![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CARDIOVASCULAR
in Brain Endothelial CellsDepartment of Pharmacology (A.R., L.S., X.B.W., D.N.K., S.P.D., V.P.), Center for Molecular and Mitochondrial Medicine and Genetics, and Department of Pediatrics (C.S., V.P.), School of Medicine, University of California, Irvine, California
Received November 9, 2007; accepted March 18, 2008.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
, but not ERβ. Mitochondrial ROS were determined by measuring the activity of aconitase, an enzyme with an iron-sulfur center inactivated by mitochondrial superoxide. 17β-Estradiol increased mitochondrial aconitase activity in HBMECs, indicating a reduction in ROS. Direct measurement of mitochondrial superoxide with MitoSOX Red showed that 17β-estradiol, but not 17-estradiol, significantly decreased mitochondrial superoxide production, an effect blocked by the ER antagonist, ICI-182,780 (fulvestrant). Selective ER agonists demonstrated that the decrease in mitochondrial superoxide was mediated by ER, not ERβ. The selective estrogen receptor modulators, raloxifene and 4-hydroxy-tamoxifen, differentially affected mitochondrial superoxide production, with raloxifene acting as an agonist but 4-hydroxy-tamoxifen acting as an estrogen antagonist. Changes in superoxide by 17β-estradiol could not be explained by changes in manganese superoxide dismutase. Instead, ER-mediated decreases in mitochondrial ROS may depend on the concomitant increase in mitochondrial cytochrome c, previously shown to act as an antioxidant. Mitochondrial protective effects of estrogen in cerebral endothelium may contribute to sex differences in the occurrence of stroke and other age-related neurodegenerative diseases.
). Mitochondria play a fundamental role in key cellular functions, including oxidative phosphorylation, oxidative stress, and apoptosis (Wallace, 2005; Madamanchi and Runge, 2007). As a major by-product of energy production, reactive oxygen species (ROS) are generated in the mitochondrial matrix, and these affect mitochondrial enzymes, lipids, and DNA. In particular, chronic ROS exposure has been suggested to increase mitochondrial DNA (mtDNA) mutations that accumulate with age; mitochondrial dysfunction seems to be a major contributor to age-related diseases (Wallace, 2005; Madamanchi and Runge, 2007).
Recent results indicate that estrogen suppresses mitochondrial ROS production (Stirone et al., 2005b; Duckles et al., 2006; Pedram et al., 2006b; Razmara et al., 2007). It is interesting to note that, by this mechanism, estrogen would be protective but would not be expected to reverse pre-existing damage. Such a mechanism could explain the long-term positive benefits of ovary retention at the time of hysterectomy (Parker et al., 2005) and might also help explain the lack of effect of estrogen in recent hormone replacement therapy clinical trials, where subjects were 10 years or more past menopause (Harman et al., 2004).
Estrogen is believed to play a critical role in protecting females against vascular disease because the incidence of vascular disease-related events, such as stroke, rises dramatically in women after menopause (Mensah et al., 2005). In addition, a large body of evidence from animal studies strongly supports a vascular protective role of estrogen (Mensah et al., 2005). Estrogen is a multifaceted hormone with beneficial effects on vascular health through genomic as well as rapid, nongenomic pathways (Duckles et al., 2006; Krause et al., 2006). We recently demonstrated that estrogen modulates mitochondrial function in cerebral blood vessels (Stirone et al., 2005b), suggesting a novel mechanism for vascular protection. In particular, estrogen increased cerebrovascular expression of several mitochondrial respiratory chain proteins, including cytochrome c and complex IV subunits. This correlated with estrogen-induced increases in the activities of the rate-limiting enzymes cytochrome c oxidase and citrate synthase. Estrogen also increased protein levels of the important mitochondrial-specific antioxidant enzyme, manganese superoxide dismutase (MnSOD), and decreased mitochondrial H2O2 production, indicating increased efficiency of mitochondrial function (Stirone et al., 2005b). Others have shown that estrogen increases MnSOD expression in blood vessels (Strehlow et al., 2003) and stabilizes the mitochondrial membrane, thus maintaining ATP production (Moor et al., 2004). Estrogen increases cerebrovascular levels of nuclear respiratory factor-1 (Stirone et al., 2005b), suggesting that the hormone acts through key transcriptional coactivators responsible for regulating mitochondrial function and oxidative metabolism.
Endothelial dysfunction and ROS production are major contributors to vascular disease, hypertension, and atherosclerosis (Madamanchi and Runge, 2007). Cerebrovascular endothelial cells have particularly high metabolic requirements to maintain the blood-brain barrier (Abbott et al., 2006); thus, mitochondrial ROS production may be especially relevant to cerebrovascular endothelial dysfunction and may contribute to the pathophysiology of stroke and other age-related diseases of the brain (Abbott et al., 2006). Because of the potential importance of the ability of estrogen to suppress mitochondrial ROS in cerebrovascular endothelium, in this study, we investigate the impact of physiological levels of the primary endogenous estrogen, 17β-estradiol, on mitochondrial superoxide production in cultured human brain microvascular endothelial cells, a critical component of the blood-brain barrier. We measured mitochondrial ROS using several complementary techniques and investigated possible mechanisms by which mitochondrial oxidative stress may be modulated by estrogen. In particular, we investigated the role of estrogen receptors, ER and ERβ, in mitochondrial effects of estrogen and compared 17β-estradiol with two clinically relevant selective estrogen receptor modulators (SERMs), raloxifene and 4-hydroxy-tamoxifen, to see whether these drugs also influence endothelial mitochondrial ROS.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
HBMECs were treated with either 10 nM 17β-estradiol (encapsulated in 2-hydroxy-propyl-β-cyclodextrin; Sigma-Aldrich, St. Louis, MO), 10 nM 17-estradiol (Sigma-Aldrich), 10 nM PPT (Tocris Cookson Inc., Ellisville, MO), 10 nM DPN (Tocris Cookson Inc.), 100 nM 4-hydroxy-tamoxifen (Sigma-Aldrich), 100 nM raloxifene (a gift from Eli Lilly & Co., Indianapolis, IN), or equivalent concentration of 2-hydroxypropyl-β-cyclodextrin alone (vehicle control), and the cells were incubated for 24 h at 37°C in 95% O2-5% CO2. Some HBMECs were pretreated with the estrogen receptor antagonist ICI-182,780 (1 µM; Tocris Cookson Inc.) or 100 nM 4-hydroxy-tamoxifen for 1 h, and then drug exposure was continued during the 17β-estradiol or vehicle treatment. After 24 h of treatment, cells were collected for mitochondrial isolation, RNA isolation, and biochemical assays.
Immunocytochemistry. HBMECs were seeded in six-well dishes containing 22-mm glass coverslips coated with Cell Systems attachment factor and immunocytochemistry performed for von Willebrand factor and subunit I of complex IV and measurement of MitoSOX Red fluorescence. Colocalization studies were performed for MitoSOX Red and subunit I of complex IV. Cells were incubated with 2.5 µM MitoSOX Red (Invitrogen, Carlsbad, CA) for 45 min at 37°C, then fixed with 3.7% paraformaldehyde for 15 min at 37°C, permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) for 10 min, and blocked for 1 h in 1% bovine serum albumin-0.05% Triton X-100 before antibody incubation. After overnight incubation at 4°C with either anti-von Willebrand factor (1:200 dilution; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or anti-subunit I of complex IV (1:200 dilution; Invitrogen), the cells were washed with phosphate-buffered saline and then incubated with 1 µg/ml Alexa Fluor 488 (Invitrogen) fluorescent secondary for 2 h. After washes in phosphate-buffered saline, coverslips were then partially dried, and placed on glass slides with mounting medium (Vector Laboratories, Burlingame, CA). Images were obtained using a Carl Zeiss Axiovert 200M fluorescent microscope equipped with appropriate filters (Carl Zeiss GmbH, Jena, Germany). Appropriate controls, such as secondary antibody alone, were used to confirm lack of nonspecific staining.
Mitochondria Isolation. Mitochondria were isolated from HB-MECs using a mitochondrial isolation kit (MITO-ISO1; Sigma-Aldrich), following manufacturer's guidelines with additional centrifugations to obtain an enriched, purified mitochondrial fraction (Stirone et al., 2005b). In brief, freshly collected HBMECs were homogenized in an extraction buffer (50 mM HEPES, pH 7.5, 1 M mannitol, 350 mM sucrose, and 5 mM EGTA). The HBMEC homogenate was centrifuged twice at 600g for 5 min at 4°C to separate out the nuclear pellet. Then, the supernatant was centrifuged at 11,000g for 10 min at 4°C for separation of the mitochondrial pellet and cytosolic fractions. The pellet was resuspended and spun again at 11,000g for 10 min to obtain an enriched mitochondrial pellet. Western immunoblot analysis of porin protein was used to confirm the identity of the mitochondrial fraction. Western blots for histone H1, a nuclear marker, were used to show the absence of nuclear contamination.
Enzyme Activities of Aconitase/Fumarase and Aconitase Reactivation. Mitochondrial aconitase is sensitive to inactivation by superoxide due to the susceptibility of its iron-sulfur core to oxidation; however, fumarase is unaffected. Thus, the activity ratio of aconitase to fumarase was calculated as an indicator of mitochondrial ROS production. Aconitase and fumarase enzyme activities were measured in mitochondria from vehicle- or drug-treated HB-MECs using spectrophotometric rate determination (Gardner et al., 1994). Freshly isolated HBMEC mitochondria samples were freeze-thawed for three cycles, followed by centrifugation at 16,000g for 5 min. For aconitase activity measurement, aliquots of the mitochondrial fraction were incubated in a reaction buffer that contained 154 mM Tris, 5 mM sodium citrate, 0.6 mM MgCl2, and 0.2 mM NADP+ at 25°C. Specific activity of mitochondrial aconitase was measured by monitoring the conversion of citrate to -ketoglutarate over time at 340 nm at 25°C using the coupled reduction of NADP+ to NADPH by 2 U/ml isocitrate dehydrogenase. Aconitase reactivation was achieved by incubation of mitochondrial samples for 5 min with the reducing reagents, 2 mM DL-dithiothreitol and ferrous ammonium sulfate at 0.2 mM. Then, the enzyme activity assay was repeated as described above. One milliunit of aconitase activity was defined as the amount catalyzing the formation of 1 nmol of isocitrate/min (Gardner et al., 1994), and values were normalized to protein content. The percentage inactivation of aconitase was calculated as the difference between mitochondrial aconitase activity before and after reactivation, divided by the reactivated activity, and multiplied by 100.
Fumarase activity was measured by conversion of malate to fumarate. Aliquots of the mitochondrial fraction were incubated in a reaction buffer of 0.05 M potassium phosphate buffer, pH 7.4, and 0.05 M sodium L-malate. The specific activity of fumarase was subsequently determined by monitoring the absorbance over time at 240 nm as fumarate end-product accumulated. The ratio of the specific activities of aconitase to fumarase was then calculated and expressed relative to vehicle control.
Mitochondrial Superoxide Production. Intramitochondrial superoxide production was measured in live HBMECs treated with hormones and drugs using the MitoSOX Red reagent (Invitrogen). This fluorogenic dye selectively enters mitochondria within living cells, where it is oxidized by superoxide anions. This oxidation reaction then emits a red fluorescence when bound to mitochondrial DNA, which is measured using a fluorescence spectrophotometer. After 24 h of hormone or drug treatment, HBMECs were incubated with 2.5 µM MitoSOX for 10 min, followed by wash cycles with a warm 1x Hanks' balanced salt solution (Invitrogen) before 30-min fluorescence readings at wavelengths 510/580 nm (excitation/emission) using a PerkinElmer Luminescence Spectrophotometer LS50B (PerkinElmer Life and Analytical Sciences, Waltham, MA). After initial baseline stabilization, production of mitochondrial superoxide was induced by addition of the complex I substrates, sodium pyruvate and malic acid (2 mM each). The superoxide dismutase mimetic, Mn(III) tetrakis (4-benzoic acid) porphyrin (MnTBAP, 1 mM), was used to scavenge superoxide produced in the reaction to confirm that the MitoSOX signal reflects superoxide levels. Superoxide production was calculated as fluorescence per minute per milligram of protein over a linear range and expressed relative to vehicle control.
Immunoblot Analysis. Endothelial cells and enriched mitochondrial pellets from HBMECs were resuspended at 4°C in cell lysis buffer (50 mM β-glycerophosphate, 2 mM MgCl2, 1 mM EGTA, 1 mM DL-dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride, with 100 µM NaVO3, 0.5% Triton X-100, 20 µM pepstatin, 20 µM leupeptin, and 0.1 U/ml aprotinin; all chemicals were obtained from Sigma-Aldrich) and assayed for protein concentration using the bicinchoninic acid protein assay kit (Pierce, Rockford, IL).
Equal amounts of whole cell lysate or mitochondrial sample proteins, dissolved in Tris-glycine SDS sample buffer with β-mercaptoethanol, were loaded onto 8 or 16% Tris-glycine gels (Invitrogen) and separated by SDS-polyacrylamide gel electrophoresis. Molecular weights of protein bands were determined using broad-range molecular weight markers (Bio-Rad, Hercules, CA). Proteins were then transferred to a nitrocellulose membrane (GE Healthcare, Chalfont St. Giles, UK), incubated overnight at 4°C in blocking buffer, and treated with primary antibodies of interest: MnSOD (Sigma-Aldrich); cytochrome c, ER- (HC-20), ER-β (H-150), glyceraldehyde-3-phosphate dehydrogenase, and histone H1 (Santa Cruz Biotechnology, Inc.); and porin (Calbiochem, San Diego, CA). To verify equal loading, glyceraldehyde-3-phosphate dehydrogenase was used for whole-cell samples, and porin was used for mitochondrial samples. After incubation with appropriate secondary antibodies, protein bands were detected by enhanced chemiluminescence with Hyperfilm (GE Healthcare) and analyzed by densitometry using UN-SCAN-IT (Silk Scientific Inc., Orem, UT).
Manganese Superoxide Dismutase Activity Assay. Manganese superoxide dismutase activity in HBMECs was measured using an SOD assay kit (Cayman Chemical, Ann Arbor, MI). Isolated HBMEC mitochondria samples were freeze-thawed for three cycles, then centrifuged at 16,000g for 5 min, and protein-normalized mitochondrial samples were used for the assay. Superoxide radicals generated by xanthine oxidase were detected using a tetrazolium salt with absorbance monitored at 450 nm. A standard curve produced by using known amounts of exogenous SOD to quench radicals generated by xanthine oxidase was used to compare to endogenous MnSOD activity in HBMEC mitochondria samples. Only mitochondrial MnSOD activity was detected because 1 mM potassium cyanide was used to inhibit other forms of SOD, including Cu/Zn-SOD and extracellular SOD. Using the generated standard curve, the MnSOD activity per amount of mitochondria protein was quantified and then corrected relative to vehicle control.
Quantitative Real-Time PCR. RNA extraction was performed using TRIzol reagent according to the manufacturer's recommendations (Invitrogen) and purified after RNase-free DNase I (Roche Diagnostics, Mannheim, Germany) treatment with RNeasy columns (QIAGEN, Valencia, CA). First strand cDNA synthesis was then performed using the SuperScript kit (Invitrogen), and quantitative real time-PCR was performed using the FastStart DNA Master SYBR Green kit in a Light Cycler (Roche Molecular Biochemicals). MnSOD and cytochrome c mRNA levels were normalized to an actin amplicon, and the results were compared with a standard curve. Oligonucleotide forward and reverse primers used for human MnSOD were (5'-ttggccaagggagatgttaca-3',5'-cgttagggctgaggtttgtcc-3') and human cytochrome c (5'-gaagtgttcccagtgccaca-3', 5'-gctattaagtctgccctttcttcc-3'). Relative amounts of transcripts were calculated on the basis of crossing point analysis. The results from three independent amplifications for each sample, analyzed in duplicate, were combined for statistical analysis.
RNA Interference. ER and ERβ RNA interference (RNAi) construct sequences were generously provided by Dr. E. Levin and have been previously validated and published (Pedram et al., 2006a). Constructs were ordered from QIAGEN, with the ER DNA target sequence, aagcccaaatgtgttgtggcc, and the ERβ target sequence, aaggtgggatacgaaaagacc. As a negative control, we used a random sequence RNAi construct with no homology to any known mammalian gene (QIAGEN). HBMECs at 70 to 80% confluence were transfected with an RNAi construct, at 5 nM, using Oligofectamine reagent in Opti-MEM reduced serum medium (Invitrogen), according to the manufacturer's protocol. Control cells were treated with the transfection vehicle alone. After 48 h of transfection, cells were treated with 10 nM 17β-estradiol or vehicle (2-hydroxy-propyl-β-cyclodextrin) for 24 h and then collected for RNA isolation and/or immunoblot analysis.
Statistical Analysis. All data values are given as mean ± S.E.M. Statistical differences were determined by Student's t test or, where appropriate, one-way analysis of variance with repeated measures. The latter approach was used due to variability in values among assays. Thus, every assay included a sample from each of the relevant experimental treatments, all run at the same time. Analysis of variance was followed by Newman-Keuls post hoc analysis. In all cases, statistical significance was set at P 
0.05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
. Cytochrome c is a critical mitochondrial carrier protein involved in energy production, apoptosis, and ROS production. In Fig. 1, we show that 17β-estradiol treatment of HBMECs for 24 h at 10 nM significantly increases cytochrome c mRNA (Fig. 1A) and protein (Fig. 1B).
|
Immunoblot analysis of estrogen receptors showed that both the 66-kDa (Fig. 2A) and 45-kDa (Fig. 2B) forms of ER (Stirone et al., 2003) and a 55-kDa band (Fig. 2C) corresponding to ERβ were present in HBMECs. To investigate which estrogen receptor mediates the influence of estrogen on mitochondrial cytochrome c, we used short interfering RNA constructs to reduce levels of either ER or ERβ in HBMECs. Confirming the effectiveness of short interfering RNA constructs specific for either ER or ERβ, each of these significantly reduced the respective receptor protein levels at 48 h post-transfection, whereas there was no effect on the other receptor subtype, nor was there an effect of the negative control RNAi construct (Fig. 2).
|
or ERβ (Fig. 3). As a control, we validated that neither RNAi construct alone, without 17β-estradiol, had any effect on cytochrome c protein levels (Fig. 3). Figure 3, A and B, shows that a loss of ER protein significantly inhibits the ability of 17β-estradiol to increase cytochrome c. In contrast, the loss of ERβ did not affect the estrogen-mediated increase in cytochrome c (Fig. 3, C and D).
|
|
Estrogen Suppresses Mitochondrial Superoxide Production. To directly measure mitochondrial superoxide production, we used the MitoSOX Red probe in HBMECs after various hormone and drug treatments. To confirm the expected mitochondrial localization of MitoSOX Red, immunocytochemistry was used (Fig. 5, A–C). Figure 5A shows MitoSOX Red fluorescence, whereas Fig. 5B shows immunofluorescence corresponding to subunit I of complex IV, a protein encoded by mtDNA and restricted to the mitochondria. The merged image (Fig. 5C) demonstrates that MitoSOX fluorescence within the cell colocalizes with immunofluorescence for subunit I of complex IV, confirming the mitochondrial localization of the MitoSOX probe.
|
-estradiol, did not alter superoxide production. Furthermore, the estrogen receptor antagonist, ICI-182,780, inhibited the ability of 17β-estradiol to decrease mitochondrial superoxide. Together, these data support the concept that 17β-estradiol acts via estrogen receptors to decrease mitochondrial superoxide production.
Effects of Selective ER Agonists and ER Modulators on Mitochondrial Superoxide Production. We then tested selective ER agonists and ER modulators to further explore the nature of the estrogen receptor that mediates suppression of mitochondrial superoxide. As shown in Fig. 6A, the ER-selective agonist PPT significantly decreased superoxide levels, whereas the ERβ-selective agonist DPN had no effect. These effects were observed using 10 nM for each ER agonist, a concentration previously shown by others to selectively activate the respective estrogen receptor (Harrington et al., 2003). Figure 6B demonstrates that the selective estrogen receptor modulator, raloxifene (100 nM), also significantly decreased superoxide production. In contrast, 4-hydroxy-tamoxifen (100 nM), the active metabolite of the partial estrogen agonist, tamoxifen, had no effect on superoxide production. However, 4-hydroxy-tamoxifen did inhibit the suppressive effect of 17β-estradiol on mitochondrial superoxide levels. This observation suggests that tamoxifen, through its active metabolite, has no agonist activity but acts like an antagonist. These experiments with selective ER agonists support the conclusion that ER is responsible for the action of estrogen to suppress superoxide production, whereas raloxifene, but not 4-hydroxy-tamoxifen, is capable of the same activity.
|
) as well as enzyme activity in brain mitochondria (Razmara et al., 2007). Thus, to explore the molecular mechanism of the effects of estrogen on mitochondrial oxidative stress, we investigated this important mitochondrial antioxidant protein. As shown in Fig. 7A, after 24 h of treatment of HBMECs with 10 nM 17β-estradiol, MnSOD RNA levels were unchanged. Figure 7B demonstrates that levels of MnSOD protein were also unaffected by exposure to 17β-estradiol. Finally, 17β-estradiol did not alter activity of MnSOD (Fig. 7C). Thus, we did not see any significant change in mRNA, protein, or activity of MnSOD in HBMECs treated with 17β-estradiol for 24 h. Therefore, after 24 h of 17β-estradiol exposure, suppression of superoxide production cannot be accounted for by a change in MnSOD function.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
. Considering its important role in superoxide metabolism, we also measured MnSOD mRNA, protein, and activity; these were unaltered after estrogen treatment. As an alternative explanation for suppression of superoxide production, we found that through ER, estrogen up-regulates cytochrome c mRNA and protein. In light of the antioxidant role of cytochrome c through the electron leak pathway (Skulachev, 1998; Zhao et al., 2003; Zhao and Xu, 2004), an increase in mitochondrial cytochrome c may account for the suppressive effects of estrogen on mitochondrial ROS production.
In general, oxygen-derived free radicals function as intracellular messengers in cell growth and proliferation (Dröge, 2002). However, during cerebral ischemia and reperfusion injuries, excess ROS causes DNA damage, protein oxidation, and lipid peroxidation (Madamanchi and Runge, 2007). The deleterious effects of ROS eventually lead to endothelial dysfunction, vascular smooth muscle cell proliferation, and destabilization of atherosclerotic plaques (Strehlow et al., 2003).
Mitochondrial oxidative phosphorylation is a major source of free radical by-products (Madamanchi and Runge, 2007) that produce long-lasting changes in mitochondrial function, especially in highly metabolically active tissues, such as endothelial cells of the blood-brain barrier (Nag, 2003). Mitochondrial ROS leads to oxidative damage to mtDNA, which lacks robust repair mechanisms, so accumulation of mtDNA mutations over the lifespan is considered to be a major contributor to age-related loss of function (Wallace, 2005). Disruption of cerebrovascular function, including the blood-brain barrier, is thought to contribute to the pathophysiology of a broad spectrum of age-related brain disorders, including Alzheimer's disease and stroke (Abbott et al., 2006). Thus, if estrogen reduces mitochondrial ROS production and delays accumulation of mtDNA mutations, estrogen would be expected to slow or delay the onset of age-related brain disorders.
Estrogen is a pleiotropic hormone with multiple sites and mechanisms for its profound neuroprotective effects (Singh et al., 2006); in particular, the cerebral vasculature is a target for sex hormones (Krause et al., 2006). Because both sexes have endogenous estrogen, protective effects of estrogen may occur in both men and women (Roof and Hall, 2000). In particular, in male rodents, estrogen has been shown to attenuate stroke damage (Toung et al., 1998), reduce cerebrovascular inflammation (Razmara et al., 2005), and suppress brain mitochondrial oxidative stress (Razmara et al., 2007). These protective effects of estrogen have also been observed under pathological conditions in various neuronal cell types (Green and Simpkins, 2000) and endothelial cells (Razandi et al., 2000).
Here, we found that 10 nM 17β-estradiol depresses brain endothelial mitochondrial ROS production using two complementary techniques: mitochondrial superoxide with MitoSOX Red and mitochondrial aconitase activity. As a functional indicator of ROS production, aconitase activity underscores the protective effect of estrogen on mitochondrial enzymes. The difference in aconitase activity between 17β-estradiol and vehicle treatments is eliminated after enzyme reactivation with reducing reagents. This is consistent with a change in enzyme activity, not protein expression, due to oxidation by mitochondrial ROS. In a previous study using an in vivo hormone treatment paradigm, we showed physiological estrogen levels suppress brain mitochondrial oxidative stress (reflected in aconitase activity) in female and male rat brains (Razmara et al., 2007) and decrease hydrogen peroxide production in cerebrovascular mitochondria (Stirone et al., 2005b).
Estrogen can be an antioxidant through the quinol product-based redox cycle (Prokai et al., 2003). However, such direct antioxidant effects of estrogen require concentrations of at least 1 to 10 µM (Behl et al., 1997). In contrast, the neuroprotective effects of physiological estrogen levels that we and others report occur at much lower concentrations (1–100 nM) (Brinton et al., 2000; Wise, 2002). We show that 17-estradiol, which does not activate ER but shares antioxidant activity (Manthey and Behl, 2006), does not mimic the effect of 17β-estradiol to decrease superoxide production. We also demonstrate that the action of 17β-estradiol is inhibited by an estrogen receptor antagonist. Together, these findings support the conclusion that the ability of estrogen to decrease superoxide production is not a direct antioxidant effect.
Of the two nuclear receptors for estrogen, this study demonstrates both ER and ERβ in brain endothelial cells. Use of the selective agonists, PPT and DPN, showed that PPT (ER selective) mimicked the effect of estrogen on superoxide production, but DPN (ERβ selective) had no effect. This supports the conclusion that estrogen acts via ER to suppress mitochondrial oxidative stress.
Differential effects of SERMs on mitochondrial superoxide production highlight the selectivity and tissue-specific actions of these agents (Riggs and Hartmann, 2003). Raloxifene decreased superoxide production in HBMECs, whereas 4-hydroxy-tamoxifen had no effect by itself but did block the action of estrogen. Both SERMs act in cerebral endothelial cells at concentrations that are within the range used clinically (Riggs and Hartmann, 2003). Although raloxifene is used to treat osteoporosis, several studies indicate that it also has beneficial effects on the cardiovascular system (Vogelvang et al., 2006). These differential effects may provide insight in the development of SERMs as therapeutic agents to target brain endothelial mitochondria.
Although several mechanisms could mediate estrogen's effects on mitochondrial ROS production, we investigated MnSOD and cytochrome c. The mitochondrial form of SOD, MnSOD, is critical in superoxide metabolism. Although transgenic homozygous MnSOD knockout mice are neonatal lethal due to acute superoxide toxicity (Li et al., 1995), even heterozygous MnSOD knockout mice demonstrate increased oxidative damage and age-related alterations in mitochondrial function (Kokoszka et al., 2001). We found no changes in mRNA, protein, or enzyme activity levels of MnSOD that could possibly explain the suppression of mitochondrial ROS after 24 h of estrogen treatment. In contrast, we have shown previously that chronic estrogen treatment (3 weeks) increases cerebrovascular mitochondrial MnSOD protein levels (Stirone et al., 2005b) and increases brain MnSOD activity (Razmara et al., 2007). Others have also reported this effect of estrogen (Krause et al., 2006). However, the scavenging of superoxide by MnSOD should lead to increased mitochondrial H2O2, which is then reduced to water by glutathione peroxidase-1 or catalase. In our previous study of in vivo estrogen exposure, mitochondrial H2O2 production was decreased, but without alterations of mitochondrial H2O2-scavenging enzymes, suggesting an overall decrease in ROS production, independent of MnSOD (Stirone et al., 2005b).
An alternative mechanism for the decrease in ROS production caused by estrogen concerns cytochrome c, a critical player in apoptosis and energy production. Cytochrome c has also recently been demonstrated to act as an antioxidant (Zhao et al., 2003) by shuttling electrons coming from superoxide anions, thereby decreasing mitochondrial ROS via an electron-leak pathway (Skulachev, 1998; Zhao and Xu, 2004). We have previously shown that in vivo and in vitro estrogen treatment increases cerebrovascular mitochondrial cytochrome c levels (Stirone et al., 2005b). In HBMECs, we found that cytochrome c mRNA and protein levels were increased by estrogen, and small interfering RNA experiments showed ER to be responsible. These effects do not seem to be accounted for by an effect of estrogen to increase mitochondrial biogenesis because cytochrome c protein measurements were corrected for by levels of the mitochondrial membrane protein porin. It is possible that estrogen enhances mitochondrial efficiency while suppressing superoxide production by changing levels of cytochrome c. Thus, the ER-mediated increase in cytochrome c may not only improve the efficiency of the respiratory chain but also reduce mitochondrial ROS through the electron leak pathway.
Estrogen may also decrease mitochondrial ROS by other mechanisms. Mitochondrial superoxide production can be affected by uncoupling proteins, but we recently demonstrated that estrogen has no effect on these proteins (Razmara et al., 2007). Estrogen may also influence the interaction between nitric oxide (NO) and mitochondrial ROS production in endothelial cells (Moncada and Higgs, 2006). We previously showed that estrogen exposure increases expression and phosphorylation of endothelial nitric oxide synthase, thus increasing NO production (Stirone et al., 2005a). NO can scavenge superoxide anions directly via formation of peroxynitrite species or indirectly via cytochrome c stabilization (Zhang and Gutterman, 2007). These mechanisms may also contribute to mitochondrial effects of estrogen.
In summary, we demonstrate a profound suppressive effect of estrogen on brain endothelial mitochondrial ROS production. Although estrogen may modulate mitochondrial oxidative stress through several independent mechanisms, the concomitant increase in cytochrome c may be a major factor. Nevertheless, other potential pathways need to be explored. With clear evidence that blood-brain barrier disruption occurs early in the development of many neurological pathologies (Abbott et al., 2006), the cerebral vasculature has received increasing focus as a possible therapeutic target. Maintaining brain endothelial health and function, by protecting mitochondria from accumulation of ROS damage, may potentially delay the onset of age-related neurodegenerative diseases. The current study identifies a profound effect of estrogen on brain endothelial mitochondrial oxidative stress as another potential novel pathway to protect function of the cerebral circulation. Selective estrogen receptor modulators that target cerebral endothelial mitochondria may protect against stroke and delay development of age-related neurodegenerative diseases.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: ROS, reactive oxygen species; mtDNA, mitochondrial DNA; MnSOD, manganese superoxide dismutase; ER, estrogen receptor; SERM, selective estrogen receptor modulator; HBMEC, human brain microvascular endothelial cell; PPT, 4,4',4''-(4-propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol; DPN, 2,3-bis(4-hydroxyphenyl)-propionitrile; MnTBAP, Mn(III) tetrakis (4-benzoic acid) porphyrin; PCR, polymerase chain reaction; RNAi, RNA interference; NO, nitric oxide; ICI-182,780, fulvestrant, 7,17β-[9-[(4,4,5,5,5,-pentafluoropentyl)sulfinyl]nonyl]estra-1,3,5(10)-triene-3,17-diol.
Address correspondence to: Dr. Sue P. Duckles, Department of Pharmacology, School of Medicine, University of California, Irvine, CA 92697-4625. E-mail: spduckle{at}uci.edu
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Abbott NJ, Ronnback L, and Hansson E (2006) Astrocyte-endothelial interactions at the blood-brain barrier. Nat Rev Neurosci 7: 41-53.[CrossRef][Medline]
Behl C, Skutella T, Lezoualc'h F, Post A, Widmann M, Newton CJ, and Holsboer F (1997) Neuroprotection against oxidative stress by estrogens: structure-activity relationship. Mol Pharmacol 51: 535-541.
Brinton RD, Chen S, Montoya M, Hsieh D, and Minaya J (2000) The estrogen replacement therapy of the Women's Health Initiative promotes the cellular mechanisms of memory and neuronal survival in neurons vulnerable to Alzheimer's disease. Maturitas 2 (Suppl 34): S35-S52.
DrögeW (2002) Free radicals in the physiological control of cell function. Physiol Rev 82: 47-95.
Duckles SP, Krause DN, Stirone C, and Procaccio V (2006) Estrogen and mitochondria: a new paradigm for vascular protection? Mol Interv 6: 26-35.
Gardner PR, Nguyen DD, and White CW (1994) Aconitase is a sensitive and critical target of oxygen poisoning in cultured mammalian cells and in rat lungs. Proc Natl Acad Sci U S A 91: 12248-12252.
Green PS and Simpkins JW (2000) Neuroprotective effects of estrogens: potential mechanisms of action. Int J Dev Neurosci 18: 347-358.[CrossRef][Medline]
Harman SM, Brinton EA, Clarkson T, Heward CB, Hecht HS, Karas RH, Judelson DR, and Naftolin F (2004) Is the WHI relevant to HRT started in the perimenopause? Endocrine 24: 195-202.[CrossRef][Medline]
Harrington WR, Sheng S, Barnett DH, Petz LN, Katzenellenbogen JA, and Katzenellenbogen BS (2003) Activities of estrogen receptor alpha- and beta-selective ligands at diverse estrogen responsive gene sites mediating transactivation or transrepression. Mol Cell Endocrinol 206: 13-22.[CrossRef][Medline]
Kokoszka JE, Coskun P, Esposito LA, and Wallace DC (2001) Increased mitochondrial oxidative stress in the Sod2 (+/-) mouse results in the age-related decline of mitochondrial function culminating in increased apoptosis. Proc Natl Acad Sci U S A 98: 2278-2283.
Krause DN, Duckles SP, and Pelligrino DA (2006) Influence of sex steroid hormones on cerebrovascular function. J Appl Physiol 101: 1252-1261.
Li Y, Huang TT, Carlson EJ, Melov S, Ursell PC, Olson JL, Noble LJ, Yoshimura MP, Berger C, Chan PH, et al. (1995) Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 11: 376-381.[CrossRef][Medline]
Madamanchi NR and Runge MS (2007) Mitochondrial dysfunction in atherosclerosis. Circ Res 100: 460-473.
Manthey D and Behl C (2006) From structural biochemistry to expression profiling: neuroprotective activities of estrogen. Neuroscience 138: 845-850.[CrossRef][Medline]
Mensah GA, Mokdad AH, Ford ES, Greenlund KJ, and Croft JB (2005) State of disparities in cardiovascular health in the United States. Circulation 111: 1233-1241.
Moncada S and Higgs EA (2006) The discovery of nitric oxide and its role in vascular biology. Br J Pharmacol 147: S193-S201.[CrossRef][Medline]
Moor AN, Gottipati S, Mallet RT, Sun J, Giblin FJ, Roque R, and Cammarata PR (2004) A putative mitochondrial mechanism for antioxidative cytoprotection by 17beta-estradiol. Exp Eye Res 78: 933-944.[CrossRef][Medline]
Nag S (2003) Pathophysiology of blood-brain barrier breakdown. Methods Mol Med 89: 97-119.[Medline]
Parker WH, Broder MS, Liu Z, Shoupe D, Farquhar C, and Berek JS (2005) Ovarian conservation at the time of hysterectomy for benign disease. Obstet Gynecol 106: 219-226.[Medline]
Pedram A, Razandi M, and Levin ER (2006a) Nature of functional estrogen receptors at the plasma membrane. Mol Endocrinol 20: 1996-2009.
Pedram A, Razandi M, Wallace DC, and Levin ER (2006b) Functional estrogen receptors in the mitochondria of breast cancer cells. Mol Biol Cell 17: 2125-2137.
Prokai L, Prokai-Tatrai K, Perjesi P, Zharikova AD, Perez EJ, Liu R, and Simpkins JW (2003) Quinol-based cyclic antioxidant mechanism in estrogen neuroprotection. Proc Natl Acad Sci U S A 100: 11741-11746.
Razandi M, Pedram A, and Levin ER (2000) Estrogen signals to the preservation of endothelial cell form and function. J Biol Chem 275: 38540-38546.
Razmara A, Duckles SP, Krause DN, and Procaccio V (2007) Estrogen suppresses brain mitochondrial oxidative stress in female and male rats. Brain Res 1176: 71-81.[CrossRef][Medline]
Razmara A, Krause DN, and Duckles SP (2005) Testosterone augments endotoxin-mediated cerebrovascular inflammation in male rats. Am J Physiol Heart Circ Physiol 289: H1843-H1850.
Riggs BL and Hartmann LC (2003) Selective estrogen-receptor modulators: mechanisms of action and application to clinical practice. N Engl J Med 348: 618-629.
Roof RL and Hall ED (2000) Gender differences in acute CNS trauma and stroke: neuroprotective effects of estrogen and progesterone. J Neurotrauma 17: 367-388.[Medline]
Singh M, Dykens JA, and Simpkins JW (2006) Novel mechanisms for estrogen-induced neuroprotection. Exp Biol Med (Maywood) 231: 514-521.
Skulachev VP (1998) Cytochrome c in the apoptotic and antioxidant cascades. FEBS Lett 423: 275-280.[CrossRef][Medline]
Stirone C, Boroujerdi A, Duckles SP, and Krause DN (2005a) Estrogen receptor activation of phosphoinositide-3 kinase, akt, and nitric oxide signaling in cerebral blood vessels: rapid and long-term effects. Mol Pharmacol 67: 105-113.
Stirone C, Duckles SP, and Krause DN (2003) Multiple forms of estrogen receptor-alpha in cerebral blood vessels: regulation by estrogen. Am J Physiol Endocrinol Metab 284: E184-E192.
Stirone C, Duckles SP, Krause DN, and Procaccio V (2005b) Estrogen increases mitochondrial efficiency and reduces oxidative stress in cerebral blood vessels. Mol Pharmacol 68: 959-965.
Strehlow K, Rotter S, Wassmann S, Adam O, Grohe C, Laufs K, Bohm M, and Nickenig G (2003) Modulation of antioxidant enzyme expression and function by estrogen. Circ Res 93: 170-177.
Toung TJ, Traystman RJ, and Hurn PD (1998) Estrogen-mediated neuroprotection after experimental stroke in male rats. Stroke 29: 1666-1670.
Vogelvang TE, van der Mooren MJ, Mijatovic V, and Kenemans P (2006) Emerging selective estrogen receptor modulators: special focus on effects on coronary heart disease in postmenopausal women. Drugs 66: 191-221.[CrossRef][Medline]
Wallace DC (2005) A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet 39: 359-407.[CrossRef][Medline]
Wise PM (2002) Estrogens and neuroprotection. Trends Endocrinol Metab 13: 229-230.[CrossRef][Medline]
Zhang DX and Gutterman DD (2007) Mitochondrial reactive oxygen species-mediated signaling in endothelial cells. Am J Physiol Heart Circ Physiol 292: H2023-H2031.
Zhao Y, Wang ZB, and Xu JX (2003) Effect of cytochrome c on the generation and elimination of 
and H2O2 in mitochondria. J Biol Chem 278: 2356-2360.
Zhao Y and Xu JX (2004) The operation of the alternative electron-leak pathways mediated by cytochrome c in mitochondria. Biochem Biophys Res Commun 317: 980-987.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
, significantly different from activity before reactivation within each group; P 
