Various PMO sequences tested in the rat PH model
| Name Sequence LW:BW (%) n | |||
|---|---|---|---|
| Splice(4150/51) 4163 | |||
| intron ↕ exon2 ↕ | |||
| Rat c-myc 5′ . . .TGCCCCCTCCAACAG/ACAGTCACGACGATGCCCCTCAACGTGAGCTTCGCTAACAGGA. . .3′ | |||
| Antisense | |||
| AVI-4126 | 3′CGCTGCTACGGGGAGTTGCA 5′ | 1.98 ± 0.10 | 9 |
| 1-22-21 | 3′GGGAGGUUGUC/UGUCAGUGCUGCUACGGGG 5′ | 1.87 ± 0.03 | 4 |
| 1-22-111 | 3′GGAGGTTGTC/TGTCAGTGCTGC 5′ | 1.88 ± 0.12 | 4 |
| 1-22-115 | 3′GCTACGGGGAGTTGCAATCG 5′ | 1.84 ± 0.10 | 7 |
| Control | |||
| Vehicle (saline) | 2.13 ± 0.08 | 13 | |
| AVI-4126 scrambled | 3′ACTGTGAGGGCGATCGCTGC 5′ | 2.06 ± 0.06 | 7 |
| 1-0-367 unrelated | 3′GCCCCTCGTTTTACTTCCCTCTCG 5′ | 2.03 ± 0.16 | 4 |
| 1-0-368 unrelated | 3′TACCTCTCCGAGGTCCCCGACG 5′ | 2.14 ± 0.06 | 4 |
The upper and lower sections of the table consist of c-myc antisense and control sequences, respectively. All mRNA target positions are based on Genbank accession no. Y00396. Liver weight-to-body weight ratios (percentage) are reported as LW/BW(%), mean ± S.E. Base residues in bold typeface indicate a mismatch with respect to the mRNA sequence and “/” indicates splice junction. n is the number of rats in respective groups.