TABLE 1

Oligonucleotide probes generated for analysis of mouse StAR and Cyp7b1 mRNA expression by QuantiGene branched DNA signal amplification assay

StAR (NM_011485a)Cyp7b1 (BC038810)
CEbtcctgcttttgtgagacggtcTTTTTctcttggaaagaaagtCEgctggaatggtgtttgctagagagTTTTTctcttggaaagaaagt
CEgaagctgctagctctgagccaTTTTTctcttggaaagaaagtCEccaggccctttcttttgaccTTTTTctcttggaaagaaagt
CEtctagctatttgtcttcctagaaggtaTTTTTctcttggaaagaaagtLEtgcctatagtatcttttcagcagatcTTTTTaggcataggacccgtgtct
CEcacctggctcccaatttataccTTTTTctcttggaaagaaagtLEgtgctcctatttcagaatcgtcaTTTTTaggcataggacccgtgtct
LEaactaccaactcccaagattttgtTTTTTaggcataggacccgtgtctLEagaatataatacattgcccagaacataTTTTTaggcataggacccgtgtct
LEctgccaggatgctgttaatcttTTTTTaggcataggacccgtgtctLEccatagcttcaggatgccgaTTTTTaggcataggacccgtgtct
LEtggtcagtattatttgatcagtataggtaTTTTTaggcataggacccgtgtctLEtttcgtcacgcagggcTTTTTTTaggcataggacccgtgtct
LEcaatagaacagtcactttatcttaacattatTTTTTaggcataggacccgtgtctLEgcagaccaagctgtccaattgTTTTTaggcataggacccgtgtct
LEggctggcatctaatctgtctataaaTTTTTaggcataggacccgtgtctLEtggagtatgagcacagcctcagTTTTTaggcataggacccgtgtct
LEacataacattttaaccttttcaaataagTTTTTaggcataggacccgtgtctLEcctgcacttctcggatgatgcTTTTTaggcataggacccgtgtct
BLtcactggggtccaagctggBLgcccagagaaagccaagatgat
BLaatgaaaatcccgtcataatcttcBLtgttgactgcaggaaactgtcaa
BLgaacaggaatgttatagctctactgactBLtctctggtgaagtggactgaaatt
BLcttaaagtgtaatatctccaaatcctgBLaacctcaagaatagtgctttccag
BLattaaagtcgtgtgccaccgt
  • BL, blocker; CE, capture extender; LE, label extender.

  • a GenBank accession numbers for each transcript are given in parenthesis after the gene name.

  • b The type of function of each branched DNA signal amplification oligonucleotide probe.