TABLE 1

Sequences, concentrations, and GenBank accession numbers of the primers and probes


Gene

Accession Number

Primer/Probe Sequence (Forward/Reverse/Probe)

Primer/Probe Concentration
nmol/l
PDGF-B-chain Z14117.1 CCGCTCCTTTGATGACCTTC 300
GCTCAGCCCCATCTTCGTC 300
CGCCTGCTGCACAGAGACTCCG 100
TGF-β1 X52498.1 GTCCCAAACGTCGAGGTGAC 300
GCCATGAGGAGCAGGAAGG 300
TGGGCACCATCCATGACATGAACC 100
CTGF NM_022266 TCTCTTCTGCGACTTCGGCT 900
CATCTTTGGCAGTGCACACG 900
CCCCGCCAACCGCAAGATTG 200
p27 D83792.1 CTTCCGCCTGCAGAAACCT 300
CTTCTCCAAGTCCCGGGTTAG 900


TTCGGCCCGGTCAATCATGAAGA
200