TABLE 1

The forward mutagenic primers used for preparation of the polymorphic mutants of CYP2B6

The base pairs that contain the desired mutations are underlined. The single mutants were prepared using the plasmid of CYP2B6*1 as templates, whereas the double and triple mutants were prepared using the plasmids of CYP2B6*4 and CYP2B6*6 as templates, respectively, as described under Materials and Methods.

CYP2B6Amino AcidMutagenic Primers
CYP2B6*4K262RGACCCCAGCGCCCCCCGCGACCTCATCGACACC
CYP2B6*5R487CCAACATACCAGATCTGCTTCCTGCCCCGC
CYP2B6*6Q172H/K262RCYP2B6*4 + GACCCCACCTTCCTCTTCCATTCCATTACCGC
CYP2B6*7Q172H/K262R/R487CCYP2B6*6 + CAACATACCAGATCTGCTTCCTGCCCCGC
CYP2B6*8K139EAGGGACTTCGGGATGGGAGAACGGAGTGTGGAG
CYP2B6*9Q172HGACCCCACCTTCCTCTTCCATTCCATTACCGC