JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on February 20, 2008; DOI: 10.1124/jpet.108.137802


0022-3565/08/3252-674-680$20.00
JPET 325:674-680, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.108.137802v1
325/2/674    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meng, L.-h.
Right arrow Articles by Pommier, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meng, L.-h.
Right arrow Articles by Pommier, Y.

CHEMOTHERAPY, ANTIBIOTICS, AND GENE THERAPY

Cytokeratin-RNA Cross-Linking Mediated by the Antitumor Aminoflavone, 5-Amino-2,3-fluorophenyl-6,8-difluoro-7-methyl-4H-1-benzopyran-4-one

Ling-hua Meng1, Zhaojing Meng, Ze-hong Miao1, Timothy D. Veenstra, and Yves Pommier

Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland (L.-h.M., Z.-h.M., Y.P.); and Laboratory of Proteomics and Analytical Technologies, Advanced Technology Program, SAIC-Frederick Inc., National Cancer Institute-Frederick, Frederick, Maryland (Z.M., T.D.V.)

Received February 7, 2008; accepted February 19, 2008.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Aminoflavone (AF) is an anticancer drug in early clinical trials, and its antiproliferative activity involves the induction of DNA-protein cross-links. To identify the proteins cross-linked to nucleic acids, cesium chloride (CsCl) gradient centrifugation was used to isolate proteins tightly bound to nucleic acids in AF-treated human breast carcinoma MCF-7 cells. The identified proteins included structural proteins (several cytokeratins), transcription regulators, and stress response proteins. The identification of the cytokeratins was validated using direct immunoblotting of the high-density CsCl (nucleic acid) fractions isolated from AF-treated cells. Ribonuclease A pretreatment caused the cytokeratin signal in the heaviest CsCl fractions to disappear, suggesting that AF mediates RNA-cytokeratin cross-links. Additional experiments using radiolabeled AF showed that AF formed adducts with total RNA and mRNA with similar affinity to that of DNA. Moreover, 18S RNA was selectively pulled down using an anti-cytokeratin antibody after AF treatment. Consistent with the formation of these adducts, we found that AF inhibits RNA and protein synthesis in a dose- and time-dependent manner. This study provides evidence for the formation of AF-mediated cytokeratin-RNA cross-links and the presence of cytokeratin-RNA complexes. Thus, in addition to its anticancer activity, AF might be a useful molecular probe to study the potential role of cytokeratins in the subcellular localization and metabolism of RNA.


Aminoflavone [AF; 5-amino-2,3-fluorophenyl-6,8-difluoro-7-methyl-4H-1-benzopyran-4-one (NSC 686288)] is in phase I clinical trials because of its remarkable effectiveness in animal tumor models and its unique COMPARE pattern (Alley et al., 1999Go) of antiproliferative activity against the panel of NCI60 human cancer cell lines (http://www.dtp.nci.nih.gov/docs/dtp_search.html). A unique pattern of activity for a new agent in the NCI cell screen suggests a novel mechanism of drug action, transport, and/or metabolism (Paull et al., 1989Go). Previous work revealed that AF selectivity for some tumor cells is related to its metabolic activation by cytochrome P450 (Kuffel et al., 2002Go) and sulfotransferase (Meng et al., 2006Go). AF induces DNA damage, mainly in the form of covalent DNA-protein cross-links (DPC) (Meng et al., 2005Go). Those DPC do not involve either Top1 or Top2, but are associated with the production of histone {gamma}-H2AX foci (Meng et al., 2005Go; Pobst and Ames, 2006Go), suggesting the formation of DNA double-strand breaks and inhibition of DNA synthesis (Meng et al., 2005Go). {gamma}-H2AX foci and cytotoxicity occur only in cells that are actively replicating DNA, suggesting that the DPC probably affect replication forks and may cause the DNA double-strand breaks (Meng et al., 2005Go).

We recently proposed that the AF-induced DPC result from bifunctional electrophilic attack by two metabolically activated amino groups that are converted to reactive nitreniums by the sequential actions of cytochrome P450 and sulfotransferase on the drug (Chen et al., 2006Go; Meng et al., 2006Go). However, the proteins involved in the AF-induced DPC remain unknown, and to elucidate the mechanism of action of AF, it is important to identify the proteins that become cross-linked to DNA. In this study, we used cesium chloride (CsCl) gradient centrifugation to separate nucleic acid-bound and free proteins. Proteins cross-linked to nucleic acids were isolated and identified using mass spectrometry. The results show that AF mediates RNA-cytokeratin complexes in human breast cancer MCF-7 cells.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture. Human breast cancer MCF-7 cells were obtained from American Type Culture Collection (Manassas, VA), and they were grown at 37°C in the presence of 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA), 100 U/ml penicillin, and 100 mg/ml streptomycin.

Drugs and Chemicals. AF and 3H-labeled AF were obtained from the Developmental Therapeutics Program (National Cancer Institute, Bethesda, MD). Aminoflavone was dissolved in dimethyl sulfoxide at a concentration of 10 mM. Aliquots were stored at –20°C. 3H-labeled AF was stored in –70°C as an ethanol solution (7.09 Ci/mM, 141 µM, and 1 mCi/ml). AF was diluted to the desired concentrations in medium immediately before each experiment. The final dimethyl sulfoxide and ethanol concentration did not exceed 0.1%. Standard laboratory chemicals were purchased from Sigma-Aldrich (St. Louis, MO), unless otherwise specified. Formic acid and trifluoroacetic acid were obtained from Fluka (Milwaukee, WI). Trypsin was purchased from Promega (Madison, WI). High-performance liquid chromatography-grade acetonitrile was obtained from EM Science (Darmstadt, Germany), and water was purified by a Barnstead NANOPure system (Dubuque, IA).

Separation and Purification of Nucleic Acid-Binding Proteins. Nucleic acid and free protein were separated by CsCl gradient centrifugation. In brief, 5 x 106 cells were lysed in 2 ml of 1% sarkosyl and homogenized using a Dounce homogenizer. Cell lysate was layered on CsCl step gradients (see Fig. 1A) (Sordet et al., 2004Go) and centrifuged at 120,000g for 20 h at 20°C. Eighteen fractions (0.5 ml each) were collected through a hole that had been punctured in the bottom of the tube. Five microliters from each fraction were loaded onto a 1.5% agarose gel, and electrophoresis was performed at 200 V for 15 min. Nucleic acids were stained with ethidium bromide and visualized using a ChemiImager Transilluminator 4000 (Alpha Innotech, San Leandro, CA).


Figure 1
View larger version (79K):
[in this window]
[in a new window]

 
Fig. 1. A, experimental procedure used to separate free proteins and nucleic acids by CsCl gradient centrifugation. B, distribution of nucleic acids in the fractions collected after CsCl gradient centrifugation. Five microliters from each of the indicated CsCl gradient fractions were electrophoresed in agarose and stained with ethidium bromide. C and D, proteins bound to nucleic acids were purified from each CsCl gradient fraction (as described under Materials and Methods) and analyzed by SDS-PAGE and Coomassie Blue staining. C and D correspond to pooled fractions 1 and 2 and 7 to 9, respectively. The CL and AF lanes (lanes 3 and 4, respectively) correspond to fractions from untreated (control) and AF-treated (1 µM for 6 h) cells. The M lanes (lanes 1) are markers with molecular mass indicated at left. Lanes E (lanes 2) are controls with nucleases but without gradient fractions. The horizontal arrows with sample numbers (a1–9 in C, and b1–6 in D) illustrate some of the bands from which proteins were extracted and identified by mass spectrometry (see Table 1).

 
The nucleic acids (RNA) containing fractions (fractions 1 and 2) were pooled together, concentrated, and desalted using a Centricon Centrifugal Filter (10,000-kDa molecular mass cutoff; Millipore Corporation, Billerica, MA). Two microliters of RNase A (4.6 µg/µl; Sigma-Aldrich) was added and incubated at 37°C for 1 h. The solutions were dialyzed overnight against phosphate-buffered saline (PBS) and lyophilized to dryness. The sample was resolubilized in 20 µl of water. Four microliters of 6x SDS loading buffer was added, the sample was then heated in a boiling water bath for 5 min, and the proteins were separated on a 12% SDS-polyacrylamide gel electrophoresis (PAGE).

Fractions 7 to 9 (DNA-containing fractions) were pooled, and an equal volume of 25 mM phosphate buffer, pH 6.6, was added to each tube. Ammonium acetate (330 µl) from a 10 M stock solution was added and mixed well, followed by the addition of 4 ml of isopropanol. The mixture was left to precipitate for 15 min at room temperature. Nucleic acids were pelleted by centrifugation at 10,000g for 20 min and subsequently washed in 70% ethanol. Nucleic acids were resuspended in 100 µl of water, followed by the addition of 8 µl of protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN), 10 µl of DNase 1 (2 U/µl), and 11 µl of 10x reaction buffer (Ambion, Austin, TX). The mixture was incubated at 37°C for 1 h. The reaction mixture was dialyzed against PBS, and 20 µl of the sample was removed for SDS-PAGE analysis. After electrophoresis, the proteins were stained with SimplyBlue SafeStain (Invitrogen). The protein bands were excised from the gel and stored at –20°C.

Nanoflow Reversed-Phase Liquid Chromatography-Tandem Mass Spectrometry. The protein bands were destained and digested with trypsin overnight at 37°C. Peptides were extracted and desalted using ZipTip C18 pipette tips (Millipore Corporation) and resuspended in 0.1% trifluoroacetic acid before mass spectrometry (MS) analysis. Nanoflow reversed-phase liquid chromatography-tandem mass spectrometry was performed using an Agilent 1100 nanoflow LC system (Agilent Technologies, Palo Alto, CA) coupled online with a linear ion-trap MS (LTQ; Thermo Electron, San Jose, CA). Nanoflow reversed-phase liquid chromatography columns were slurry packed in-house with 3-µm, 300Å pore-size C-18 phase (Vydac, Hesperia, CA) in a 75-µm i.d. x 10-cm fused silica capillary (Polymicro Technologies, Phoenix, AZ) with a flame-pulled tip. After sample injection, the column was washed for 20 min with 98% mobile phase A (0.1% formic acid in water) at 0.5 µl/min, and peptides were eluted using a linear gradient of 2% mobile phase B (0.1% formic acid in acetonitrile) to 42% mobile phase B for 40 min at 0.25 µl/min, then to 98% mobile phase B for an additional 10 min. The linear ion-trap MS was operated in a data-dependent mode in which each full MS scan was followed by five tandem mass spectrometry scans, where the five most abundant molecular ions were dynamically selected for collision-induced dissociation using a normalized collision energy of 35%. Dynamic exclusion was applied to minimize repeated selection of peptides previously selected for collision-induced dissociation. The capillary temperature and electrospray voltage were set at 160°C and 1.5 kV, respectively.


View this table:
[in this window]
[in a new window]

 
TABLE 1 Proteins identified from CsCl gradients

 
Bioinformatic Analysis. Tandem mass spectra were searched using SEQUEST against a UNIPROT-derived human proteome database downloaded from the European Bioinformatics Institute (http://www.ebi.ac.uk/integr8/EBI-Integr8-HomePage.do). Only those tryptic peptides with up to two missed cleavage sites that met specific SEQUEST-scoring criteria [delta correlation ({Delta}Cn) ≥0.08 and charge state-dependent cross correlation (Xcorr) ≥1.9 for [M+H]1+, ≥2.2 for [M+2H]2+, and ≥3.1 for [M+3H]3+] were considered as legitimate identifications.

In Vivo Detection of Cytokeratin-Nucleic Acid Complexes. Nucleic acid-protein complexes were detected by the in vivo complex of enzyme bioassay (Sordet et al., 2004Go). The collected nucleic acid-containing fractions were diluted into an equal volume of 25 mM potassium phosphate buffer, pH 6.6, and applied to polyvinylidene difluoride membrane (Immobilon-P; Millipore Corporation) using a slot-blot vacuum manifold. Nucleic acid-cytokeratin complexes were detected by immunoblotting using cytokeratins antibodies.

Laser Scanning Confocal Microscopy. Laser scanning confocal microscopy was performed as described previously (Meng et al., 2005Go). Cells were grown in culture medium on chamber slides. After drug treatment, cells were fixed in 2% paraformaldehyde in PBS for 5 min, washed in PBS, permeabilized in 100% methanol at –20°C for 20 min, and washed again with PBS. Slides were blocked with PBS containing 1% bovine serum albumin and 5% goat serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) for 1 h, incubated with anti-pan-cytokeratin (EMD Biosciences, San Diego, CA), which recognizes cytokeratin 4, 5, 6, 8, 10, 13, and 18, at desired dilution for 2 h, washed, incubated with an Alexa Fluor 488 anti-mouse IgG secondary antibody (Molecular Probes, Eugene, Oregon) at 200-fold dilution for 1 h, and washed in PBS. Slides were mounted with mounting medium (Vectashield; Vector Laboratories, Burlingame, CA) and viewed using a PCM2000 laser scanning confocal microscopy (Nikon, Tokyo, Japan) with a 40x objective. Images were saved as BMP files.

Covalent Binding of AF to DNA and RNA in MCF-7 Cells. MCF-7 cells were treated with 3H-labeled AF (7.09 Ci/mM) for 6 h. Whole DNA was extracted using the DNeasy Tissue Kit from QIAGEN (Valencia, CA), and DNA was eluted with the DNeasy Tissue Kit buffer. Whole RNA was extracted using the RNeasy Mini Kit from QIAGEN and was eluted with diethylpyrocarbonate-treated water. mRNAs were purified using the Absolutely mRNA Purification Kit from Stratagene (La Jolla, CA). The concentration of DNA and RNA in the eluate was determined based on the absorbance at 260 nm. Purity of the nucleic acid samples was verified with the A260/A280 ratio of the eluate (always between 1.8 and 2.0, indicative of quite pure RNA or DNA). The eluate (10 µl) was used to determine the amount of bound radiolabel by liquid scintillation counting.

Immunoprecipitations. MCF-7 cells were treated with 1 µM AF for 6 h. Cells were collected and suspended in 1 ml of PBS. One hundred microliters of cell suspension was taken out, and RNA was extracted to represent whole cellular RNA. The rest of the cells were pelleted and incubated with 500 µl of ice-cold lysis buffer (PBS containing 1% Nonidet P40, 1 mM Na3VO4, 5 mM NaF, and protease inhibitor cocktail) on ice for 30 min. Lysates were clarified by centrifugation at 10,000g for 15 min, and 4 mg of total protein was used for immunoprecipitation. Lysates were precleared with 80 µl of 25% protein A/G agarose slurry for 1 h at 4 °C with rotation. Lysates were spun at 4000g for 5 min, and the supernatants were transferred to another tube and incubated at 4°C with 4 µg of monoclonal anti-pan-cytokeratin (C-11; Abcam, Cambridge, MA) and 160 µl of 25% protein A/G agarose slurry for 2 h. The protein A/G agarose was recovered by centrifugation at 4000g and washed five times with 1 ml of ice-cold lysis buffer. Before the last wash, 100 µl of aliquot was removed, and proteins were eluted with 20 µl of SDS loading buffer by boiling for 5 min and subjected to immunoblot analysis with anti-pan-cytokeratin antibody from EMD Biosciences. The rest of the protein A/G agarose beads were collected, and RNAs were extracted from the beads using the RNeasy Mini Kit from QIAGEN. Ten microliters of the RNA sample was used to perform reverse transcription with RETROscript (Ambion). Real-time quantitative polymerase chain reaction (PCR) was performed using ABsolute QPCR Mixes (ABgene, Rochester, NY) on an ABI 7900 real-time PCR instrument (AME Bioscience, Chicago, IL). Thermal cycling conditions were 50°C for 2 min, 95°C for 15 min, then 40 cycles of 95°C for 15 s and 60°C for 1 min. Primer and probe sequences were as follows (Stommel and Wahl, 2004Go): p21WAF1/CIP1, GCAGACCAGCATGACAGATTTC (sense), GCGGATTAGGGCTTCCTCTT (antisense), FAM-CACTCCAAACGCCGGCTGATCTTC-TAMRA (probe); and 18S RNA, GATTAAGTCCCTGCCCTTTGTACA (sense), GATCCGAGGGCCTCACTAAAC (antisense), FAM-CGCCCGTCGCTACTACCGATTGG-TAMRA (probe). Gene expression was analyzed using Sequence Detection Systems software, version 1.7 (ABI Prism; Applied Biosystems, Foster City, CA).

DNA, RNA, and Protein Synthesis. DNA and RNA synthesis were measured as described previously (Meng et al., 2005Go) with minor modifications. In brief, cells were prelabeled with 0.005 µCi/ml [14C]thymidine (53.6 mCi/mM) for 48 h at 37°C. DNA synthesis was measured by 10-min pulses with 1 µCi/ml [methyl-3H]thymidine (80.9 Ci/mM) at the end of treatment. RNA synthesis was measured by 30-min pulses with 1 µCi/ml [5'-3H]uridine. Protein synthesis was measured by 30-min pulses with 1 µCi/ml [35S]methionine and [35S]cysteine. Incorporation was stopped by washing cell cultures twice in ice-cold Hank's buffered saline solution, and the cells were scraped into 4 ml of ice-cold Hank's buffered saline solution. One milliliter of aliquots was precipitated after addition of 100 µl of 100% (w/v) trichloroacetic acid in triplicate. Samples were vortexed, mixed, and centrifuged for 10 min at 12,000g at 4°C. Precipitates were dissolved overnight at 37°C in 0.5 ml of 0.4 M NaOH. Samples were counted by dual-label liquid scintillation. The [3H] values were normalized with [14C] counts for DNA and RNA synthesis. The [35S] values were computed for protein synthesis rate.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Isolation and PAGE Analysis of Proteins Covalently Bound to Nucleic Acids in AF-Treated Cells. Human breast carcinoma MCF-7 cells that have been well characterized for their response and sensitivity to AF (Loaiza-Pérez et al., 2004Go; Meng et al., 2005Go; Meng et al., 2006Go) were lysed with 1% sarkosyl after exposure to 1 µM AF for 6 h. This length is the time and drug concentration required for AF-induced DPC to reach its peak (Meng et al., 2005Go). The cell lysates were layered on CsCl gradients and centrifuged at 120,000g for 20 h (Fig. 1A). After centrifugation, 18 fractions of 500 µl were collected from the bottom of the tube and numbered on the basis of their elution order. To determine the nucleic acid-containing fractions (Sordet et al., 2004Go), samples from each were electrophoresed in agarose gels. Figure 1B shows that fractions 1 and 2 contained nucleic acids, which sedimented in the highest density CsCl fractions and exhibited faster electrophoretic mobility than the nucleic acids sedimented in the lighter CsCl-density fractions (fractions 5–10).

Fractions 1 and 2 and 7 to 9 from the CsCl gradients were pooled (pools a and b, respectively; see Fig. 1B) and desalted, the cross-linked proteins were analyzed by SDS-PAGE, and staining was performed with Coomassie Blue. Representative gels are shown in Fig. 1, C and D. A greater number and intensity of bands were detected in the AF-treated samples [Fig. 1, C and D, lane 4 (AF)] than in those corresponding to the untreated samples [Fig. 1, C and D, lane 3 (control; CL)], indicating the induction of specific protein-DNA cross-links in AF-treated cells.

Identification of the Proteins Bound to Nucleic Acids after AF Treatment. Gel bands indicated by the arrows and code names in Fig. 1, C and D (a or b followed by number, for fractions 1–2 and 7–9, respectively) were excised and analyzed using mass spectrometry. The major proteins and the number of peptides identified for each are summarized in Table 1. Furthermore, the molecular mass of the identified proteins was in agreement with the electrophoretic mobility corresponding to the excised bands (data not shown). The proteins in fractions 1 and 2 include architectural and structural proteins (cytokeratins, plectin, and actinin), a translation regulator [elongation factor 2 (EF-2)], three stress response proteins [heat shock protein (HSP)-60, HSP-86, and HSP-90], importin, and fatty acid synthetase. The proteins identified from fractions 7 to 9 included seven different cytokeratins and two elongation factors. The cytokeratins were among the most abundant proteins in the nucleic acid fractions, and their presence was reproducible in independent experiments.

Confirmation of Cytokeratin Binding to Nucleic Acids by Immunoblotting. To confirm that AF induced nucleic acid-cytokeratin binding, direct immunoblotting assays were performed on the entire set of CsCl gradient fractions obtained from AF-treated and control cells (Sordet et al., 2004Go). Slot blots were performed using an anti-pan-cytokeratin antibody, which recognizes cytokeratins 4, 5, 6, 8, 10, 13, and 18. As shown in Fig. 2A, cytokeratins were detected in both control and AF-treated cells in fractions that contain free proteins (i.e., 12 and above). In contrast, after AF treatment, cytokeratin signals were observed in the first fractions, which correspond to the nucleic acid-containing fractions (see Fig. 1B).


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
Fig. 2. Immunological analyses of cytokeratins in nucleic acid fractions from MCF-7 cells treated with 1 µM AF for 6 h. Untreated samples (CL) were run in parallel. A, slot blot analysis using anti-pan-cytokeratin antibody in samples from each CsCl gradient fraction. B, Western blot analysis with anti-pan-cytokeratin antibody for proteins purified from fractions 1 and 2 from the CsCl gradients. Fractions were pooled, and proteins were purified (see Materials and Methods; Fig. 1C). Protein samples were separated on an SDS-PAGE, and Western blot analysis was performed using the anti-pan-cytokeratin antibody. C, immunofluorescence staining for cytokeratins. MCF-7 cells were treated with 1 µM AF for 6 h, and they were stained with mouse anti-pan-cytokeratin antibody and goat anti-mouse antibody conjugated with Alexa Fluor 488 (green).

 
To further demonstrate cytokeratin-nucleic acid cross-linking in AF-treated cells, fractions 1 and 2 from the CsCl gradient centrifugation were pooled, and the proteins were extracted. The protein samples were analyzed by Western blot analysis using anti-pan-cytokeratin antibodies. As shown in Fig. 2B, a single band migrating slightly above the 50-kDa molecular mass marker was observed after AF treatment (Fig. 2B, lane 2). This approximate molecular mass corresponds to that of cytokeratin 8, which is one of the most prominently identified cytokeratins in the mass spectrometry analyses (see Table 1).

To detect whether AF induces morphological changes in the cytokeratin network, cells were treated with 1 µMAFfor 6 h, and cytokeratins were stained and examined using immunofluorescence microscopy. As expected, cytokeratins form a dense network of microfilaments distributed throughout the cytoplasm in untreated MCF-7 cells [Fig. 2C, (CL)]. No significant changes in the distribution or intensity of cytokeratin after AF treatment were observed, although AF induces cytokeratin-nucleic acid cross-links.

Cross-Linking of Cytokeratins to RNA in AF-Treated Cells. As shown in Fig. 2A, the AF-mediated cytokeratin-nucleic acid cross-links mainly existed in the nucleic acid fractions that sedimented near the bottom of the CsCl gradients. Previous experiments demonstrated that the cellular DNA migrates more slowly [in the CsCl gradient fractions 7–10 (Sordet et al., 2004Go)]. Because of the fast electrophoretic mobility of the nucleic acids in fractions 1 and 2 (see Fig. 1B), we hypothesized that those nucleic acids were RNA. To test whether those factions contain RNA, the CsCl fractions were electrophoresed on RNase A-containing agarose gels. As shown in Fig. 3A, the nucleic acid bands that moved fastest in agarose gel (indicated by brackets and corresponding to fractions 1–4) disappeared in the presence of RNase A. In contrast, the nucleic acids with slower mobility (in fractions 6–8) were unaffected by RNase A. Those results indicate that, independently of AF, the fast moving nucleic acids in fractions 1 and 2 correspond to RNA, whereas DNA, which shows a slower electrophoretic mobility, sediments in fractions 6 to 8.


Figure 3
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 3. Cytokeratins cross-linking to RNA in AF-treated cells. A, agarose electrophoreses for the CsCl fractions as described in Fig. 1, A and B. Left panels correspond to untreated cells (CL), and right panels correspond to cells treated with AF (1 µM for 6 h). Top panels correspond to standard analysis (as in Fig. 1B), whereas lower panels show agarose gels containing 0.2 µg/ml RNase A. Brackets indicate a series of fast moving nucleic acid bands that disappeared in the RNase A-treated samples. B, inhibition of cytokeratins cross-linking to RNA by RNase A treatment. Cell lysates were treated with 2 µg/ml RNase A for 30 min at room temperature, and then CsCl gradient centrifugation was performed, fractions 1 to 2 were pooled, and slot blot with anti-pan-cytokeratin antibody was performed.

 

To explore whether the presence of cytokeratins in the RNA fractions of the AF-treated cells was dependent on the RNA, cell lysates were first treated with RNase A before loading to the CsCl gradients. As shown in Fig. 3B, pretreatment of the cell lysate with RNase A abolished the cytokeratin signal, indicating that AF mediates the covalent binding (i.e., cross-linking) of cytokeratins to RNA. Thus, under those conditions, the cytokeratins are pulled down through the CsCl by the RNA.

AF Binds to RNA and DNA with Similar Affinity. It has been established (Kuffel et al., 2002Go; Meng et al., 2006Go) that AF binds covalently to DNA. To compare the binding of AF to RNA and DNA, MCF-7 cells were treated with 3H-radiolabeled AF, and AF-RNA and AF-DNA adducts were measured after nucleic acid precipitation. mRNAs were also purified from total RNA, and AF bound to mRNA was measured. As shown in Fig. 4A, AF forms both adducts with similar efficiency with mRNA and DNA, but it also forms effectively with total RNA. Because ribosomal RNA (rRNA) makes up at least 80% of the total RNA in a typical eukaryotic cell, this result suggests that AF forms covalent adducts with rRNA as well.


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 4. Binding of AF to DNA, mRNA, and rRNA. A, MCF-7 cells were treated with 1 µM 3H-AF for 6 h. DNA and RNA were extracted and purified using the DNeasy Tissue Kit and RNeasy Mini Kit, respectively. mRNA was purified from total RNA using the Absolutely mRNA Purification Kit. Data are the amounts of AF bound to 1 mg of DNA/RNA. B, RNA was pulled down by immunoprecipitation with anti-pan-cytokeratin antibody. In brief, MCF-7 cells were treated with AF (1 µM for 6 h) or left untreated (CL). Cell lysates were immunoprecipitated with anti-pancytokeratin. RNA was extracted from whole-cell lysates (input) or from the IP. Real-time PCR was performed, and RNA levels were normalized to those from untreated cells. Data shown are from two independent experiments. Insets, Western blot analysis for cytokeratin from whole-cell lysates (input) or from IP. *, heavy chain of the antibody; **, cytokeratin. Ab, antibody against cytokeratin used for immunoprecipitation.

 
To directly explore the cross-linking of cytokeratin to rRNA in the presence of AF, we performed immunoprecipitations with anti-pan-cytokeratin antibodies in AF-treated cells, and we measured 18S rRNA by reverse transcription-PCR. The effects of AF on 18S rRNA to its effects on mRNA transcription levels of the CDKN1A (p21WAF1/CIP1) gene, which we recently showed to be up-regulated by AF (Meng et al., 2007Go), were also compared. The inset of Fig. 4B demonstrates the efficiency of the pull down of cytokeratin proteins (marked with a double asterisk, **, Fig. 4B). The upper band (*, Fig. 4B) indicates the heavy chain of the antibody. The RNA pulled down by immunoprecipitation and the total RNA from whole-cell lysates were extracted, RNA levels of the AF-treated cells were normalized to those of untreated cells. As shown in Fig. 4B (left column), the levels of p21WAF1/CIP1 mRNAs were induced more than 10-fold by AF treatment, consistent with previously published results (Kuffel et al., 2002Go; Meng et al., 2007Go). The levels of p21WAF1/CIP1 mRNA immunoprecipitated using the cytokeratins antibodies remained elevated by approximately 10-fold (second set of columns from left in Fig. 4B), indicating cross-linking of the p21WAF1/CIP1 mRNA to cytokeratins in AF-treated cells. The results for the 18S rRNAs were even more striking. Whereas AF tended to reduce the total levels of 18S rRNA by approximately 30% [third set of columns (input for 18S) in Fig. 4B], the levels of 18S rRNA cross-linked to cytokeratins were elevated in the presence of AF [right columns (IP for 18S) in Fig. 4B]. Results from control quantitative reverse transcription-PCR revealed that the level of 18S rRNA pulled down by normal mouse IgG was similar in control cells and in AF-treated cells (data not shown), suggesting that enhanced 18S RNA pulled down by cytokeratin antibody is cytokeratin-specific. Thus, the ratio of 18S RNA cross-linked to cytokeratin increased by approximately 5-fold in the immunoprecipitates, suggesting that cytokeratin-18S rRNA cross-links are selectively mediated by AF.

Inhibition of DNA, RNA, and Protein Synthesis by AF. Because of the cross-linking of cytokeratins to RNA and DNA, we wished to determine the functional impact of such cross-linkings in AF-treated cells. AF has already been shown to inhibit DNA synthesis under the conditions in which it induces DPC (Meng et al., 2005Go) and to bind cellular macromolecules selectively in drug-sensitive cells (Kuffel et al., 2002Go; Loaiza-Pérez et al., 2004Go). To explore whether AF also affected the synthesis of RNA and proteins, RNA and protein synthesis were measured by incorporation of [5'-3H]uridine and [35S]cysteine, respectively. As shown in Fig. 5, AF inhibited RNA and protein synthesis in both a dose- and time-dependent manner. The potency of inhibition on RNA synthesis is less than that on DNA synthesis. At an AF concentration of 0.3 µM, which inhibited DNA synthesis completely, AF inhibited RNA synthesis by 60% (Fig. 5A). Protein synthesis was also inhibited under the same conditions, although to a lesser extent compared to that for DNA and RNA.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 5. Inhibition of DNA, RNA, and protein synthesis by AF. DNA synthesis was measured by 10-min pulses with 1 µCi/ml [methyl-3H]thymidine. RNA synthesis was measured by 30-min pulses with 1 mCi/ml [5'-3H]uridine. Protein synthesis was measured by 30-min pulses with 1 µCi/ml [35S]methionine and [35S]cysteine. Left, concentration response was determined for cells treated with AF for 8 h. Right, time course with 1 µM AF. Data are mean ± S.D. for at least three independent experiments.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Aminoflavone is an anticancer drug candidate with a distinct mechanism of action. First, AF induces DNA-protein cross-links in human breast cancer cells independently of DNA topoisomerases (Meng et al., 2005Go). Second, those cross-links occur selectively in some cancer cell lines because AF is metabolically activated to a bis-nitrenium derivative after its sequential activation by cytochrome P450 and sulfotransferase (Kuffel et al., 2002Go; Loaiza-Pérez et al., 2004Go; Chen et al., 2006Go; Meng et al., 2006Go) (Fig. 6A). The aim of the present study was to identify the proteins that become cross-linked to nucleic acids (both DNA and RNA) in cells treated with AF. Ten protein candidates were identified from fractions containing DNA. Seven of these proteins were identified as various cytokeratin isoforms. It has been reported that cytokeratins were among the proteins cross-linked to DNA after exposure to arsenite in WRL-68 human hepatic cells (Ramírez et al., 2000Go), suggesting the existence of DNA-cytokeratin cross-links. Strikingly, we found that more proteins migrated to the bottom of the tube after the CsCl gradient centrifugation. Mass spectrometry analyses revealed that these proteins include structural proteins, most of which are cytokeratins, transcription regulators, and stress response proteins. In this study, we focused on cytokeratins because they were highly represented and also because they were readily detectable by immunoblotting with pan-cytokeratin antibodies in the nucleic acid fractions (Figs. 2 and 3). Figure 6B shows our hypothetical representation of the mechanisms by which AF can induce RNA-cytokeratin cross-linking.


Figure 6
View larger version (27K):
[in this window]
[in a new window]

 
Fig. 6. Proposed interactions between RNA and cytokeratins based on the AF-mediated cytokeratin-RNA cross-links. A, metabolic conversion of the AF primary amines by sequential action of cytochrome P450-A1 (CYP1A1) and sulfotransferase-A1 (SULT1A1) (Kuffel et al., 2002Go; Loaiza-Pérez et al., 2004Go; Chen et al., 2006Go; Meng et al., 2006Go). B, we propose that the two reactive primary amines at positions 5 and 4' can be metabolically converted to nitrenium ions (Chen et al., 2006Go) (see A) that react with RNA and cytokeratin, thereby forming cytokeratin-AF-RNA cross-links.

 

Cytokeratins belong to the intermediate filament protein family, and more than 20 different cytokeratins have been identified, of which cytokeratin 8, 18, and 19 are the most abundant in simple epithelial cells (Barak et al., 2004Go; Gu and Coulombe, 2007Go). These three cytokeratins were among the proteins that were most frequently identified as being cross-linked to RNA (Table 1). It is notable that those cross-links occurred without detectable morphological change of the cytokeratin network (Fig. 2C). Treatment of the cell lysates with RNase A before the gradient centrifugation abolished the nucleic acid-cytokeratin complex, indicating that RNA was cross-linked to cytokeratins in the presence of AF. In a consistent manner, a number of RNA-processing components were identified from the RNA-containing fractions (fractions 1 and 2, Table 1; and data not shown). These results indicated that AF also induced RNA-protein cross-links in MCF-7 cells in addition to the DNA adducts (Kuffel et al., 2002Go; Meng et al., 2006Go). We found that AF formed adducts with both mRNA and rRNA (Fig. 4). More specifically, we found that AF can mediate cross-linking between the small ribosomal subunit RNA (18S RNA) and cytokeratins (Fig. 4B), suggesting that cytokeratins are colocalized with mRNA and ribosomes under physiological conditions.

The cytoskeleton network plays an important role in the maintenance of cell shape and the transport and anchoring of cellular components. The cytoskeleton also functions as a physical anchor and transport network for RNA (Kloc et al., 2002Go; Tekotte and Davis, 2002Go; López de Heredia and Jansen, 2004Go). Thus, the cytoskeleton network may provide a scaffold for both mRNA translocation and anchorage of ribosomes for protein synthesis. There is evidence to suggest that cytoskeletal interactions are important for the expression of mRNA, including control of its translation and its direct movement within the cell (St Johnston, 1995Go). Ultraviolet radiation has been previously used to demonstrate that cross-linking can occur between RNA and a cytoskeleton-associated protein (DeFranco et al., 1998Go). In our study, we have identified a number of proteins that may associate with RNA in AF-treated cells. We identified several ribosomal proteins such as 60S ribosomal protein L4, 40S ribosomal protein S3a, and 40S ribosomal protein S9 from the RNA fractions (data not shown), but they were less prevalent than cytokeratins and some translational factors such as EF-2 (Table 1). Cytokeratins have been confirmed to cross-link RNA in the presence of AF, but little is known about the function of cytokeratin-RNA interactions. It has been reported that organization of the cytokeratin filament depended on the presence of intact VegT mRNA and a noncoding RNA in Xenopus oocytes (Kloc et al., 2005Go).

In summary, we show that AF, which is beginning clinical trials as an anticancer drug, induces both DNA-protein and RNA-protein cross-links in human breast cancer cells. Proteins that covalently bind to DNA or RNA were identified, and we focused on the cytokeratin-RNA cross-links. The ability of AF to cross-link cytokeratins and RNA suggests that AF could be used as a molecular probe to identify new RNA-associated proteins and to study the potential role of cytokeratins in RNA metabolism. Induction of cytokeratin-RNA cross-linking by AF could contribute to inhibition of protein synthesis by AF (see Fig. 5). However, further studies will be needed to determine the implication of the cytokeratin-RNA cross-links in the mechanistic action of AF.


    Acknowledgements
 
The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organization imply endorsement by the United States Government.


    Footnotes
 
This project has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract N01-CO-12400.

Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.108.137802.

ABBREVIATIONS: AF, aminoflavone; NSC 686288, 5-amino-2,3-fluorophenyl-6,8-difluoro-7-methyl-4H-1-benzopyran-4-one; DPC, DNA-protein cross-links; CsCl, cesium chloride; 3H-labeled AF, 5-amino-2,3-fluorophenyl-6,8-difluoro-7-methyl—[3-3H]-4H-1-benzopyran-4-one; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; MS, mass spectrometry; PCR, polymerase chain reaction; CL, control; EF-2, elongation factor 2; HSP, heat shock protein; rRNA, ribosomal RNA; IP, immunocomplexes.

1 Current affiliation: Institute of Materia Medica, Shanghai, China. Back

Address correspondence to: Dr. Yves Pommier, Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Drive, Bldg. 37, Room 5068, Bethesda, MD 20892-4255. E-mail: pommier{at}nih.gov


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Alley MC, Stinson SF, Pacula-Cox CM, Camalier RF, Philips LR, Daw TW, and Sausville EA (1999) Pharmacologic evaluations of a novel amino-substituted flavone (NSC 686288) exhibiting unique in vitro and in vivo anticancer activities. Proc Am Assoc Cancer Res 40: 119.

Barak V, Goike H, Panaretakis KW, and Einarsson R (2004) Clinical utility of cytokeratins as tumor markers. Clin Biochem 37: 529–540.[CrossRef][Medline]

Chen C, Meng L, Ma X, Krausz KW, Pommier Y, Idle JR, and Gonzalez FJ (2006) Urinary metabolite profiling reveals CYP1A2-mediated metabolism of NSC686288 (aminoflavone). J Pharmacol Exp Ther 318: 1330–1342.[Abstract/Free Full Text]

DeFranco C, Chicurel ME, and Potter H (1998) A general RNA-binding protein complex that includes the cytoskeleton-associated protein MAP 1A. Mol Biol Cell 9: 1695–1708.[Abstract/Free Full Text]

Gu LH and Coulombe PA (2007) Keratin function in skin epithelia: a broadening palette with surprising shades. Curr Opin Cell Biol 19: 13–23.[CrossRef][Medline]

Kloc M, Wilk K, Vargas D, Shirato Y, Bilinski S, and Etkin LD (2005) Potential structural role of non-coding and coding RNAs in the organization of the cytoskeleton at the vegetal cortex of Xenopus oocytes. Development 132: 3445–3457.[Abstract/Free Full Text]

Kloc M, Zearfoss NR, and Etkin LD (2002) Mechanisms of subcellular mRNA localization. Cell 108: 533–544.[CrossRef][Medline]

Kuffel MJ, Schroeder JC, Pobst LJ, Naylor S, Reid JM, Kaufmann SH, and Ames MM (2002) Activation of the antitumor agent aminoflavone (NSC 686288) is mediated by induction of tumor cell cytochrome P450 1A1/1A2. Mol Pharmacol 62: 143–153.[Abstract/Free Full Text]

Loaiza-Pérez AI, Kenney S, Boswell J, Hollingshead M, Alley MC, Hose C, Ciolino HP, Yeh GC, Trepel JB, Vistica DT, et al. (2004) Aryl hydrocarbon receptor activation of an antitumor aminoflavone: basis of selective toxicity for MCF-7 breast tumor cells. Mol Cancer Ther 3: 715–725.[Abstract/Free Full Text]

López de Heredia M and Jansen RP (2004) mRNA localization and the cytoskeleton. Curr Opin Cell Biol 16: 80–85.[CrossRef][Medline]

Meng LH, Kohlhagen G, Liao ZY, Antony S, Sausville E, and Pommier Y (2005) DNA-protein cross-links and replication-dependent histone H2AX phosphorylation induced by aminoflavone (NSC 686288), a novel anticancer agent active against human breast cancer cells. Cancer Res 65: 5337–5343.[Abstract/Free Full Text]

Meng LH, Kohn KW, and Pommier Y (2007) Dose-response transition from cell cycle arrest to apoptosis with selective degradation of Mdm2 and p21WAF1/CIP1 in response to the novel anticancer agent, aminoflavone (NSC 686288). Oncogene 26: 4806–4816.[CrossRef][Medline]

Meng LH, Shankavaram U, Chen C, Agama K, Fu HQ, Gonzalez FJ, Weinstein J, and Pommier Y (2006) Activation of aminoflavone (NSC 686288) by a sulfotransferase is required for the antiproliferative effect of the drug and for induction of histone {gamma}-H2AX. Cancer Res 66: 9656–9664.[Abstract/Free Full Text]

Paull KD, Shoemaker RH, Hodes L, Monks A, Scudiero DA, Rubinstein L, Plowman J, and Boyd MR (1989) Display and analysis of patterns of differential activity of drugs against human tumor cell lines: development of mean graph and COMPARE algorithm. J Natl Cancer Inst 81: 1088–1092.[Abstract/Free Full Text]

Pobst LJ and Ames MM (2006) CYP1A1 activation of aminoflavone leads to DNA damage in human tumor cell lines. Cancer Chemother Pharmacol 57: 569–576.[CrossRef][Medline]

Ramírez P, Del Razo LM, Gutierrez-Ruiz MC, and Gonsebatt ME (2000) Arsenite induces DNA-protein crosslinks and cytokeratin expression in the WRL-68 human hepatic cell line. Carcinogenesis 21: 701–706.[Abstract/Free Full Text]

Sordet O, Liao Z, Liu H, Antony S, Stevens EV, Kohlhagen G, Fu H, and Pommier Y (2004) Topoisomerase I-DNA complexes contribute to arsenic trioxide-induced apoptosis. J Biol Chem 279: 33968–33975.[Abstract/Free Full Text]

St Johnston D (1995) The intracellular localization of messenger RNAs. Cell 81: 161–170.[CrossRef][Medline]

Stommel JM and Wahl GM (2004) Accelerated MDM2 auto-degradation induced by DNA-damage kinases is required for p53 activation. EMBO J 23: 1547–1556.[CrossRef][Medline]

Tekotte H and Davis I (2002) Intracellular mRNA localization: motors move messages. Trends Genet 18: 636–642.[CrossRef][Medline]



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.108.137802v1
325/2/674    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meng, L.-h.
Right arrow Articles by Pommier, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meng, L.-h.
Right arrow Articles by Pommier, Y.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition