Induction of Prostaglandin H Synthase-2 and Tumor Necrosis Factor-α in Human Amnionic WISH Cells by Various Stimuli Occurs Through Distinct Intracellular Mechanisms

  1. Keren I. Hulkower1,
  2. Ellen R. Otis1,
  3. Junling Li1,
  4. Bruce W. Ennis2,
  5. David J. Cugier2,
  6. Randy L. Bell1,
  7. George W. Carter1 and
  8. Keith B. Glaser1
  1. 1Immunosciences Research Area (K.I.H., E.R.O., J.L., R.L.B., G.W.C., K.B.G.) and the 2Aging and Degenerative Diseases Research Area (B.W.E., D.J.C.), Abbott Laboratories, Abbott Park, Illinois
     
    Next Section

    Abstract

    These studies examined the signal transduction mechanisms by which prostaglandin (PG) E2 production can occur in human amnionic WISH cells in response to the stimuli okadaic acid, interleukin (IL)-1β, tumor necrosis factor (TNF)-α, phorbol-12-myristate-13-acetate (PMA) or combinations of PMA with IL-1β or TNF-α. We also investigated whether WISH cells are capable of producing TNF-α or IL-1β in response to stimulation, because these cytokines can be produced in an autocrine fashion to perpetuate an inflammatory response. Our data indicate that the magnitude of PGE2 production induced by a given stimulus correlated temporally with the level of PGH synthase-2 (PGHS-2) protein. PMA or IL-1β induced PGE2 production 2 to 4 hr after treatment, whereas the combination of these agents produced the most rapid induction 2 hr after treatment. Only okadaic acid induced the production of both PGE2 and TNF-α, after a lag of 12 to 18 hr. PGE2 production by all stimuli was inhibited by dexamethasone, the IL-1 receptor antagonist (IL-1ra), the specific PGHS-2 inhibitor NS-398 and the protein kinase inhibitor staurosporin. In contrast, TNF-α production in response to okadaic acid was inhibited by the TNF-converting enzyme inhibitor GI 129471 and staurosporin but was unaffected by either IL-1ra, dexamethasone or NS-398. We conclude that WISH cells are capable of producing bioactive proinflammatory mediators such as TNF-α and PGE2 through separable intracellular signal transduction mechanisms. The ability of IL-1ra to reduce PGE2 production caused by all stimuli used suggests an autocrine role for IL-1 in PGHS-2 induction in these cells.

    Human amnionic WISH cells (Hayflick, 1961) have proven to be a robust in vitro model for the study of arachidonic acid release and PG formation. WISH cells have been shown to produce a variety of prostanoids in response to a wide range of stimuli (Harris et al., 1988). Production of PGE2, in a concentration-dependent manner, was demonstrated in WISH cells with the cytokines TNF-α and IL-1, the growth factors epidermal growth factor and transforming growth factor-α and the phorbol esters phorbol dibutyrate and PMA (Harris et al., 1988). Subsequent investigations revealed that IL-1β-induced PGE2 formation in WISH cells is mediated through the expression of the inducible PGHS-2 (Albert et al., 1994) and a cytosolic PLA2 (Xue et al., 1995; Xue et al., 1996). Recently, it was also observed that PGE2synthesis induced by IL-1β in WISH cells can be modulated by interferon and IL-4 at the PGHS-2 mRNA level (Harding et al., 1996). Because sites of inflammation contain an abundance of cytokines and growth factors (Dinarello, 1992), this implicates complex regulation of both autocrine cytokines and proinflammatory genes, such as PGHS-2, in such settings.

    Several different signal transduction pathways have been reported to be involved in the induction and modulation of PGHS-2. Signals that ultimately trigger the accumulation of PGHS-2 mRNA have been shown to be initiated through tyrosine kinase, protein kinase A, protein kinase C, mitogen-activated protein kinase or Janus activated kinase-signal transduction activator of transcription (JAK-STAT) pathways, depending on the type of cell and stimulus studied (Blanco et al., 1995; Hamasaki and Eling, 1995; Rzymkiewicz et al., 1995;Herschman, 1996). Additionally, okadaic acid, a non-phorbol ester tumor promoter that acts through the inhibition of protein phosphatases 1 and 2A, has been shown to stimulate PGE2 production in rat peritoneal macrophages (Ohuchi et al., 1989). Okadaic acid has also been shown to induce the synthesis of IL-1 (Sung and Walters, 1993) and TNF-α (Sung et al., 1992) in human monocytes.

    In the present study, we have studied the signal transduction mechanisms by which induction of PGHS-2 can occur within WISH cells. Additionally, we have examined the effect of okadaic acid on PGE2 production and cytokine synthesis in these cells and have investigated whether cross-regulation of PGE2 and cytokine production occurs in these cells. Our results indicate that, whereas several cytokines and tumor promoters induce PGHS-2 protein in WISH cells, they do so through distinct intracellular mechanisms. We have demonstrated for the first time that WISH cells are capable of producing the cytokines TNF-α and IL-1 and that the signal transduction mechanisms involved in the induction of these cytokines are distinct from those involved in the induction of PGHS-2.

    Previous SectionNext Section

    Materials and Methods

    Reagents.

    The following supplies were obtained from the indicated sources: WISH cells, American Type Culture Collection (Rockville, MD); cell culture products and media, GIBCO (Grand Island, NY); recombinant human IL-1β and TNF-α, UBI (Lake Placid, NY); IL-1ra and goat anti-human TNF-α antibodies, R & D Systems (Minneapolis, MN); okadaic acid sodium salt, RBI (Natick, MA); okadaic acid 7,10,24,28-tetraacetate, LC Laboratories (Woburn, MA); staurosporin, BioMol (Plymouth Meeting, PA);o-phenylenediamine dihydrochloride, dexamethasone, indomethacin and PMA, Sigma Chemical Co. (St. Louis, MO); casein, BDH Laboratory Supplies (Poole, England); purified PGHS-1, PGHS-2 and rabbit polyclonal anti-human PGHS-2, Cayman Chemicals (Ann Arbor, MI); 10% polyacrylamide precast gels, nitrocellulose membrane, molecular weight standards and electrophoresis/transfer buffers and equipment, Novex (San Diego, CA); PGE2 EIA reagents, PerSeptive Diagnostics (Cambridge, MA); streptavidin-horseradish peroxidase, enhanced chemiluminescence reagents and Hyperfilm, Amersham (Arlington Heights, IL); Immobilon 4 microtiter ELISA plates, Dynatech (Chantilly, VA); biotinylated goat anti-rabbit F(ab′)2 fragments, Biosource International (Camarillo, CA). The TNF-converting enzyme inhibitor GI 129471 and the PGHS-2 inhibitor NS-398 were synthesized at Abbott Laboratories (Abbott Park, IL). Rabbit polyclonal anti-PGHS-1 was a gift from Dr. David DeWitt, Michigan State University. Biotinylated anti-TNF-α was purchased from The Binding Site (Burmingham, UK). The 1B15 cDNA probe was kindly provided by Dr. Lynn Matrisian, Vanderbilt University. All other chemicals were obtained through standard suppliers.

    Cell activation.

    Human amnionic WISH cells (Hayflick, 1961) were maintained in Dulbecco’s minimal essential medium supplemented with 10% fetal bovine serum and 1% antibiotics (final concentrations, 50 U/ml penicillin G sodium and 50 μg/ml streptomycin sulfate). Cells were passaged via trypsinization and seeded, at a density of 1 × 105 cells/cm2 of growth area, into 48-well culture dishes for activation studies, into six-well culture dishes for immunoblot analysis or into 162-cm2 flasks for mRNA preparation. After 48 hr (≥90% confluence), the growth medium was decanted and the monolayers were washed twice with Gey’s balanced salt solution. The cells were then treated with stimulants for specified times in Neuman-Tytell serumless medium containing 1% penicillin/streptomycin solution. For certain studies, dexamethasone, staurosporin, GI 129471 and NS-398 were added to the cultures at the time of treatment (final dimethylsulfoxide concentration, ≤0.1%). As indicated, IL-1ra was preincubated with the cultures for 1 hr before treatment with stimuli. After the appropriate incubation time at 37°C in a humidified CO2 incubator, the conditioned medium was removed from the cultures and assayed for PGE2 and/or TNF-α content. Certain cultures were solubilized directly into Laemmli sample buffer and stored at −20°C for subsequent electrophoresis (Laemmli, 1970) and immunoblotting. The protein content of cell lysates was determined using the method of Bensadoun and Weinstein (1976), with bovine serum albumin as a standard. Each experiment was repeated at least three times with each data point in triplicate. Figures are representative data from individual experiments. Data analysis was performed using Student’s ttest.

    PGE2 assay.

    The PGE2 content of the conditioned media was assayed using the PerSeptive Diagnostics EIA kit, according to the manufacturer’s protocol. The anti-PGE2 antibody has <3.5% cross-reactivity with PGA1, PGA2, PGB1, PGB2, PGF1α and PGF2α. Sensitivity of this ELISA is 15 pg/ml, with a detection range of 0.1 to 50 ng/ml.

    TNF-α assay.

    The human TNF-α content of the conditioned media was assayed using a sandwich ELISA developed at Abbott Laboratories. Immobilon 4 microtiter plates were coated with goat anti-human TNF-α antibodies. TNF-α standards or samples were added to each well and incubated for 2 hr at ambient temperature. The plates were washed, and biotinylated anti-human TNF-α was added. After a 1-hr incubation, the plates were washed (four times) and streptavidin-labeled horseradish peroxidase was added to the wells. After 1 hr at ambient temperature, the plates were washed (four times) and o-phenylenediamine dihydrochloride substrate was added for 15 min. The reaction was stopped with 1 N H2SO4 and read on a Molecular Devices Thermomax microtiter plate reader at 480 nm. The anti-human TNF-α antibody has no cross-reactivity with other cytokines and <5% cross-reactivity with murine TNF-α. Sensitivity of this ELISA is 31 pg/ml, with a detection range of 31 to 2000 pg/ml.

    SDS-polyacrylamide gel electrophoresis and immunoblot analysis.

    Samples (50 μg protein) of whole-cell homogenates in Laemmli buffer were subjected to electrophoresis on 1.5-mm-thick 10% polyacrylamide gels. The separated proteins were transferred to nitrocellulose filters using half-strength Towbin buffer (Towbinet al., 1979) with 20% (v/v) methanol. The filters were blocked for 1 hr at room temperature with 2.5% casein in 50 mM Tris-HCl (pH 7.6), 154 mM NaCl, 0.2 mM thimerosal, and then incubated with anti-PGHS antibody (1:1000 dilution) in blot buffer (50 mM Tris-HCl, 200 mM NaCl, 0.05% Tween-20, 1% casein, pH 7.5) overnight at 4°C. After three 5-min washes in TBS/Tween (50 mM Tris-HCl, 200 mM NaCl, pH 7.5, containing 0.05% Tween-20), the filters were incubated with biotinylated goat anti-rabbit F(ab′)2 fragments (1:2000 dilution) in blot buffer for 30 min at room temperature and then washed (3 × 5 min) in TBS/Tween. The filters were then incubated with streptavidin-horseradish peroxidase (1:5000 dilution) in blot buffer for 30 min at room temperature and washed (3 × 5 min) in TBS/Tween, and the immunoreactive bands were visualized with the enhanced chemiluminescence reagents on Hyperfilm (Amersham), according to the manufacturer’s protocol.

    Preparation of mRNA and Northern analysis.

    After treatment, the cells were washed once with Gey’s balanced salt solution and harvested using trypsin-EDTA. The cells were resuspended in Gey’s balanced salt solution, counted, pelleted and stored at −70°C until RNA isolation. Poly(A)+ RNA was isolated using a Mini RiboSep Ultra mRNA isolation kit, according to the manufacturer’s instructions (Collaborative Biomedical Products, Bedford, MA), and stored as an ethanol precipitate at −70°C until gel electrophoresis.

    WISH cell mRNA was recovered by centrifugation at 4°C for 30 min at 15,000 × g. The mRNA pellet was washed once with cold 70% ethanol, recentrifuged, dried in a SpeedVac concentrator (Savant Instruments, Farmingdale, NY) and resuspended in 200 μl of deionized water. RNA content was determined spectrophotometrically (260/280 nm), and the samples were resuspended in 20 μl of RNA sample buffer [5% formamide, 10× gel buffer {1× is 20 mM 3-(N-morpholino)propanesulfonic acid, 3 mM sodium acetate, 1 mM EDTA}, 1% tracking dye, 7% formaldehyde]. Five micrograms of poly(A)+ mRNA were loaded into each well of a 1% agarose gel and electrophoresed at 150 V for approximately 3 hr in 1× gel buffer. The gel was washed in distilled water (2 × 10 min) and then once in 20× SSC transfer buffer (3 M NaCl, 0.3 M sodium citrate, pH 7.0). The RNA was transferred to a 0.45-μm Nytran Plus membrane (Schleicher & Schuell, Keene, NH), using a vacuum blotter (Bio-Rad, Richmond, CA), in 20× SSC for 90 min. The RNA was cross-linked to the membrane using a GS Gene Linker UV chamber (Bio-Rad) set at 120 mJ.

    PGHS-2 and 1B15 cDNAs were used as probes for Northern analysis. Full-length (1.8 kilobases) PGHS-2 cDNA was obtained by using reverse transcription-polymerase chain reaction to amplify PGHS-2 message from human placenta. Primers (5′ primer, GTAACCTGGAATTCTATAAATATGCTCGCCC-GCGCCCTGCT; 3′ primer, AGGTCTGTAGATCTGACTTCTACAGTTCAGTCGAACGTTCTTTTAGTAGTACTG) were based on the published PGHS-2 sequence (Hla and Neilson 1992). Cyclophilin (1B15) cDNA was a sucrose gradient-purified insert from sp61B15 (Danielson et al., 1988). The probes were labeled using a random-primed DNA labeling kit (Boehringer Mannheim, Indianapolis, IN), according to the manufacturer’s instructions.

    Blots were prehybridized by washing in 50% formamide, 5× Denhardt’s reagent, 1% SDS, denatured DNA, 5× saline sodium phosphate EDTA solution, for at least 4 hr at 42°C. The labeled probe was added directly to this solution, and hybridization was carried out overnight at 42°C. The next day the blot was washed twice in 2× SSC/0.1% SDS for 5 min at 25°C, twice in 0.5× SSC/0.1% SDS for 20 min at 42°C and finally in 0.2× SSC/0.2% SDS for 1 hr at 55°C.

    The RNA blot was covered with Mylar film and placed into an exposure cassette (Molecular Dynamics, Sunnyvale, CA), which provides for the exposure of the blot to a storage phosphor screen. After exposure the phosphor screen was scanned using a digital phosphor imager (PhosphorImager; Molecular Dynamics). A digital image of the radioactivity contained within the blot was then obtained. Analysis of the data from the scanned image was performed using ImageQuant software (Molecular Dynamics). Digital images were quantitated by determining the average pixel values along the length of the rectangles drawn to encompass each lane of the blot. Pixel values in the bands were recognized as peaks along the length of the rectangle (i.e., the gel lane). The areas under these band peaks were integrated to obtain a value indicating the relative intensity of each band in the blot. The data were normalized to loading controls (i.e., 1B15) and expressed as fold increases in band intensity, relative to untreated control values.

    Previous SectionNext Section

    Results

    Stimulus-induced PGE2 production by WISH cells.

    WISH cells responded to multiple stimuli, such as PMA, IL-1β, TNF-α and okadaic acid, alone or in combination, to produce PGE2 (fig. 1A). All of these stimuli culminated in the induction of PGHS-2 (fig. 1B). In agreement with previous data (Harris et al., 1988), PGE2production in response to the cytokines IL-1β and TNF-α was found to be dose-dependent (fig. 2). Interestingly, the kinetics of PGE2 production in WISH cells differed widely depending upon the stimulus used (fig. 1A). The combination of PMA and IL-1β yielded the most rapid induction of PGE2, with measurable product at 1 hr. This was in contrast to PMA alone, which produced less PGE2 than PMA and IL-1β and had a substantial lag phase (4–6 hr). Although the amount of PGE2 induced by IL-1β alone was substantially less than that with PMA and IL-1β, IL-1β alone stimulated the production of PGE2 rapidly (within 2–4 hr). In contrast, okadaic acid appeared to require a significant amount of time (12–18 hr) before PGE2 production became maximal. However, in all cases, the level of PGE2 produced in response to a given agent or combination of agents in WISH cells was temporally correlated with PGHS-2 induction by the agent (fig. 1B). For example, PGHS-2 protein was induced as early as 1 to 2 hr in cells treated with the combination of PMA and IL-1β, whereas such induction in response to okadaic acid did not occur until 12 hr after treatment. The levels of PGE2 and PGHS-2 protein produced in response to either TNF-α or IL-1β were significantly less than that reached by treatment with the combination of PMA and IL-1β (fig. 1). In contrast, levels of PGHS-1 protein remained unchanged in response to all stimuli (data not shown).

    Figure 1
    View larger version:
    Figure 1

    Effect of stimulus and treatment time on PGE2 production and PGHS-2 induction by WISH cells. A, WISH cells were treated, as noted, with 30 nM okadaic acid, 10 ng/ml PMA, 10 ng/ml IL-1β, 10 ng/ml TNF-α or combinations of PMA with IL-1β or TNF-α for 1 to 24 hr, and the amount of PGE2 released into the conditioned medium was measured as described in “Materials and Methods.” Values are the mean ± S.E.M. of three determinations. For IL-1β, stimulation was considered significantly above background from 4 to 24 hr (P ≤ .05). PMA was considered significantly different from 6 to 24 hr (P ≤ .05). The combination of IL-1β and PMA was considered significant from 4 to 24 hr (P ≤ .01). TNF-α was considered significant from 18 to 24 hr (P ≤ .06). Okadaic acid was considered significant from 12 to 24 hr (P ≤ .05). B, immunoblot analysis was performed using a 1:1000 dilution of anti-human PGHS-2 IgG with the whole-cell homogenates (50 μg protein) from cultures treated from 1 to 24 hr as described in A. Lanes S1 and S2, purified PGHS-1 and PGHS-2 proteins run as standards. For the control group, lanes A, B and C contain the 8-, 18- and 24-hr IL-1β samples, respectively, as positive controls for the induction of PGHS-2; for all other groups, lanes A, B and C contain the 8-, 18- and 24-hr control samples, respectively, as negative controls for PGHS-2 induction. Exposure to film after enhanced chemiluminescence detection was for 20 sec for each of the blots. Levels of PGHS-1 protein were unchanged over time in all treatment groups (data not shown).

    Figure 2
    View larger version:
    Figure 2

    Effect of stimulus dose on PGE2production by WISH cells. WISH cells were treated for 18 hr, and the amount of PGE2 released into the conditioned medium was measured by EIA. Values are the mean ± S.E.M. of three determinations. A, IL-1β. B, TNF-α. *, significance above background of P ≤ .05; **, significance of P ≤ .01.

    Northern analysis revealed that, for certain stimuli, PGHS-2 mRNA was still detectable 18 hr after treatment (fig. 3). The most significant abundance of mRNA at 18 hr was present in the okadaic acid-treated cultures, as well as with the combination of PMA with either IL-1β or TNF-α. No significant mRNA expression was observed for TNF-α, IL-1β or PMA alone at 18 hr (fig. 3). The PGHS-2 mRNA levels observed for okadaic acid and the combination of PMA and IL-1β after 18 hr of treatment (fig. 3) demonstrate an interesting phenomenon, which appears to correlate with the levels of PGHS-2 and PGE2 seen with these activators (fig. 1).

    Figure 3
    View larger version:
    Figure 3

    PGHS-2 mRNA induction in response to treatment with various stimuli. A, cells were treated with 30 nM okadaic acid (OKA), 10 ng/ml PMA, 10 ng/ml IL-1β, 10 ng/ml TNF-α or combinations of PMA with IL-1β or TNF-α for 18 hr, and poly(A)+ mRNA was extracted from each culture and subjected to Northern analysis as described in “Materials and Methods.” B, the graph depicts densitometric analysis of the treatment groups and normalization to 1B15 mRNA content.

    Effect of IL-1ra on stimulus-induced PGE2production.

    One possible explanation for the lag periods observed in PGE2 biosynthesis with certain stimuli, such as okadaic acid, could be that the induction of PGE2 is secondary to the production of another cytokine, such as IL-1β. Once induced, the IL-1β or other cytokine would then induce PGHS-2. To examine this possibility, we examined the effect of IL-1ra on PGE2 production induced by a range of stimuli (fig.4). As expected, pretreatment of the cells with a 1000-fold molar excess of IL-1ra (3 μg/ml) inhibited the IL-1β (3 ng/ml)-induced production of PGE2 by 90%. Interestingly, IL-1ra pretreatment also inhibited PGE2 production in response to 30 nM okadaic acid, PMA and TNF-α (50–60%). IL-1ra pretreatment blocked PGE2 production in response to the combination of PMA and IL-1β by 80%, but that induced by the combination of PMA and TNF-α was reduced by only 20% (fig. 4). It therefore seems likely that at least some of the PGE2produced in response to okadaic acid, PMA and TNF-α may be attributed to the induction of IL-1 by these agents, because IL-1ra has no known function other than to block signal transduction through the IL-1 receptor. We were unable to detect IL-1β in the conditioned medium from WISH cells treated for 18 hr either with PMA and TNF-α or with okadaic acid (data not shown). It is possible that production of this cytokine is below the limits of detection (i.e., <10 pg/ml) of commercially available EIA kits.

    Figure 4
    View larger version:
    Figure 4

    Effect of the IL-1ra on PGE2 production by various stimuli in WISH cells. Cultures were preincubated for 1 hr with 3 μg/ml IL-1ra or with medium only before treatment for 18 hr with 30 nM okadaic acid (OKA), 10 ng/ml PMA, 3 ng/ml IL-1β, 10 ng/ml TNF-α or combinations of PMA and IL-1β (3 ng/ml) or TNF-α. The amount of PGE2 released into the conditioned medium was measured by EIA. Values are the mean ± S.E.M. of three determinations. All stimuli were significantly greater than control (P ≤ .05). *, significance of P ≤ .05 for specific stimulivs. IL-1ra treatment; **, significance of P ≤ .01.

    TNF-α production by WISH cells.

    Because our results suggested that WISH cells are capable of producing IL-1, we next examined whether these cells had the capacity to produce TNF-α. IL-1β and PMA by themselves failed to produce detectable levels of TNF-α after 18 hr of treatment (data not shown). However, when the cells were treated with the combination of PMA and IL-1β or with okadaic acid, TNF-α could be measured in the conditioned medium. Although the production of TNF-α was rapid with the combination of PMA and IL-1β (i.e., within 2 hr after treatment), levels of maximal production were modest (200 pg/106 cells; data not shown). In contrast, TNF-α production in response to okadaic acid was delayed, with no appreciable production measured until 18 hr after treatment. However, the magnitude of TNF-α produced in response to okadaic acid was much greater (15-fold) than that observed with the combination of PMA and IL-1β, reaching 3 ng/106 cells (fig. 5A). It therefore appears that the kinetics of TNF-α production in response to either okadaic acid or the combination of PMA and IL-1β parallel those of the induction of PGHS-2 by these same agents.

    Figure 5
    View larger version:
    Figure 5

    Effect of okadaic acid on WISH cells. A, effect of treatment time with 30 nM okadaic acid on TNF-α production. ▪, okadaic acid-treated cultures; •, cultures treated with vehicle only. *, significance of P ≤ .05 vs. control. B, dose-response relationship for okadaic acid effects on PGE2and TNF-α production after 18-hr treatments. The amount of PGE2 and TNF-α released into the conditioned medium was measured by EIA. Values are the mean ± S.E.M. of three determinations. *, significance of P ≤ .05; **, significance of P ≤ .01 from control.

    The induction of TNF-α and PGE2 biosynthesis by okadaic acid occurred over a very narrow concentration range, which was limited by cytotoxicity. Both PGE2 and TNF-α production were undetectable in response to 10 nM okadaic acid, whereas maximal production of TNF-α and substantial PGE2 production were observed at 30 nM levels of the compound (fig. 5B). Whereas PGE2 levels continued to increase, TNF-α levels actually decreased at 100 nM okadaic acid. It should be noted that this concentration caused morphological changes in the WISH cells, such as blebbing and detachment. Because this effect was not observed at 30 nM, this concentration was chosen for further study. The biologically inactive salt of this molecule, okadaic acid 7,10,24,28-tetraacetate, was without effect on PGE2 or TNF-α production at concentrations up to 100 nM (data not shown). In contrast to its effect on PGE2 production, IL-1ra was without significant effect on TNF-α production elicited by okadaic acid. Stimulated cells produced 877.8 ± 56.0 pg TNF-α/ml, compared with IL-1ra-pretreated cells, which produced 739.5 ± 118.9 pg TNF-α/ml.

    Effect of signal transduction inhibitors on PGE2 and TNF-α production.

    To examine whether the inductions of PGHS-2 and TNF-α in WISH cells are regulated through a common set of intracellular signaling pathways, we investigated the effects of dexamethasone and staurosporin on the cellular responses to various stimuli. Dexamethasone (100 nM) completely inhibited the induction of PGE2 in response to PMA, IL-1β and TNF-α, whereas it was less effective in inhibiting PGE2 production in response to okadaic acid or the combination of PMA with either IL-1β or TNF-α (fig.6A). Dexamethasone was also examined for its effect on levels of PGHS-2 protein induced by the various stimuli. Dexamethasone by itself did not cause the induction of PGHS-2 protein, whereas it completely blocked the induction of PGHS-2 in response to PMA, IL-1β and TNF-α. In addition, levels of PGHS-2 protein induced by okadaic acid as well as by the combinations of PMA with either IL-1β or TNF-α were markedly reduced (70–80%) by dexamethasone (fig. 6B). Thus, the effects of dexamethasone on the induction of PGHS-2 protein correlated directly with its effects on PGE2 production (fig. 6B).

    Figure 6
    View larger version:
    Figure 6

    Effects of dexamethasone and staurosporin on the induction of PGE2, PGHS-2 and TNF-α in WISH cells. Cells were treated for 18 hr with okadaic acid, PMA, IL-1β or TNF-α, as described for figure 1, in the presence and absence of either 100 nM dexamethasone or 100 nM staurosporin. A, PGE2was measured by EIA in conditioned medium from treated cultures. Values are the mean ± S.E.M. of three determinations. All stimuli were significantly greater than control (P ≤ .01). *, significance of P ≤ .05 for specific stimuli vs. dexamethasone or staurosporin treatment; **, significance of P ≤ .01. B, immunoblot analysis was performed using a 1:1000 dilution of anti-human PGHS-2 IgG with the whole-cell homogenates (50 μg protein) from cultures treated as described for A. Lanes S1 and S2, purified PGHS-1 and PGHS-2 proteins run as standards. Lanes A, treatments in the absence of either dexamethasone or staurosporin. Lanes B, treatments in the presence of 100 nM dexamethasone. Lanes C, treatments in the presence of 100 nM staurosporin. In all three blots, lane group 1 contains the control treatments. Blot I contains PMA (lane group 2), IL-1β (lane group 3) and PMA and IL-1β (lane group 4). Blot II contains PMA (lane group 2), TNF-α (lane group 3) and PMA and TNF-α (lane group 4). Blot III contains okadaic acid (lane group 2), IL-1β (lane group 3) and PMA (lane group 4). Exposure to film after enhanced chemiluminescence detection was for 20 sec for each blot. C, TNF-α was measured by EIA in conditioned medium from treated cultures. Values are the mean ± S.E.M. of three determinations. Okadaic acid treatment vs. control was considered significant at P ≤ .01. **, significance of P ≤ .01 vs.okadaic acid treatment only.

    The effect of staurosporin, a serine/threonine kinase inhibitor, was similarly investigated and found to be more complex. Staurosporin (100 nM) itself induced the production of PGE2 by WISH cells, whereas it inhibited the induction of PGE2 in response to PMA by 66%. PGE2 production in response to either IL-1β or TNF-α was virtually unaffected by staurosporin treatment, whereas the combinations of PMA with either IL-1β or TNF-α were inhibited by treatment with staurosporin (60% and 75%, respectively). Production of PGE2 in response to okadaic acid was also somewhat (45%) inhibited by staurosporin (fig. 6A). Interestingly, staurosporin alone did not induce PGHS-2 protein, although it did increase the level of PGE2 production by the cells. PGHS-2 protein induced in response to PMA and the combination of PMA with either IL-1β or TNF-α was drastically reduced by treatment with staurosporin. In contrast, staurosporin had little or no effect on levels of PGHS-2 protein induced by okadaic acid, IL-1β only or TNF-α only (fig. 6B). It therefore appears that, in contrast to dexamethasone, the regulation of PGE2 production by staurosporin (i.e., serine/threonine kinases) in WISH cells did not entirely correlate with its effects on PGHS-2 protein levels.

    We next examined the effects of dexamethasone and staurosporin on TNF-α production by okadaic acid. In contrast to its effect on PGE2 production, dexamethasone had no effect on TNF-α production (fig. 6C). Staurosporin, however, was able to inhibit TNF-α production induced by okadaic acid by 60% (fig. 6C).

    Effect of nonsteroidal anti-inflammatory drugs on okadaic acid-induced PGE2 and TNF-α production.

    To examine whether cross-regulation exists between the production of TNF-α and PGE2 in WISH cells, we tested a PGHS-2-selective nonsteroidal anti-inflammatory drug, NS-398 (Futakiet al., 1994), for its ability to inhibit okadaic acid-induced PGE2 and TNF-α production. NS-398 potently inhibited the production of PGE2 induced by okadaic acid, with an IC50 of 47 nM (95% confidence limits, 36–60 nM), whereas it failed to inhibit TNF-α production by >20% at a concentration of 1 μM (fig. 7A). Conversely, the TNF-α-converting enzyme inhibitor GI 129471 (McGeehan et al., 1994) inhibited the production of TNF-α with an IC50 of 0.94 μM (95% confidence limits, 0.8–1.1 μM), whereas it failed to inhibit PGE2 production by >20% at a 3 μM concentration (fig. 7B).

    Figure 7
    View larger version:
    Figure 7

    Effects of anti-inflammatory compounds on okadaic acid-induced PGE2 and TNF-α production in WISH cells. Cells were coincubated for 18 hr with 30 nM okadaic acid and various concentrations of compounds as indicated. PGE2 and TNF-α were measured in the conditioned medium by EIA, and percent inhibition was calculated for the compounds. Control values for PGE2and TNF-α were 1540 ng/106 cells and 4350 pg/106 cells, respectively. Values are the mean ± S.E.M. of three experiments, each in triplicate (n= 9). A, NS-398 (PGHS-2 inhibitor); B, GI 129471 (TNF-converting enzyme inhibitor).

    Previous SectionNext Section

    Discussion

    The human amnionic epithelial cells (WISH cells) have the potential to produce copious amounts of prostanoids (100–700 ng/106 cells) in response to a wide variety of stimuli, including growth factors, phorbol esters and inflammatory cytokines such as IL-1 and TNF-α. Table 1 summarizes our findings from observations made using alternative stimuli to induce proinflammatory mediators in WISH cells. Our studies have now clearly demonstrated that both the time of induction and the magnitude of PGE2 produced by WISH cells can be regulated differentially, depending upon the stimulus used. The data also distinctly illustrate that the magnitude of PGE2 induction by a given stimulus is tightly linked to levels of both PGHS-2 mRNA and protein in these cells. The combination of PMA and IL-1β produces a more than additive effect on PGHS-2 protein and subsequent PGE2 production, compared with effects observed with these stimuli alone. Previous investigators have shown that IL-1 can serve to stabilize the mRNA induced by PMA (Ristimaki et al., 1994;Srivastava et al., 1994). Our finding that PGHS-2 mRNA was still abundant after 18 hr of treatment with the combination of PMA and IL-1β, but not with these activators individually, is in agreement with those observations.

    View this table:
    Table 1

    Summary of inhibitor effects on PGE2 and TNF-α production in WISH cells

    We have demonstrated herein that okadaic acid induces both PGE2 and TNF-α production in WISH cells. Cultures of WISH cells treated with okadaic acid showed a longer lag phase (12–18 hr) to induce PGE2 production than did those treated with PMA (2–4 hr), which correlated with the time required to induce PGHS-2 protein (fig. 1). Our observations are consistent with those of Ohuchiet al. (1989), who observed an 8- to 12-hr lag in PGE2 synthesis in okadaic acid-treated rat peritoneal macrophages, whereas those treated with PMA produced PGE2within 2 to 4 hr. TNF-α production also required a 12- to 18-hr exposure to okadaic acid (fig. 5A). Our studies suggest that the effects of okadaic acid on WISH cells can be specifically linked to its activity as an inhibitor of protein phosphatases 1 and 2A, for several reasons. Firstly, okadaic 7,10,24,28-tetraacetate, a structural analog of okadaic acid reported not to inhibit protein phosphatases, did not induce either TNF-α or PGE2 production in WISH cells at concentrations as high as 100 nM (maximum noncytotoxic dose for both okadaic acid and okadaic acid 7, 10, 24, 28-tetraacetate). Secondly, FK506, a known immunosuppressant that inhibits protein phosphatase 2B (calcineurin) (Fruman et al., 1992; Kincaid, 1995), was without effect on PGE2 and TNF-α production at concentrations up to 1 μM (K. I. Hulkower, E. R. Otis, R. L. Bell and K. B. Glaser, unpublished observations). Calyculin A, another reported inhibitor of protein phosphatases 1 and 2A that is structurally unrelated to okadaic acid (Ishihara et al., 1989), was able to induce PGE2 but not TNF-α production in WISH cells. However, that TNF-α production is not induced by calyculin A may be explained by the cytotoxic effects of this compound observed at lower concentrations than with okadaic acid (K. I. Hulkower, E. R. Otis, R. L. Bell and K. B. Glaser, unpublished observations).

    To understand the mechanism(s) involved in the long lag time after treatment of the cells with okadaic acid before the onset of PGE2 production, we investigated whether the induction of PGE2 could be secondary to the production of another cytokine by okadaic acid. IL-1ra (3 μg/ml) inhibited the production of PGE2 in response to 30 nM okadaic acid by 50%. Similarly, we found that PGE2 induced by either PMA or TNF-α alone was also partially (60%) inhibited by IL-1ra. Although we were unable to detect IL-1β by conventional EIA in the conditioned medium of WISH cells after 18 hr of treatment with okadaic acid, it is possible that this cytokine is produced at a level below the detection limit of these types of assays or remains associated with the cell membrane. However, because the only currently known activity of IL-1ra is the antagonism of signal transduction through the type I IL-1 receptor (Dripps et al., 1991; Granowitz et al., 1992a,b), it is likely that at least some of the PGE2produced in response to okadaic acid, PMA or TNF-α may be attributed to the production of IL-1 by these agents. Even minute amounts of IL-1 have been shown to act synergistically with other activators to cause heightened cellular responses, such as increased PGE2production (Dinarello, 1996). It is therefore possible that the small amount of IL-1 produced in response to okadaic acid could vastly augment PGE2 production, which is also induced by this agent. The autocrine effects of inflammatory cytokines have been well described, e.g., TNF has been shown previously to induce the production of IL-1 in human fibroblasts (Le et al., 1987). More specifically, in recent studies with human monocytes, it has been reported that lipopolysaccharide induction of PGHS-2 is inhibited by pretreatment with IL-1ra, thereby implicating the induction of IL-1 by lipopolysaccharide in these cells as being responsible for driving PGHS-2 induction and PGE2 production (Glaser and Lock, 1995). It is also plausible that an abundance of IL-1 receptors may be present on WISH cells and need to be saturated with IL-1ra before inhibition of PGE2 production is observed.

    Although we can observe the production of both PGE2 and TNF-α in WISH cells in response to okadaic acid, with similar time courses, our studies suggest that distinct intracellular processes may govern the production of each of these mediators. Not all agents that stimulate the production of PGE2 in WISH cells are able to induce TNF-α. Although we have shown that PGE2 production in response to okadaic acid is partially mediated by the production of IL-1 in these cells (inhibitable by IL-1ra), it should be noted that this is not the case for TNF-α production, because it is completely unaffected by IL-1ra. NS-398, a PGHS-2-specific inhibitor, was able to completely block PGE2 production induced by okadaic acid but had no effect on concomitant TNF-α production, implying that PGE2 is not required for TNF production. Likewise, the TNF-converting enzyme inhibitor GI 129471 (McGeehan et al., 1994) was able to block the release of TNF into the medium of okadaic acid-treated cells, whereas it was without effect on PGE2production. Also indicative of separate routes of signal transduction for the production of PGE2 and TNF-α is our finding that dexamethasone, which inhibits PGE2 production by okadaic acid, has no effect on TNF-α secretion in the same cultures. This indicates that induction of PGHS-2 by okadaic acid in WISH cells occurs under transcriptional control of glucocorticoid-sensitive response elements, whereas TNF-α production does not. However, because both PGE2 and TNF-α production are inhibited to some extent by staurosporin, it is likely that serine/threonine kinases are involved in both processes.

    The lack of effect of dexamethasone on TNF-α production in WISH cells may be explained by the mechanisms by which okadaic acid and dexamethasone regulate IκBα and NFκB (Menon et al., 1995; Verma et al., 1995). The inhibition of phosphatase activity causes IκB to remain phosphorylated and thus become vulnerable to degradation by a proteasome-dependent pathway, which thereby allows gene activation via translocation of the nuclear transcription factor NFκB (Palombella et al., 1994). Okadaic acid has been shown to inhibit the phosphatase activity that removes the phosphate from IκB, leading to its degradation and subsequent activation of NFκB-dependent TNF-α production in U937 cells (Menon et al., 1995). Recently, one possible mechanism of steroid action was proposed that suggested that inhibition of NFκB by steroids was due to increased de novo synthesis of IκB (Auphan et al., 1995; Scheinman et al., 1995). Because okadaic acid allows IκB to be phosphorylated without subsequent dephosphorylation, the newly synthesized IκB is also degraded and thus does not inhibit TNF-α production in WISH cells. Alternatively, okadaic acid could stimulate both NFκB and AP-1 (jun/fos) transcriptional machinery in WISH cells. Different genes, e.g., PGHS-2 and TNF-α, may use these different activators independently, and thus one may be inhibitable by dexamethasone and the other not. Further experiments on the regulation of IκB and jun/fos are in progress, to make this distinction between steroid mechanisms in WISH cells.

    It is noteworthy that such a diverse group of agents that signal through very different mechanisms are unified in their ability to induce PGHS-2 and cause the production of PGE2 in WISH cells. This is likely to occur at a convergent point distal to the initial activation of their separate pathways, at the level of phosphorylation events. PMA is noted for its ability to stimulate the protein kinase C pathway (Nishizuka, 1984) and increase serine/threonine phosphorylation, whereas the actions of okadaic acid are mediated by its inhibition of protein phosphatases 1 and 2A (Bialojan and Takai, 1988), indirectly elevating levels of serine/threonine and tyrosine phosphorylation. A novel IL-1-responsive serine/threonine kinase has recently been purified and cloned; it is claimed to be part of a key pathway for the signal transduction process of this cytokine, leading to the activation of NF-κB (Cao et al., 1996). TNF-α has been described to work through a ceramide-activated protein kinase pathway, leading to the activation of NF-κB (Schutze et al., 1992). It is noteworthy that staurosporin, an inhibitor of protein kinases, induces PGE2production by WISH cells independently of PGHS-2 induction. Staurosporin has previously been reported to induce PGE2production in rabbit articular chondrocytes (Hulkower et al., 1991) and human decidual cells (Cole et al., 1995). A possible explanation for this finding is that staurosporin may modulate levels of arachidonic acid by regulating the activity of a PLA2 in these cells, thereby operating at a step proximal to cyclooxygenase enzyme activity. It is therefore likely that the formation of PGE2 through staurosporin treatment in WISH cells may be primarily mediated through the release of arachidonic acidvia a PLA2 and only secondarily by a cyclooxygenase step. It is not unusual for PGE2 production in cells to be regulated at the level of both PLA2 and cyclooxygenase activities, because this phenomenon has been observed previously in rheumatoid synoviocytes (Hulkower et al., 1994), as well as in WISH cells (Xue et al., 1996).

    In WISH cells, a diverse group of stimuli acting through different signaling pathways induce the de novo synthesis of PGHS-2 (fig. 8). The ability of these cells to make TNF-α in response to various stimuli may also be part of their role in parturition (Terranova et al., 1995). Indeed, the normal physiological process of parturition shares many features with the inflammatory process, including production by the decidual cells of prostanoids and cytokines, including IL-1β and TNF-α (MacDonaldet al., 1991; Romero et al., 1991). As a result of the production of these bioactive mediators, WISH cells make an excellent model to study the regulatory process of proinflammatory mediator release.

    Figure 8
    View larger version:
    Figure 8

    Proposed scheme of PGE2 and cytokine production by proinflammatory stimuli in WISH cells. P-Pase, protein phosphatase; PKC, protein kinase C; AA, arachidonic acid; DEX, dexamethasone; OKA, okadaic acid; TCE, TNF-converting enzyme; NSAIDs, nonsteroidal anti-inflammatory drugs; Ser/Thr, serine/threonine.

    Previous SectionNext Section

    Acknowledgments

    We are grateful to Ruth Huang for expert cell culture support and to Lori Pease for assistance with the TNF-α assays.

    Previous SectionNext Section

    Footnotes

    • Send reprint requests to: Dr. Keren I. Hulkower, Abbott Laboratories, D47K/AP9, 100 Abbott Park Road, Abbott Park, IL 60064-3500.

    • Abbreviations:
      EIA
      enzyme immunoassay
      ELISA
      enzyme-linked immunosorbent assay
      IL
      interleukin
      IL-1ra
      interleukin-1 receptor antagonist
      PG
      prostaglandin
      PGHS
      prostaglandin H synthase
      PLA2
      phospholipase A2
      PMA
      phorbol-12-myristate-13-acetate
      SDS
      sodium dodecyl sulfate
      SSC
      standard saline citrate
      TBS
      Tris-buffered saline
      TNF
      tumor necrosis factor
      • Received June 7, 1996.
      • Accepted October 7, 1996.
    Previous Section
     

    References

    1. ↵
      1. Albert T. J.,
      2. Su H.-C.,
      3. Zimmerman P. D.,
      4. Iams J. D.,
      5. Kniss D. A.
      (1994) Interleukin-1β regulates the inducible cyclooxygenase in amnion-derived WISH cells. Prostaglandins 48:401–416.
      CrossRefMedlineWeb of Science
    2. ↵
      1. Auphan N.,
      2. DiDonato J. A.,
      3. Rosette C.,
      4. Helmberg A.,
      5. Karin M.
      (1995) Immunosuppression by glucocorticoids: Inhibition of NF-κB activity through induction of IκB synthesis. Science (Wash. DC) 270:286–290.
      Abstract/FREE Full Text
    3. ↵
      1. Bensadoun A.,
      2. Weinstein D.
      (1976) Assay of proteins in the presence of interfering materials. Anal. Biochem. 70:241–250.
      CrossRefMedlineWeb of Science
    4. ↵
      1. Bialojan C.,
      2. Takai A.
      (1988) Inhibitory effect of a marine-sponge toxin, okadaic acid, on protein phosphatases: Specificity and kinetics. Biochem. J. 256:283–290.
      MedlineWeb of Science
    5. ↵
      1. Blanco A.,
      2. Habib A.,
      3. Levy-Toledano S.,
      4. Maclouf J.
      (1995) Involvement of tyrosine kinases in the induction of cyclo-oxygenase-2 in human endothelial cells. Biochem. J. 312:419–423.
    6. ↵
      1. Cao Z.,
      2. Henzel W. J.,
      3. Gao X.
      (1996) IRAK: A kinase associated with the interleukin-1 receptor. Science (Wash. DC) 271:1128–1131.
      Abstract
    7. ↵
      1. Cole O. F.,
      2. Seki H.,
      3. Sullivan M. H. F.,
      4. Elder M. G.
      (1995) Interleukin-1β-stimulated prostaglandin synthesis by human decidual cells is independent of protein kinase C. Prostaglandins 49:66–77.
    8. ↵
      1. Danielson P. E.,
      2. Forss-Petter S.,
      3. Brow M. A.,
      4. Calavetta L.,
      5. Douglass R. J.,
      6. Milner R. J.,
      7. Sutcliffe J. G.
      (1988) p1B15: A cDNA clone of the rat mRNA encoding cyclophilin. DNA 7:261–267.
      MedlineWeb of Science
    9. ↵
      1. Gallin J. I.,
      2. Goldstein I. M.,
      3. Snyderman R.
      1. Dinarello C. A.
      (1992) Role of interleukin-1 and tumor necrosis factor in systemic responses to infection and inflammation. in Inflammation: Basic Principles and Clinical Correlates, eds Gallin J. I., Goldstein I. M., Snyderman R. (Raven Press, New York), 2nd ed. pp 211–232.
    10. ↵
      1. Dinarello C. A.
      (1996) Biologic basis for interleukin-1 in disease. Blood 87:2095–2147.
      Abstract/FREE Full Text
    11. ↵
      1. Dripps D. J.,
      2. Brandhuber B. J.,
      3. Thompson R. C.,
      4. Eisenberg S. P.
      (1991) Interleukin-1 (IL-1) receptor antagonist binds to the 80-kDa IL-1 receptor but does not initiate IL-1 signal transduction. J. Biol. Chem. 266:10331–10336.
      Abstract/FREE Full Text
    12. ↵
      1. Fruman D. A.,
      2. Klee C. B.,
      3. Bierer B. E.,
      4. Burakoff S. J.
      (1992) Calcineurin phosphatase activity in T lymphocytes is inhibited by FK 506 and cyclosporin A. Proc. Natl. Acad. Sci. U.S.A. 89:3686–3690.
      Abstract/FREE Full Text
    13. ↵
      1. Futaki N.,
      2. Takahashi S.,
      3. Yokoyama M.,
      4. Arai I.,
      5. Higuchi S.,
      6. Otomo S.
      (1994) NS-398, a new anti-inflammatory agent, selectively inhibits prostaglandin G/H synthase/cyclooxygenase (COX-2) activity in vitro. Prostaglandins 47:55–59.
      CrossRefMedlineWeb of Science
    14. ↵
      1. Glaser K. B.,
      2. Lock Y. W.
      (1995) Regulation of prostaglandin H synthase 2 expression in human monocytes by the marine natural products manoalide and scalaradial: Novel effects independent of inhibition of lipid mediator production. Biochem. Pharmacol. 50:913–922.
      CrossRefMedline
    15. ↵
      1. Granowitz E. V.,
      2. Clark B. D.,
      3. Vannier E.,
      4. Callahan M. V.,
      5. Dinarello C. A.
      (1992a) Effect of interleukin-1 (IL-1) blockade on cytokine synthesis: IL-1 receptor antagonist inhibits IL-1-induced cytokine synthesis and blocks the binding of IL-1 to its type II receptor on human monocytes. Blood 79:2356–2363.
      Abstract/FREE Full Text
    16. ↵
      1. Granowitz E. V.,
      2. Vannier E.,
      3. Poutsiaka D. D.,
      4. Dinarello C. A.
      (1992b) Effect of interleukin-1 (IL-1) blockade on cytokine synthesis. II. IL-1 receptor antagonist inhibits lipopolysaccharide-induced cytokine synthesis by human monocytes. Blood 79:2364–2369.
      Abstract/FREE Full Text
    17. ↵
      1. Hamasaki Y.,
      2. Eling T. E.
      (1995) EGF and TPA stimulate de novo synthesis of PGHS-1 and PGHS-2 through different signal transduction pathways. Prostaglandins Leukotrienes Essential Fatty Acids 53:225–229.
      CrossRefMedline
    18. ↵
      1. Harding L.,
      2. Wang Z.,
      3. Tai H.-H.
      (1996) Stimulation of prostaglandin E2 synthesis by interleukin-1β is amplified by interferons but inhibited by interleukin-4 in human amnion-derived WISH cells. Biochim. Biophys. Acta 1310:48–52.
      Medline
    19. ↵
      1. Harris A. N.,
      2. Perlman M.,
      3. Schiller S. L.,
      4. Romero R.,
      5. Mitchell M. D.
      (1988) Characterization of prostaglandin production in amnion-derived WISH cells. Am. J. Obstet. Gynecol. 159:1385–1389.
      MedlineWeb of Science
    20. ↵
      1. Hayflick L.
      (1961) The establishment of a line (WISH) of human amnion cells in continuous cultivation. Exp. Cell Res. 23:14–20.
      CrossRefMedlineWeb of Science
    21. ↵
      1. Herschman H. R.
      (1996) Prostaglandin synthase 2. Biochim. Biophys. Acta 1299:125–140.
      Medline
    22. ↵
      1. Hla T.,
      2. Neilson K.
      (1992) Human cyclooxygenase-2 cDNA. Proc. Natl. Acad. Aci. U.S.A. 89:7384–7388.
      Abstract/FREE Full Text
    23. ↵
      1. Hulkower K. I.,
      2. Georgescu H. I.,
      3. Evans C. H.
      (1991) Evidence that responses of articular chondrocytes to interleukin-1 and basic fibroblast growth factor are not mediated by protein kinase C. Biochem. J. 276:157–162.
    24. ↵
      1. Hulkower K. I.,
      2. Wertheimer S. J.,
      3. Levin W.,
      4. Coffey J. W.,
      5. Anderson C. M.,
      6. Chen T.,
      7. DeWitt D. L.,
      8. Crowl R. M.,
      9. Hope W. C.,
      10. Morgan D. W.
      (1994) Interleukin-1β induces cytosolic phospholipase A2 and prostaglandin H synthase in rheumatoid synovial fibroblasts: Evidence for their roles in the production of prostaglandin E2. Arthritis Rheum. 37:653–661.
      MedlineWeb of Science
    25. ↵
      1. Ishihara H.,
      2. Martin B. L.,
      3. Brautigan D. L.,
      4. Haraki H.,
      5. Ozaki H.,
      6. Kato Y.,
      7. Fusetani N.,
      8. Watabe S.,
      9. Hashimoto K.,
      10. Uemura D.,
      11. Hartshorne D. J.
      (1989) Calyculin A and okadaic acid: Inhibitors of protein phosphatase activity. Biochem. Biophys. Res. Commun. 159:871–877.
      CrossRefMedlineWeb of Science
    26. ↵
      1. Kincaid R. L.
      (1995) The role of calcineurin in immune system responses. J. Allergy Clin. Immunol. 96:1170–1177.
      CrossRefMedline
    27. ↵
      1. Laemmli U. K.
      (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond.) 227:680–685.
      CrossRefMedline
    28. ↵
      1. Le J.,
      2. Weinstein D.,
      3. Gubler U.,
      4. Vilcek J.
      (1987) Induction of membrane-associated interleukin 1 by tumor necrosis factor in human fibroblasts. J. Immunol. 138:2137–2142.
      Abstract
    29. ↵
      1. MacDonald P. C.,
      2. Koga S.,
      3. Casey M. L.
      (1991) Decidual activation in parturition: Examination of amniotic fluid for mediators of the inflammatory response. Ann. N.Y. Acad. Sci. 622:315–330.
      CrossRefMedline
    30. ↵
      1. McGeehan G. M.,
      2. Becherer J. D.,
      3. Robert C.,
      4. Bast J.,
      5. Boyer C. M.,
      6. Champion B.,
      7. Connolly K. M.,
      8. Conway J. G.,
      9. Furdon P.,
      10. Karp S.,
      11. Kidao S.,
      12. McElroy A. B.,
      13. Nichols J.,
      14. Pryzwansky K. M.,
      15. Schoenen F.,
      16. Sehut L.,
      17. Truesdale A.,
      18. Verghese M.,
      19. Warner J.,
      20. Ways J. P.
      (1994) Regulation of tumour necrosis factor-α processing by a metalloproteinase inhibitor. Nature (Lond.) 370:558–561.
      CrossRefMedline
    31. ↵
      1. Menon S. D.,
      2. Guy G. R.,
      3. Tan Y. H.
      (1995) Involvement of a putative protein-tyrosine phosphatase and IκBα serine phosphorylation in nuclear factor κB activation by tumor necrosis factor. J. Biol. Chem. 270:18881–18887.
      Abstract/FREE Full Text
    32. ↵
      1. Nishizuka Y.
      (1984) The role of protein kinase C in cell surface signal transduction and tumor promotion. Nature (Lond.) 308:693–698.
      CrossRefMedline
    33. ↵
      1. Ohuchi K.,
      2. Tamura T.,
      3. Ohashi M.,
      4. Watanabe M.,
      5. Hirasawa N.,
      6. Tsurufuji S.,
      7. Fujiki H.
      (1989) Okadaic acid and dinophysistoxin-1, non-TPA-type tumor promoters, stimulate prostaglandin E2 production in rat peritoneal macrophages. Biochim. Biophys. Acta 1013:86–91.
      Medline
    34. ↵
      1. Palombella V. J.,
      2. Rando O. J.,
      3. Goldberg A. L.,
      4. Maniatis T.
      (1994) The ubiquitin-proteasome pathway is required for processing the NF-κB1 precursor protein and the activation of NF-κB. Cell 78:773–785.
      CrossRefMedlineWeb of Science
    35. ↵
      1. Ristimaki A.,
      2. Garfinkel S.,
      3. Wessendorf J.,
      4. Maciag T.,
      5. Hla T.
      (1994) Induction of cyclooxygenase-2 by interleukin-1α: Evidence for post-transcriptional regulation. J. Biol. Chem. 269:11769–11775.
      Abstract/FREE Full Text
    36. ↵
      1. Romero R.,
      2. Mazor M.,
      3. Manogue K.,
      4. Oyarzun E.,
      5. Cerami A.
      (1991) Human decidua: A source of cachectin-tumor necrosis factor. Eur. J. Obstet. Gynecol. Reprod. Biol. 41:123–127.
      CrossRefMedlineWeb of Science
    37. ↵
      1. Rzymkiewicz D. M.,
      2. DuMaine J.,
      3. Morrison A. R.
      (1995) IL-1β regulates rat mesangial cyclooxygenase II gene expression by tyrosine phosphorylation. Kidney Int. 47:1354–1363.
      MedlineWeb of Science
    38. ↵
      1. Scheinman R. I.,
      2. Cogswell P. C.,
      3. Lofquist A. K.,
      4. Baldwin A. S.
      (1995) Role of transcriptional activation of IκBα in mediation of immunosuppression by glucocorticoids. Science (Wash. DC) 270:283–286.
      Abstract/FREE Full Text
    39. ↵
      1. Schutze S.,
      2. Potthoff K.,
      3. Machleidt T.,
      4. Berkovic D.,
      5. Wiegmann K.,
      6. Kronke M.
      (1992) TNF activates NF-κB by phosphatidylcholine-specific phospholipase C-induced “acidic” sphingomyelin breakdown. Cell 71:765–776.
      CrossRefMedlineWeb of Science
    40. ↵
      1. Srivastava S. K.,
      2. Tetsuka T.,
      3. Daphna-Iken D.,
      4. Morrison A. R.
      (1994) IL-1β stabilizes COX II mRNA in renal mesangial cells: Role of 3′-untranslated region. Am. J. Physiol. 267:F504–F508.
      Abstract/FREE Full Text
    41. ↵
      1. Sung S.-s. J.,
      2. Walters J. A.
      (1993) Stimulation of interleukin-1α and interleukin-1β production in human monocytes by protein phosphatase 1 and 2A inhibitors. J. Biol. Chem. 268:5802–5809.
      Abstract/FREE Full Text
    42. ↵
      1. Sung S.-s. J.,
      2. Walters J. A.,
      3. Fu S. M.
      (1992) Stimulation of tumor necrosis factor α production in human monocytes by inhibitors of protein phosphatase 1 and 2A. J. Exp. Med. 176:897–901.
      Abstract/FREE Full Text
    43. ↵
      1. Terranova P. F.,
      2. Hunter V. J.,
      3. Roby K. F.,
      4. Hunt J. S.
      (1995) Tumor necrosis factor-α in the female reproductive tract. Proc. Soc. Exp. Biol. Med. 209:325–342.
      CrossRefMedline
    44. ↵
      1. Towbin H.,
      2. Staehelin T.,
      3. Gordon J.
      (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76:4350–4354.
      Abstract/FREE Full Text
    45. ↵
      1. Verma I. M.,
      2. Stevenson J. K.,
      3. Schwarz E. M.,
      4. Antwerp D. V.,
      5. Miyamoto S.
      (1995) Rel/NF-KB/IκB family: Intimate tales of association and dissociation. Gene Dev. 9:2723–2725.
      FREE Full Text
    46. ↵
      1. Xue S.,
      2. Brockman D. E.,
      3. Slater D. M.,
      4. Myatt L.
      (1995) Interleukin-1β induces the synthesis and activity of cytosolic phospholipase A2 and the release of prostaglandin E2 in human amnion-derived WISH cells. Prostaglandins 49:351–369.
      CrossRefMedlineWeb of Science
    47. ↵
      1. Xue S.,
      2. Slater D. M.,
      3. Bennett P. R.,
      4. Myatt L.
      (1996) Induction of both cytosolic phospholipase A2 and prostaglandin H synthase-2 by interleukin-1β in WISH cells is inhibited by dexamethasone. Prostaglandins 51:107–124.
      MedlineWeb of Science
    « Previous | Next Article »Table of Contents

    This Article

    1. JPET February 1, 1997 vol. 280 no. 2 1065-1074
    1. AbstractFree
    2. » Full Text
    3. Full Text (PDF)

    Classifications

    Responses

    1. Submit a response
    2. No responses published

    Navigate This Article

    Current Issue

    1. November 2009, 331 (2)
    1. Current Issue
    1. Alert me to new issues of JPET