monkey α7 acetylcholine receptor
The cloned monkey α7 subunit is 502 amino acids long, with a calculated molecular weight of 56.4 kDa. There are five amino acid changes when compared to human α7 (Fig. 1). Two of the changes are localized in the extracellular N-terminal domain that involves in ligand binding; two more changes in the second intracellular loop between transmembrane domain M3 and M4; one more in the predicted signal peptide which is eliminated in mature receptor.
Electrophysiological responses of human and monkey α7 acetylcholine receptor
As shown in Fig. 2, both the human and monkey α7
Discussion
Human and monkey α7 differ significantly in their EC50 values for the endogenous agonists acetylcholine and choline, as well as for the experimental agonists, cytisine, 4OH-GTS-21, TC-1698, and AR-R17779. This basic observation should be considered if the rhesus monkey is used as a model system to test α7 agonists for human therapeutics. Specifically, our results suggest that any nicotinic agonist targeting α7 may be less potent in the monkey than it would be in humans, although antagonist
Acknowledgements
This work was supported by NIH grant GM57481-01A2 and Memory Pharmaceuticals. We thank Taiho Pharmaceuticals for providing 4-OH-GTS-21 and Targacept for providing TC-1698. We particularly thank Dr. Cathy Smith-Maxwell, and are very grateful to Axon Instruments/Molecular Devices for the use of an OpusXpress 6000A and pClamp9.1.
References (26)
- et al.
Improved learning and memory in aged rats with chronic administration of the nicotinic receptor agonist GTS-21
Brain Res.
(1995) - et al.
The alpha7-nicotinic acetylcholine receptor and the pathology of hippocampal interneurons in schizophrenia
J. Chem. Neuroanat.
(2000) - et al.
The Correction of alpha7 nicotinic acetylcholine receptor concentration–response relationships in Xenopus oocytes
Neurosci. Lett.
(1998) - et al.
Alpha7-selective agonists and modes of alpha7 receptor activation
Eur. J. Pharmacol.
(2000) - et al.
Activity of alpha7-selective agonists at nicotinic and serotonin receptors expressed in Xenopus oocytes
Bioorg. Med. Chem. Lett.
(2004) - et al.
Activation and inhibition of native neuronal alpha-bungarotoxin-sensitive nicotinic ACh receptors
Brain Res.
(2002) - et al.
beta-Amyloid(1-42) binds to alpha7 nicotinic acetylcholine receptor with high affinity. Implications for Alzheimer's disease pathology
J. Biol. Chem.
(2000) - et al.
Schizophrenia, sensory gating, and nicotinic receptors
Schizophr. Bull.
(1998) - et al.
Nicotine enhances the learning and memory of aged rats
Pharmacol. Biochem. Behav.
(1995) - et al.
Crystal structure of an ACh-binding protein reveals the ligand-binding domain of nicotinic receptors
Nature
(2001)
Nicotinic binding in rat brain: autoradiographic comparison of [3H] acetylcholine [3H] nicotine and [125I]-alpha-bungarotoxin
J. Neurosci.
Nicotinic receptors at the amino acid level
Annu. Rev. Pharmacol. Toxicol.
Nicotinic acetylcholine receptors on local circuit neurons in the dentate gyrus: a potential role in the regulation of granule cell excitability
J. Neurophysiol.
Cited by (13)
Cytisine for smoking cessation: A research agenda
2008, Drug and Alcohol DependenceExploring the pharmacological properties of insect nicotinic acetylcholine receptors
2007, Trends in Pharmacological SciencesNicotinic acetylcholine receptor involvement in inflammatory bowel disease and interactions with gut microbiota
2021, International Journal of Environmental Research and Public HealthMore than smoke and patches: The quest for pharmacotherapies to treat tobacco use disorder
2020, Pharmacological ReviewsAlpha7 nicotinic receptors as therapeutic targets in schizophrenia
2019, Nicotine and Tobacco Research