Table 1

Primers used in PCR reactions

MessengerForward PrimerReverse PrimerFragment Size
CYP3A11-a GGAAATTCGATGTGGAGTGC AGGTTTGCCTTTCTCTTGCC 329
CYP3A2 TACTACAAGGGCTTAGGGAG CTTGCCTGTCTCCGCCTCTT 348
CYP3A9 GGACGATTCTTGCTTACAGG ATGCTGGTGGGCTTGCCTTC 373
CYP3A18 TCCTGTCTCCAACCTTCACC CACTCGGTTCTTCTGGTTTG 413
CYP1A1 GGTGAAACAGGGGGATGACT TAACGGAGGATAGGAATGAA 438
CYP1A2 TAGTGAAGCAGGGGGATGAC GACCGGAAAGAAGTCCACAG 431
CYP2B1/2 TCAGGAGGAAGCCCAATGTT CAGCAAAGAAGAGAGAGAGC 458
CYP2C6 ATAAGACGCTTTACCCTCAC GATTTTCCTGCTTCCACTTA 460
CYP2C11 AGCTCTTGTTGATCTAGGAG GGGAAGTAATCAATAATGGC 426
CYP2E1 CTCCTCGTCATATCCATCTG GCAGCCAATCAGAAATGTGG 482
GAPDH TTCAACGGCACAGTCAAG CACACCCATCACAAACAT 240
  • 1-a  It appeared recently that the active and inducible CYP3A1 protein is encoded by CYP3A23 (GenBank accession no. L24207) and not by the originally cloned CYP3A1 gene (GenBank accession no. M10161), which was never found to be expressed in rats. We stay with the CYP3A1 terminology. However, the CYP3A1-specific PCR primers amplify the mRNA of CYP3A23.