Tyrosine Phosphatase-Dependent/Tyrosine Kinase-Independent Induction of Nuclear Factor-κB by Tumor Necrosis Factor-α: Effects on Prostaglandin Endoperoxide Synthase-2 mRNA Accumulation
Abstract
We previously have demonstrated that tumor necrosis factor-α (TNF-α) increases prostaglandin endoperoxide synthase-2 (PGHS-2) mRNA accumulation and tyrosine phosphorylation in the fibrosarcoma cell line, MCA-101. Tyrosine kinase inhibitor, genistein, and tyrosine phosphatase inhibitor, phenylarsine oxide (PAO), blocked TNF-α-mediated induction of PGHS-2 mRNA in these cells. Because the PGHS-2 promoter has a nuclear factor-κB (NF-κB) binding motif, which is important for PGHS-2 gene transcription in some cell types, we have evaluated the effects of tyrosine kinase inhibitors and PAO on TNF-α-induced NF-κB activation. TNF-α (1 nM) rapidly induced translocation of NF-κB, an event accompanied by degradation of inhibitory protein IκB-α. N-tosyl-l-phenylalanine chloromethyl ketone (TPCK), a serine protease inhibitor, inhibited IκB-α degradation and NF-κB activation in response to TNF-α in a dose-dependent manner (25, 50, 100 μM). TPCK also inhibited PGHS-2 mRNA accumulation. These data suggest that NF-κB contributed to PGHS-2 mRNA accumulation in MCA-101 cells stimulated with TNF-α. PAO (2.4 μM) completely abolished activation of NF-κB and degradation of IκB-α induced by TNF-α at a concentration that blocked PGHS-2 mRNA accumulation. However, four tyrosine kinase inhibitors, genistein, tyrphostin 47, herbimycin A and erbstatin, failed to block translocation of NF-κB and degradation of IκB-α. These data demonstrate that tyrosine kinase pathways are not required for TNF-α-induced NF-κB activation in MCA-101 cells and suggest that signaling via these pathways mediates TNF-α-induced PGHS-2 mRNA accumulation via an NF-κB-independent mechanism. Moreover, an upstream tyrosine phosphatase pathway may mediate PGHS-2 mRNA accumulation by TNF-α via an NF-κB-dependent mechanism.
Tumor necrosis factor-α is a primary mediator of the immune and inflammatory responses (Vassalli, 1992). Induction of PGHS-2, with a subsequent increase in prostaglandin formation, may contribute to the net outcome of these responses. We demonstrated previously that TNF-α increases PGHS-2 mRNA accumulation, protein expression and prostaglandin E2 formation in MCA-101 cells, a murine fibrosarcoma cell line. Our results suggested that PTKs and PTP-ase(s) play a role in the transcriptional and post-transcriptional mechanisms that contribute to the regulation of the PGHS-2 gene by TNF-α (Mahboubi et al., 1997a).
Binding of TNF-α to p55 and p75 receptors, which lack intrinsic PTKs and PTPase(s) activity, triggers multiple signaling pathways, that result in activation of promoters and enhancers of various genes including interleukin-6 (Patestos et al., 1993), interleukin-8 (Mukaida et al., 1990), endothelial cell adhesion molecules (Collins et al., 1995) and PGHS-2 (Yamamoto et al., 1995). TNF-α-mediated induction of some of these genes occurs, at least in part, via induction of transcription factor NF-κB. For instance, Yamamota et al.(1995) demonstrated the potential role of NF-κB in the induction of PGHS-2 by TNF-α in MC3T3-E1 cells. NF-κB is a heterodimer that comprises a 48- to 55-kdalton DNA binding subunit (p50) and a 65- to 68-kdalton transactivator (p65) (Siebenlist et al., 1994), and it is sequestered within the cytosol by association with an inhibitory protein, IκB-α. Activation is post-translational and results from dissociation of IκB-α followed by translocation of the released NF-κB into the nucleus. TNF-α is a potent activator of NF-κB in a wide variety of the cell types including MCA-101 cells (Mahboubi et al., 1997b). Both TNF-α receptors independently mediate NF-κB activation by TNF-α (Rothe et al., 1995; Hohmann et al., 1990); however, the precise mechanism responsible for this activation is unknown. Like all NF-κB activators, TNF-α causes serine phosphorylation of IκB-α and nearly complete degradation of the inhibitor within minutes after administration (Miyamoto et al., 1994; Finco et al., 1994; Sun et al., 1995; Menon et al., 1995; Mahboubi et al., 1997b). Several signaling pathways, including acidic and neutral sphingomyelinase-generated ceramides (Schutze et al., 1992), PTKs (Anderson et al., 1994; Reddy et al., 1994), PTPase(s) (Menon et al., 1995; Singh and Aggarwal, 1995), proteases (Finco et al., 1994) and superoxide radicals (Schreck et al., 1992; Suzuki et al., 1994; Schulze-Osthoff et al., 1993), have been implicated in TNF-α-induced phosphorylation of IκB-α in different cell types. Whether these signals are generated by TNF-α sequentially or independently of each other, however, is not understood. Moreover, the relative contribution of the individual signaling components to TNF-α-mediated NF-κB likely will differ among cell types.
The role of PTPase(s) and PTKs in cytokine receptor signaling has been investigated with use of various chemical inhibitors such as PAO, which inhibits PTPase(s), and genistein, tyrphostin, herbimycin A and erbstatin, which inhibit tyrosine kinases. By use of these inhibitors, it has been shown that PTKs and PTPase(s) are part of TNF-α signal transduction pathways. The importance of PTKs and PTP-ase(s) in mediating TNF-α cytotoxicity (Sasaki and Patek, 1995; Mishra et al., 1994; Totpal et al., 1992) and NF-κB activation (Singh and Aggarwal, 1995; Guesdon et al., 1995; Andersonet al., 1994; Reddy et al., 1994) has been demonstrated in several cell types.
We previously showed that TNF-α induces tyrosine phosphorylation in MCA-101 cells and that tyrosine kinase and tyrosine phosphatase inhibitors prevent accumulation of PGHS-2 mRNA induced by TNF-α in these cells (Mahboubi et al., 1997a). In the present study we demonstrated that PTP-ase(s) inhibitor, PAO, abrogates the TNF-α-induced IκB-α degradation, and subsequently, TNF-α-induced nuclear translocation of NF-κB in MCA-101 cells. A serine protease inhibitor, TPCK, inhibits both PGHS-2 mRNA accumulation and NF-κB activation induced by TNF-α in these cells. However, tyrosine kinase inhibitors do not inhibit NF-κB activation induced by TNF-α in these cells. Taken together, these results suggest that a tyrosine kinase pathway may not be required for TNF-α-induced NF-κB activation but is involved in TNF-α signal transduction pathways leading to increased PGHS-2 accumulation in MCA-101 cells. Moreover, tyrosine phosphatase-dependent NF-κB activation by TNF-α may be an important mechanism by which PGHS-2 mRNA accumulation is increased.
Experimental Procedures
Cell line and reagents.
MCA-101 (a kind gift from Dr. Nicholas Restifo, National Cancer Institute, Bethesda, MD) is a fibrosarcoma cell line of B6 origin that was generated and cultured as described previously (Mahboubi et al., 1997b). Recombinant mouse TNF-α was purchased from Genzyme (Boston, MA). PAO, TPCK, leupeptin, PMSF, MTT and sodium orthovanadate were from Sigma Chemical Co. (St. Louis, MO). Genistein, tyrphostin 47, herbimycin A and erbstatin were purchased from LC Lab (Wonburn, MA). The PGHS-2 cDNA probe (1.9 kb) was obtained from Oxford (Oxford, MI).
Western blot analysis of IκB-α.
After the appropriate treatment with TNF-α, the media were removed and cells washed twice with ice-cold PBS. Cells were harvested and centrifuged at 600 ×g for 4 min in the cold room. The pellet was lysed with RIPA buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM PMSF, 10 μg/ml leupeptin, 1 mM sodium orthovanadate) for 30 min on ice. The lysate was centrifuged at 10,000 × g for 20 min at 4°C. Protein concentrations of the supernatant were determined with a detergent-compatible Bio-Rad protein assay kit. Cell lysate (20 μg) was dissolved in an equal volume of 2× SDS-PAGE sample buffer (100 mM Tris-Cl, pH 6.8, 200 mM DTT, 4% SDS, 0.2% bromophenol blue, 20% glycerol) and boiled for 3 min. The proteins in the cell lysate were separated on a 10% SDS-PAGE gel and transferred to nitrocellulose. Nonspecific sites on the membrane were blocked by incubating the membrane in blocking solution containing 3% non-fat dry milk in TBST at room temperature for 30 min. After blocking, membranes were immunoblotted with rabbit anti-human IκB-α antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at 1 μg/ml in blocking solution for 45 min and washed two times for 7 min with TBST. Membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit antisera (Santa Cruz Biotechnology, Santa Cruz, CA) and diluted in blocking solution for 30 min at room temperature. Membranes were washed with TBST, and IκB-α protein was detected by the enhanced chemiluminescence system (Amersham, Arlington Heights, IL).
Total RNA isolation and Northern blot analysis.
Confluent, quiescent cells were incubated in the absence or presence of TNF-α in media containing 0.5% serum. After various incubation periods, media were removed and the cell monolayers washed twice with ice-cold PBS. Total cellular RNA was isolated by lysing the cells in guanidine isothiocyanate sodium citrate buffer and extracting RNA with ethanol as described previously (Kamdar and Evans, 1992). RNA (10 μg) was electrophoresed in a 1% agarose/formaldehyde gel in 1× 3-[N-morpholino] propane sulfonic acid as running buffer. RNA was then transferred to a nylon membrane (Genescreen, Dupont-New England Nuclear, Boston, MA) and hybridized to a randomly primed32P-labeled cDNA probe in buffer containing: 50% formamide, 10% dextran sulfate, 0.2% polyvinylpyrrolidone, 0.2% ficoll, 0.2% bovine serum albumin, 1.0 M NaCl, 1.0% SDS, 0.05 M Tris, pH 7.5, and 0.1% sodium phosphate at 42°C for 24 hr. After hybridization, the membrane was washed with 2× SSC, 1.0% SDS at 65°C for 1 hr and 0.1% SSC at 25°C for 1 hr. Then the probed blots were exposed at −70°C to XAR-5 X-ray film (Eastman Kodak, Rochester, NY).
Nuclear extraction and EMSA.
Nuclear protein extracts were prepared by the method of Schreiber et al. (1989). Cells were washed twice in ice-cold PBS, then harvested in buffer A (20 mM HEPES, pH 8.0, 0.32 M sucrose, 2.0 mM CaCl2, 2.0 mM MgCl2, 0.1 mM EDTA, 0.5% NP-40, 1.0 mM DTT, 0.25 mM PMSF, 1 μg/ml leupeptin) and nuclei pelleted by centrifugation at 1500 × g for 5 min at 4°C. Pelleted nuclei were resuspended in 50 μl of buffer B (20 mM HEPES, pH 8.0, 25% glycerol, 0.42 M NaCl, 2 mM MgCl2, 0.2 mM EDTA, 1.0 mM DTT and 0.25 mM PMSF, 1 μg/ml leupeptin). Nuclei pellets were mixed gently and incubated on ice for 15 min. Nuclear debris was removed by centrifugation for 15 min at 10,000 ×g, and the nuclear protein concentration was measured by the Bradford method.
Five nanomoles of double-stranded NF-κB oligonucleotide (5′… AGTTGAGGGGACTTTCCCAGGC, Promega, Madison, WI) was 5′-end-labeled with [γ-32P]ATP (specific activity, 3,000 Ci/mmol; Amersham, Arlington Heights, IL) and T4 polynucleotide kinase (Clontech, Palo Alto, CA). The unincorporated [γ-32P]ATP was separated from labeled probe by electrophoresis in a 15% polyacrylamide gel. The labeled NF-κB was extracted with phenol/chloroform followed by ethanol precipitation. The final pellet was dissolved in Tris-EDTA buffer, pH 7.4. Binding reaction mixtures containing 20 μg protein of nuclear extract,32P-labeled NF-κB probe and 2 μg of calf thymus DNA in binding buffer (20 mM HEPES, pH 8.0, 5 mM DTT, 0.2 mM EDTA, 0.2 mM PMSF, 2 mM MgCl2, 10% glycerol, 1 μg/ml leupeptin) were incubated at room temperature for 20 min. Samples were analyzed by use of native 6% polyacrylamide gels followed by autoradiography.
Cytotoxicity assay.
MCA-101 cells were cultured in 96-well plates (2.5 × 105 per well) overnight. The next day, media were removed and drugs or media were added for 2 or 3 hr. At the end of the incubation periods, the viability of the cells was determined by assaying their metabolic capacity with use of MTT (Mosmann, 1983). MTT (1 mg/ml) was added to all the wells. After a 2-hr incubation at 37°C/5% CO2 in the presence of MTT, acidified isopropanol was added to each well and the plates were read with a test wavelength of 570 nm and a reference wavelength of 630 nm.
Results
TNF-α-mediated activation of NF-κB in MCA-101 cells.
MCA-101 cells were incubated with TNF-α (1 nM) for various times. Nuclear extracts were prepared, incubated with a32P-labeled NF-κB oligonucleotide probe and separated by gel electrophoresis. Incubation of confluent, quiescent MCA-101 cells with TNF-α for 15 min revealed that NF-κB binding activity was increased markedly in nuclear extracts (fig. 1A). NF-κB activity was maximal after stimulation with TNF-α for 1 hr and was still evident up to 4 hr (fig. 1A). Competition experiments with a 100-fold molar excess of unlabeled NF-κB consensus oligonucleotide were done to verify the specificity of the NF-κB binding activity in nuclear extracts from TNF-α-treated cells. NF-κB binding activity in nuclear extracts from cells treated with TNF-α for 1 hr was completely absent when extracts were incubated with unlabeled NF-κB consensus oligonucleotide competitor before the addition of32P-labeled NF-κB probe (fig. 1B). In contrast, the DNA binding activity was not affected by a 100-fold molar excess of the nonspecific competitor, AP-1 (fig. 1B). The identity of the putative NF-κB complex was confirmed by use of EMSA in conjunction with antibody mobility supershifts. Nuclear extracts from TNF-α-stimulated cells were incubated with32P-labeled NF-κB probe for 30 min, and antibodies specific for either p65 or p50 were then added for an additional 30 min. When anti-NF-κB p65 or anti-NF-κB p50 antibodies were added to the EMSA binding reaction, the mobility of the putative NF-κB complex clearly was diminished compared with the mobility of the complex in the absence of these antibodies (data not shown). Thus, the complex induced by TNF-α is a form of NF-κB containing the p65 (rel A) and p50 subunits.
TPCK inhibits TNF-α-mediated activation of NF-κB.
Degradation of IκB-α protein by unknown proteases plays a critical role in the activation of NF-κB in vivo. Evidence for this emerges from studies with inhibitors of chymotrypsin-like proteases, such as TPCK, a serine protease inhibitor which modifies histidine residues in active sites (Schoellmann and Shaw, 1962) and blocks degradation of IκB-α and activation of NF-κB by TNF-α in different cell types (Finco et al., 1994; Menon et al., 1995). EMSA were performed to determine whether TPCK also inhibits NF-κB activation by TNF-α in MCA-101 cells. Cells were preincubated with different doses of TPCK (25, 50 or 100 μM) for 10 min followed by a 1-hr incubation with 1 nM TNF-α. After incubation, nuclear extracts were prepared and NF-κB activity was measured. TNF-α-mediated activation of NF-κB was inhibited in a dose-dependent manner in the presence of TPCK and was inhibited completely in the presence of 100 μM TPCK (fig. 2). In vitro treatment of nuclear extracts from TNF-α-stimulated cells, containing activated NF-κB free of IκB-α, with TPCK did not inhibit the DNA binding of activated NF-κB (data not shown). This indicated that TPCK does not directly block binding of the NF-κB complex to DNA. Cell viability, as determined by the MTT assay, was 100% after treatment for 2 or 3 hr with 25 μM TPCK and ranged from 88 to 96% after treatment for 2 or 3 hr with 50 or 100 μM TPCK.
Additional experiments were performed to ensure that the effects of TPCK on NF-κB activation were related to IκB-α degradation. We previously demonstrated that TNF-α induces IκB-α degradation in MCA-101 cells and complete degradation is seen 15 min after addition of TNF-α (Mahboubi et al., 1997b). In the present study, cells were preincubated with media alone (control), or different doses of TPCK (25, 50 or 100 μM) for 10 min, then incubated with or without 1 nM TNF-α for 15 min. IκB-α protein was detected in control cells (fig. 3). On the other hand, incubation with TNF-α for 15 min caused degradation of the IκB-α protein in the absence of TPCK. TNF-α-mediated degradation of IκB-α protein was partially inhibited by 25 μM TPCK, the concentration that partially inhibited TNF-α-mediated activation NF-κB. However, TNF-α-mediated degradation of IκB-α was inhibited drastically in the presence of either 50 or 100 μM TPCK, the dose that completely inhibited TNF-α-mediated activation of NF-κB. Taken together, these data indicate that TPCK can inhibit TNF-α-mediated activation of NF-κB and degradation of IκB-α protein in MCA-101 cells.
TPCK inhibits PGHS-2 mRNA accumulation induced by TNF-α.
TPCK was used to investigate whether NF-κB activation plays a role in TNF-α-mediated induction of PGHS-2 mRNA accumulation. Cells were preincubated for 10 min with media or TPCK, then incubated with or without TNF-α for 3 hr, lysed and Northern blot analysis performed with use of a specific PGHS-2 cDNA probe. As shown previously (Mahboubiet al., 1997a), PGHS-2 mRNA accumulation was increased significantly by TNF-α in MCA-101 cells (fig. 4). Preincubation with 25 μM TPCK slightly reduced PGHS-2 mRNA accumulation induced by TNF-α, whereas 50 μM of TPCK completely inhibited PGHS-2 mRNA accumulation by TNF-α (fig. 4). Thus, TPCK, which inhibited NF-κB activation and prevented the TNF-α-mediated degradation of IκB-α, also inhibited PGHS-2 mRNA accumulation induced by TNF-α.
TNF-α-mediated activation of NF-κB is inhibited by PAO.
NF-κB activation was assessed in cells challenged with TNF-α in the absence or presence of a tyrosine phosphatase inhibitor, PAO, to assess if activation of tyrosine phosphatase(s) also plays a role in NF-κB activation by TNF-α. Cells were preincubated with 2.4 μM PAO for 10 min, then incubated with or without TNF-α for 1 hr; this dose of PAO previously was shown to maximally increase tyrosine phosphorylation in MCA 101 cells (Mahboubi et al., 1997a). Preincubation with PAO completely inhibited NF-κB activation by TNF-α (fig. 5). Nuclear extracts from TNF-α-stimulated cells, which contain activated NF-κB free of IκB-α, were incubated alone or with 2.4 μM PAO for 10 min, after which labeled probe was added. In vitro treatment of extracts with PAO did not inhibit the DNA binding of activated NF-κB (data not shown), which indicates that PAO does not directly block binding of the NF-κB complex to DNA. These results suggest the involvement of a PTPase(s) in TNF-α signal transduction pathways leading to the activation of NF-κB in MCA-101 cells. PAO did not affect cell viability as measured by the MTT cytotoxicity assay.
The effects of PAO on IκB-α protein degradation induced by TNF-α were evaluated to confirm that PAO inhibited TNF-α-mediated activation of NF-κB. Cells were preincubated with PAO for 10 min, then incubated with or without TNF-α for an additional 15 min. IκB-α protein was detected in both control and PAO-treated cells (fig. 6). On the other hand, TNF-α caused degradation of IκB-α protein in the absence of PAO (fig. 6). The TNF-α-mediated degradation of IκB-α protein was prevented completely when cells were preincubated for 10 min with PAO before the addition of TNF-α. We conclude that activity of a putative PTPase(s) is critical for degradation of IκB-α protein by TNF-α in MCA-101 cells.
Tyrosine kinase inhibitors do not prevent activation of NF-κB by TNF-α.
Recent studies with tyrosine kinase inhibitors have demonstrated that TNF-α activates NF-κB via a tyrosine kinase signaling pathway(s) (Anderson et al., 1994; Reddyet al., 1994). We previously showed that TNF-α induces tyrosine phosphorylation in MCA-101 cells (Mahboubi et al., 1997a). Therefore, we determined whether activation of tyrosine kinases is involved in TNF-α signal transduction leading to NF-κB activation in these cells. Cells were preincubated for 1 hr with increasing concentrations of genistein (50, 100, 200 μM) and then were incubated with or without TNF-α for 1 hr. TNF-α-activated NF-κB and preincubation with genistein did not inhibit this effect (fig. 7). Other tyrosine kinase inhibitors including tyrphostin 47 (300 μM), herbimycin A (1.7 μM) and erbstatin (50 μM) also did not inhibit NF-κB activation by TNF-α in MCA-101 cells (data not shown). Similarly, several tyrosine kinase inhibitors had no effect on TNF-α-mediated degradation of IκB-α protein in MCA-101 cells. Cells were preincubated for 1 hr with 200 μM genistein, 300 μM tyrphostin 47, 50 μM erbstatin or 1.7 μM herbimycin A, then incubated without or with 1 nM TNF-α for 15 min. IκB-α protein was present in both unstimulated (control) cells and cells treated with tyrosine kinase inhibitors (fig. 8). Moreover, TNF-α caused degradation of IκB-α protein in the absence or presence of tyrosine kinase inhibitors (fig. 8). These data suggest that TNF-α activates NF-κB in MCA-101 cells via a tyrosine kinase-independent pathway.
Discussion
In this study we demonstrated that PTPase(s), but not PTKs, contribute to TNF-α-induced proteolysis of IκB-α and TNF-α-mediated NF-κB activation in MCA-101 cells. We also showed that inhibition of NF-κB by TPCK prevented the TNF-α-mediated increase in PGHS-2 mRNA accumulation in these cells. We previously showed that inhibition of PTP-ase(s) and PTKs inhibited TNF-α-mediated induction of PGHS-2 mRNA (Mahboubi et al., 1997a). Accordingly, we postulate that TNF-α-mediated NF-κB activation, via a PTP-ase-dependent mechanism, increases transcription of the PGHS-2 gene. Moreover, activation of tyrosine kinases by TNF-α contributes to induction of PGHS-2 mRNAvia an NF-κB-independent pathway. Thus, TNF-α (i.e., a single cytokine) can increase PGHS-2 by either a NF-κB-dependent or NF-κB-independent mechanism. Because inhibition of serine/threonine phosphatases with okadaic acid increases PGHS-2 mRNA accumulation by an NF-κB-independent mechanism (Mahboubiet al., 1997b), it is apparent that the PGHS-2 gene may be regulated by multiple mechanisms within a given cell type.
The signal transduction pathways associated with TNF-α receptors in MCA-101 cells were evaluated in the present study. Both TNF-α receptors (p55, p75) lack intrinsic tyrosine kinase and tyrosine phosphatase activity. However, PTKs and PTPase(s) have been hypothesized to be a part of TNF-α signal transduction pathways. For instance, modulation of cellular tyrosine kinase and tyrosine phosphatase activity by kinase and phosphatase inhibitors, respectively, can block the growth inhibitory effects of TNF-α (Sasaki and Patek, 1995; Mishra et al., 1994; Totpalet al., 1992) and NF-κB activation (Singh and Aggarwal, 1995; Guesdon et al., 1995; Anderson et al., 1994; Reddy et al., 1994). Tyrosine kinase inhibitors inhibit NF-κB activation by TNF-α in Jurkat Bκ5.2 cells (Andersonet al., 1994), in a human histiocytic lymphoma cell line (U937) (Reddy et al., 1994) and in endothelial cells (Weberet al., 1995). We previously demonstrated that TNF-α increases tyrosine phosphorylation in MCA-101 cells and the tyrosine kinase inhibitor, genistein, inhibits TNF-α-mediated increases in PGHS-2 mRNA accumulation (Mahboubi et al., 1997a). The doses of genistein used in the present study are specific for tyrosine kinases and have no effect on serine/threonine kinases, PKA or PKC (Akiyama et al., 1987; Akiyama and Ogawara, 1991; van Hinsbergh et al., 1994). Thus, we postulated that TNF-α-induced tyrosine phosphorylation played a role in TNF-α-mediated activation of NF-κB in these cells. Unlike previous reports where tyrosine kinase inhibitors abolished TNF-α-mediated NF-κB activation, our results indicate that tyrosine phosphorylation is not involved in TNF-α signal transduction leading to NF-κB activation in MCA-101 cells. Anderson et al. (1994)suggested that activation of an unidentified redox-sensitive PTK(s) is a common requirement for the triggering of NF-κB activation by TNF-α and oxidants in Jurkat T cells. Induction of NF-κB by TNF-α apparently is independent of and excludes a role for reactive oxygen intermediates in MCA-101 cells (Mahboubi K, Young W and Ferreri NR, unpublished data). Therefore, it is possible that a redox-sensitive PTK(s), which is activated in Jurkat T cells in response to TNF-α, is not activated in TNF-α-stimulated MCA-101 cells.
A tyrosine phosphatase inhibitor, PAO, increases tyrosine phosphorylation in several cell types (Staal et al., 1994;Menon et al., 1995) including MCA-101 cells (Mahboubiet al., 1997a) and inhibits NF-κB activation by TNF-α in the transformed monocyte cell line (U-937) (Menon et al., 1995) and monoblastic leukemia cell line (ML-1a) (Singh and Aggarwal, 1995). Menon et al. (1995) demonstrated that tyrosine phosphatase inhibitor, PAO, abolished TNF-α-induced serine phosphorylation and degradation of IκB-α in U937 cells. In the present study, we demonstrated the importance of tyrosine phosphatases because inhibition of PTPase(s) with PAO prevented TNF-α-mediated IκB-α degradation and, thus, NF-κB activation.
The promoter region of the mouse PGHS-2 gene has been cloned and sequenced (Fletcher et al., 1992). It contains various putative transcriptional regulatory elements such as NF-κB, SP1, ETS, AP-2, CRE, NF-IL6 (C/EBPβ) and ATF. Among these elements, CRE (Xieet al., 1994), C/EBPβ (NF-IL6) (Sirois and Richards, 1993;Yamamoto et al., 1995) and NF-κB (Yamamoto et al., 1995) acted as positive regulatory elements for PGHS-2 gene transcription. We previously showed that a transcriptional mechanism contributes to the TNF-α-mediated increase in PGHS-2 mRNA accumulation in MCA-101 cells (Mahboubi et al., 1997a). Therefore, NF-κB may be an important transcription factor that contributes to the regulation of the PGHS-2 gene by TNF-α in these cells. We showed that two inhibitors of NF-κB, a protease inhibitor (TPCK) and tyrosine phosphatase inhibitor (PAO) (Mahboubi et al., 1997a) abrogated TNF-α-induced PGHS-2 mRNA accumulation. These data are consistent with the hypothesis that activation of NF-κB by TNF-α may be linked to the TNF-α-mediated increase of PGHS-2 gene transcription.
Regulation of gene transcription generally is controlled by the concerted action of more than one transcription factor. For instance, activation of NF-κB is necessary, but is not sufficient, for induction of interleukin-6 (Patestos et al., 1993), interleukin-8 (Mukaida et al., 1990) and endothelial cell adhesion molecules (Collins et al., 1995) by TNF-α.Yamamota et al. (1995) demonstrated the involvement of both NF-κB and C/EBPβ (NF-IL6) motifs in the TNF-α-dependent PGHS-2 induction in MC3T3-E1 cells. Our data do not exclude the possible role of transcription factor C/EBPβ (NF-IL6) and other transcription factors in the TNF-α-dependent PGHS-2 induction in MCA-101 cells. Moreover, we previously showed that okadaic acid, a serine-threonine phosphatase inhibitor, increases PGHS-2 transcription without activation of NF-κB in MCA-101 cells (Mahboubi et al., 1997b), which indicates a role for other transcription factors in the regulation of PGHS-2 gene transcription. Tyrosine kinase-mediated induction of PGHS-2 by TNF-α is NF-κB-independent, according to our findings. Thus, the inability to link PTKs to NF-κB activation may suggest that TNF-α-mediated PTKs activation, which results in PGHS-2 mRNA accumulation and presumably gene transcription, leads to activation of other transcription factor(s) in MCA-101 cells involved in PGHS-2 gene transcription. The role of C/EBPβ (NF-IL6) and other transcription factors in TNF-α-mediated induction of PGHS-2 gene transcription in MCA-101 cells remains to be determined.
Footnotes
-
Send reprint requests to: Dr. Keyvan Mahboubi, Department of Pharmacology, New York Medical College, Valhalla, NY 10595.
- Abbreviations:
- PGHS-2
- prostaglandin endoperoxide synthase-2
- NF-κB
- nuclear factor-κB
- MCA
- methylcholanthrene
- TNF-α
- tumor necrosis factor-α
- TBST
- tris buffer saline tween
- SDS
- sodium dodecyl sulfate
- PBS
- phosphate-buffered saline
- EMSA
- electrophoresis mobility shift assay
- C/EBPβ
- CCAAT/enhancer binding protein β
- CRE
- cyclic AMP response element
- PMSF
- phenylmethylsulfonyl fluoride
- PAO
- phenylarsine oxide
- PTKs
- protein tyrosine kinases
- PTPase(s)
- protein tyrosine phosphatases
- TPCK
- N-tosyl-l-phenylalanine chloromethyl ketone
- MTT
- 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium
- PAGE
- polyacrylamide gel electrophoresis
- HEPES
- N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid
- EDTA
- ethylenediaminetetraacetic acid
- DTT
- dithiothreitol
- SSC
- standard saline citrate
-
- Received April 8, 1997.
- Accepted January 27, 1998.
- The American Society for Pharmacology and Experimental Therapeutics
References
Time course of TNF-α-mediated NF-κB activation. Confluent, quiescent MCA-101 cells were incubated with media (control), or media containing 1 nM TNF-α. Nuclear extracts were prepared at either time zero (control), 15 min, 30 min, 1 hr or 4 hr after addition of TNF-α (A). EMSA was performed to detect an activated NF-κB complex in the nuclear extracts, as described under “Experimental Procedures.” The asterisk denotes the nonspecific complex; the NF-κB label indicates the specific binding complex. To determine the specificity of the NF-κB probe, nuclear extracts from TNF-α-stimulated cells were preincubated with either 100-fold molar excess of specific (cold NF-κB) or nonspecific oligonuclotide (cold AP-1) for 10 min before the addition of 32P-labeled NF-κB consensus oligonucleotide (B). The asterisk denotes the nonspecific complex; the NF-κB label indicates the specific binding complex. These figures represent three similar experiments.
Effect of protease inhibitor (TPCK) on NF-κB activation by TNF-α. Confluent, quiescent MCA-101 cells were pretreated with media, or different doses of TPCK (25, 50 and 100 μM) for 10 min, and subsequently stimulated with 1 nM TNF-α for 1 hr. Nuclear extracts were prepared and EMSA performed, as described under “Experimental Procedures.” The asterisk denotes the nonspecific complex; the NF-κB label indicates the specific binding complex. This figure represents three similar experiments.
Effect of TPCK on TNF-α-induced IκB-α protein degradation. Confluent, quiescent MCA-101 cells were pretreated with media (control) or TPCK (25, 50 and 100 μM) for 10 min, and subsequently stimulated with 1 nM TNF-α for 15 min. After incubation, cell lysates were separated on a 10% SDS gel, and IκB-α protein was detected with anti-IκB-α antibody, as described under “Experimental Procedures.” This figure represents three similar experiments.
Effect of TPCK on PGHS-2 mRNA accumulation induced by TNF-α. (A) MCA-101 cells were pretreated with media (control) or different doses of TPCK (25 and 50 μM) for 10 min, and subsequently stimulated with or without 1 nM TNF-α. After 3 hr, total RNA was isolated and PGHS-2 mRNA levels were detected by Northern blot analysis with a specific 32P-labeled cDNA probe for PGHS-2 (upper panel). RNA quantity and integrity were verified by ethidium bromide staining of 28S and 18S ribosomal RNA (bottom panel). This figure represents three similar experiments. (B) The relative intensity of the COX-2 mRNA bands were determined by scanning densitometry and normalized with use of the corresponding levels of 28S RNA.
The protein tyrosine phosphatase inhibitor (PAO) prevents NF-κB activation by TNF-α. MCA-101 cells were pretreated with media (control) or 2.4 μM PAO for 10 min, and subsequently incubated in the absence or presence of 1 nM TNF-α for 1 hr. Nuclear extracts were prepared and EMSA performed, as described under “Experimental Procedures.” The asterisk denotes the nonspecific complex; NF-κB label indicates the specific binding complex. This figure represents three similar experiments.
The protein tyrosine phosphatase inhibitor (PAO) prevents TNF-α-induced IκB-α protein degradation. MCA-101 cells were pretreated with media or 2.4 μM PAO for 10 min, and subsequently incubated with or without 1 nM TNF-α for 15 min. After incubation, cell lysates were separated on a 10% SDS gel, and the IκB-α protein was detected with the anti-IκB-α antibody, as described under “Experimental Procedures.” This figure represents three similar experiments.
TNF-α-mediated NF-κB activation is not affected by genistein. MCA-101 cells were pretreated with media or different doses of genistein (50, 100 and 200 μM) for 1 hr, and subsequently incubated with or without 1 nM TNF-α for 1 hr. Nuclear extracts were prepared and EMSA performed, as described under “Experimental Procedures.” The asterisk denotes the nonspecific complex; the NF-κB label indicates the specific binding complex. This figure represents three similar experiments.
Effects of protein tyrosine kinase inhibitors on TNF-α-induced IκB-α protein degradation. MCA-101 cells were pretreated with media and either 200 μM genistein, 300 μM tyrphostin 47, 1.7 μM herbimycin A or 50 μM erbstatin for 1 hr, and subsequently incubated with or without 1 nM TNF-α for 15 min. After incubation, cell lysates were separated on a 10% SDS gel, and the IκB-α protein was detected with the anti-IκB-α antibody. This figure represents three similar experiments.
