TABLE 1

PCR primer sequences and cycle conditions for resequencing of DCK


Primer

Sequence 5′ to 3′

Cycle Conditions

Amplicon Size
kb
DCK5′UTR-F AGCGAACCAAGTGCTTCAAG 59°C for 1 min; 5% dimethyl sulfoxide; 1.5 mM MgCl2 1
DCk5′UTR-R GGGAATCGCACTGCCCACT
DCKex1-F AGTGGGCAGTGCGATTCCCA 59°C for 1 min; 5% dimethyl sulfoxide; 1.5 mM MgCl2 0.93
DCKex1-R GGTAAGGGAAGGATGCTCTG
DCKex2-F ATTGGGCAGGGAGCCTTTTCA 55°C for 40 s; 1.5 mM MgCl2 0.5
DCKex2-R TGGTTGAATCCATATCAATCTG
DCKex3.4-F AAGATCTAAGGATTTTCCAGAC 55°C for 2 min; 1.5 mM MgCl2 1.5
DCKex3.4-R AACTTGCCCAGTCTGGGATT
DCKex5.6-F AGTACTGCTTGGCTTAGAGC 55°C for 2 min; 1.5 mM MgCl2 1.5
DCKex5.6-R TAGCTCAGGCCACAAAGCTAG
DCKex7.3′UTR-F ATGCAATGGCATTGTGGTAGT 57°C for 2 min; 2 mM MgCl2 1.8
DCKex7.3′UTR-R GCATAGCAGAAGAGAAAATTCT
DCK-Intron1-F CCAGAGCATCCTTCCCTTAC 59°C for 1 min; 1.5 mM MgCl2 4
DCK-Intron1-R
TGAAAAGGCTCCCTGCCCAAT


  • kb, kilobase.