Molecular Cloning and Pharmacological Characterization of Guinea Pig 5-HT1B and 5-HT1D Receptors*
Section snippets
Molecular cloning and functional expression of guinea pig 5-HT1B and 5-HT1D receptors
A guinea pig liver genomic library in γEMBL3 (≈ 1.5 × 106 total recombinants; Clontech, Palo Alto, CA, U.S.A.) was screened, at reduced stringency (Weinshank et al., 1990), using overlapping oligonucleotide probes derived from the third intracellular and the second extracellular loops of the human 5-HT1B and 5-HT1D receptor genes (Weinshank et al., 1992): for 5-HT1B third intracellular loop (sense) 5′ GCCCGCTCCCGGATTTTGAAACAGACGCCCAACAGGACC GGCAAG 3′ and (antisense)
Cloning of guinea pig 5-HT1B and 5-HT1D receptor subtypes
Guinea pig 5-HT1B and 5-HT1D receptor genes were isolated from a guinea pig liver genomic library using oligonucleotide probes derived from the second extracellular and third intracellular loops of the corresponding human homologs. Sequence analysis of the coding region of the guinea pig 5-HT1B receptor subtype indicates the gene encodes a predicted protein of 390 amino acids (Fig. 1). The human 5-HT1B receptor is 391 amino acids in length, containing an additional amino acid (Serine at
DISCUSSION
The development of therapeutic agents is dependent upon the selection of appropriate animal models which are able to predict the clinical efficacy of drugs in humans. Evaluation of compounds targeted for a specific human receptor subtype(s) across multiple mammalian species may have deleterious consequences on drug design since the pharmacological properties of the same receptor subtype between two species may be extremely divergent. Consequently, it is essential to identify an animal model
Acknowledgements
The authors wish to acknowledge Ms. Michelle Smith, Ms. Debbie Tambe, Ms. Anastasia Kokkinakis, Mr. George Stepan, Mr. Yamin Dou and Ms. Jenny Xanthos for their expert technical assistance and Mr. George Moralishvili and Ernest Lilley for assistance with the illustrations. This work was supported in part by Eli Lilly and Company.
References (50)
A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding
Analytical Biochemistry
(1976)- et al.
Distinct 5-HT1B and 5-HT1D serotonin receptors in the rat: structural and pharmacological comparison of the two cloned receptors
Molecular and Cellular Neuroscience
(1992) - et al.
5-HT1 receptors mediating contraction in bovine cerebral arteries: a model for human cerebrovascular ‘5-HT1Dβ’ receptors
European Journal of Pharmacology
(1993) - et al.
Alignment of receptor nomenclature with the human genome: classification of 5-HT1B and 5-HT1D receptor subtypes
Trends in Pharmacological Sciences
(1996) - et al.
Cloning and characterisation of the rabbit 5-HT1Dα and 5-HT1Dβ receptors
FEBS Letters
(1995) - et al.
Characterization of the 5-HT1B recognition site in rat brain: binding studies with (−)[125I]iodocyanopindolol
European Journal of Pharmacology
(1985) - et al.
Mode of action of the anti-migraine drug sumatriptan
Trends in Pharmacological Sciences
(1991) - et al.
Conversion of the human 5-HT1Dβ serotonin receptor to the rat 5-HT1B ligand-binding phenotype by Thr355 Asn site directed mutagenesis
Biochemical Pharmacology
(1992) Neurogenic versus vascular mechanisms of sumatriptan and ergot alkaloids in migraine
Trends in Pharmacological Sciences
(1992)- et al.
Differences in the effects of ketanserin and GR 127935 on 5-HT receptor-mediated responses in rabbit saphaneous vein and guinea-pig jugular vein
European Journal of Pharmacology
(1995)
Detection of specific sequences among DNA fragments separated by gel electrophoresis
Journal of Molecular Biology
Ketanserin and ritanserin discriminate between recombinant human 5-HT1Dα and 5-HT1Dβ receptor subtypes
European Journal of Pharmacology (Molecular Pharmacology Section)
The rat 5-hydroxytryptamine1B receptor is the species homologue of the human 5-hydroxytryptamine1Dβ receptor
Molecular Pharmacology
A single point mutation increases the affinity of serotonin 5-HT1Dα, 5-HT1Dβ, 5-HT1E, and 5-HT1F receptors for β-adrenergic antagonists
Neuropharmacology
Cloning and characterization of a recombinant guinea pig 5-HT1F receptor
Society for Neuroscience Abstracts
Structure, functional expression, and spatial distribution of a cloned rat 5-HT1D-like receptor
Journal of Receptor Research
Differences in ligand binding profiles between cloned rabbit and human 5-HT1Dα and 5-HT1Dβ receptors: ketanserin and methiothepin distinguish rabbit 5-HT1D subtypes
Naunyn-Schmiedeberg's Archives of Pharmacology
Differential expression of sumatriptan-sensitive 5-hydroxytryptamine receptors in human trigeminal ganglia and cerebral blood vessels
Molecular Pharmacology
Pharmacological characterization of serotonin-5-O-carboxmethyl-glycyl-tyrosinamide, a new indolic ligand for 5-hydroxytryptamine (5-HT)1B and 5-HT1D binding sites
Journal of Pharmacology and Experimental Therapeutics
5-HT1D binding sites in varuous species: similar pharmacological profile in dog, monkey, calf, guinea-pig and human brain membranes
Naunyn-Schmiedeberg's Archives of Pharmacology
Autoradiographic characterization and localization of 5-HT1D compared to 5-HT1B binding sites in rat brain
Naunyn-Schmiedeberg's Archives of Pharmacology
Evidence for presynaptic localization of inhibitory 5-HT1Dβ-like autoreceptors in the guinea-pig brain cortex
Naynyn-Schmiedeberg's Archives of Pharmacology
Further characterization of the putative 5-HT receptor which mediates blockade of neurogenic plasma extravasation in rat dura mater
British Journal of Pharmacology
The cloning and expression of an OK cell cDNA encoding a 5-hydroxytryptamine1B receptor
Molecular Pharmacology
Cited by (33)
5-HT<inf>2A</inf> receptor levels increase in MPTP-lesioned macaques treated chronically with L-DOPA
2012, Neurobiology of AgingCitation Excerpt :However, as the concentration of ketanserin used in the current study was low, i.e., 2.5 nM, it is likely that binding to the histaminergic-1 receptors was insignificant, as previously demonstrated in rat cerebral cortex (Leysen et al., 1982). In addition to the aforementioned receptors, ketanserin also binds to dopaminergic 5-HT1B/1D receptors, with an affinity of 138 and 707 nM, respectively (Zgombick et al., 1997). Because the concentration of ketanserin used in our study is way below the affinity of the compound for these other receptors, binding to these will be insignificant, an important consideration as 5-HT1B has been suggested to have a role in LID (Jackson et al., 2004; Zhang et al., 2008).
The serotonergic system in Parkinson's disease
2011, Progress in NeurobiologyDistribution of 5-HT Receptors in the Central Nervous System
2010, Handbook of Behavioral NeuroscienceCitation Excerpt :Altogether, the data suggest that [11C]AZ10419369 is a suitable radioligand for PET studies on 5-HT1B receptor distribution and occupancy in vivo (Pierson et al., 2008). 5-HT1D receptor has been cloned, and functionally expressed in recombinant systems; ligands can label it specifically (Zgombick et al., 1995, 1996, 1997), although most of them will also label 5-HT1B receptors (see above). 5-HT1D selective antagonists have been developed for migraine, with the hope of avoiding cardiovascular side effects, but with less success than anticipated (see, for example, PNU-142633; McCall et al., 2002), especially since both 5-HT1B and 5-HT1D receptors are present in the trigeminal ganglion (Hou et al., 2001).
Acute nicotine and phencyclidine increase locomotor activity of the guinea pig with attenuated potencies relative to their effects on rat or mouse
2010, Pharmacology Biochemistry and BehaviorIn vitro characterization of AR-A000002, a novel 5-hydroxytryptamine <inf>1B</inf> autoreceptor antagonist
2004, European Journal of PharmacologyIs the beneficial antidepressant effect of coadministration of pindolol really due to somatodendritic autoreceptor antagonism?
2001, Biological PsychiatryCitation Excerpt :During these experiments plasma levels of pindolol and paroxetine, as well as pindolol brain levels in the raphe nuclei, were measured to correlate actual brain and plasma levels with the pharmacologic effects. Since pindolol has considerable affinity for rat 5-HT1B receptors but not for human and guinea pig 5-HT1B receptors, the study was performed in freely moving guinea pigs to prevent interference by 5-HT1B antagonism of pindolol during SSRI administration (Moret and Briley 1997; Zgombick et al 1997). In addition, the affinity of (−)-pindolol for guinea pig and human 5-HT1A receptors is nearly similar (Raurich et al 1999).
- *
The sequences reported in this paper have been deposited in the GenBank database (accession numbers are U82174 and U82175).