![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CHEMOTHERAPY, ANTIBIOTICS, AND GENE THERAPY
Oncology Division, Postgraduate Medical School (A.M., P.M.-P., H.M.C.) and School of Biological and Molecular Sciences (G.E.N.K.), University of Surrey, Surrey, United Kingdom; Department of Urology, Kanazawa University, Kanazawa, Japan (A.M.); and Department of Nutritional Science, Faculty of Health and Welfare Science, Okayama Prefectural University, Okayama, Japan (Y.T.)
Received September 12, 2007; accepted December 17, 2007.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
(GSTpi), and nonsteroidal anti-inflammatory response gene (NAG-1) in the LNCaPCOX-2 cell line compared with LNCaPneo cells. Significant decreases in survivin levels and increases in GSTpi and NAG-1 appeared to be COX-2-dependent effects because they were more pronounced in LNCaPCOX-2 cells. Our findings indicate both COX-2-dependent and -independent mechanisms attributable to celecoxib and support its utility in the management of prostate cancer.
There are currently a number of lines of evidence suggesting that cyclooxygenase (COX)-2 is a promising new target for cancer therapy, both at the level of chemoprevention and also to treat cancer. COX-2 has been reported to be elevated in a number of types of cancers, such as prostate (Yoshimura et al., 2000
), breast (Davies et al., 2002), colorectal (Soslow et al., 2000), pancreatic (Tucker et al., 1999), and liver (Koga et al., 1999). Indeed, the production of prostaglandins due to the activity of COX-2 has been implicated in carcinogenic processes where chronic inflammation is indicated. Furthermore, epidemiological evidence indicating a significantly reduced incidence of colorectal adenomas in subjects who have taken nonsteroidal anti-inflammatory drugs over a prolonged period of time provides a rationale for using COX-2 inhibitors to treat cancer (Schreinemachers and Everson, 1994). Recent evidence has shown that COX-2 overexpression may increase tumorigenic potential via prevention of cellular apoptosis (Tsujii and DuBois, 1999). Moreover, the deletion of COX-2 in Apc knockout mice, which is representative of familial adenomatous polyposis, was consistent with a reduction in the number and size of colorectal adenomas and a restoration of apoptosis (Oshima et al., 1996).
A number of immunohistochemically based studies have demonstrated higher expression of COX-2 in cancerous versus benign prostate tissues (Gupta et al., 2000; Yoshimura et al., 2000), and a more recent study by Wang et al. (2005) demonstrated incremental staining with higher Gleason scores. Prostate cancer is regarded as a slow growing malignancy that is the result of an imbalance between the proliferation rate and cell death. Indeed, overexpression of anti-apoptotic factors has been reported in human prostate cancer tissues (Tanji et al., 2000; Krajewska et al., 2003). In conjunction with these findings, reports in the literature have identified COX-2 inhibitors as inducers of apoptosis in prostate cancer cells with concomitant decreases in antiapoptotic factors such as Bcl-2 (Liu et al., 1998). Moreover, use of nonsteroidal anti-inflammatory drugs has been associated with a decrease in distant bony metastases with concomitant increases in survival in prostate cancer patients (Nguyen, 2004).
We have set out to clarify the role of COX-2 in human prostate cancer by transfecting the human prostate cancer line LNCaP with COX-2. The sensitivity of the transfected cells to various cytotoxic agents was compared with empty vector control LNCaPneo cells. The present study has addressed the role of COX-2 with respect to chemosensitivity to standard chemotherapeutic agents and has also attempted to elucidate the underlying mechanisms. Moreover, we have looked at the effects of the COX-2 inhibitor celecoxib in our COX-2-expressing prostate cancer model in terms of the mRNA levels of genes relevant to prostate carcinogenesis.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Cell Culture. Prostate cancer cell lines PC-3 and DU145 were obtained from the European Collection of Cell Cultures. LNCaP stable transfectants (Neo and COX-2) were developed as described below. Stock cells of LNCaP transfectants were treated every third passage with 0.35 mg/ml neomycin to select for cells that maintained the plasmid containing either the Neo or COX-2 plasmid. All prostate cancer cells were grown in RPMI 1640 medium, supplemented with heat-inactivated 10% fetal bovine serum (Invitrogen, Paisley, UK) and 2 mM L-glutamine. Cells were grown in a humidified incubator with 5% CO2 at 37°C. At each passage, cells were detached from the culture flask with porcine trypsin-EDTA solution.
Gene Transfection. Twenty-four hours after plating 2 x 105 LNCaP cells on 6-cm dishes in Dulbecco's modified Eagle's medium with 5% charcoal-stripped fetal bovine serum-containing medium, cells were transfected with pBOSNeo or pBOSNeoCOX-2 vector (see Fig. 1) (Kinoshita et al., 1999) using a standard calcium phosphate method. After 48 h, the transfected cells were trypsinized from the plate and replaced onto a 6-cm culture dish in medium containing a final concentration of 0.8 mg/ml G418 (Geneticin; Invitrogen) to select stably transfected cells. Discrete colonies formed by 14 days after selection. Stable clones were continuously cultured in the presence of 0.8 mg/ml G418. Stock cells of LNCaP transfectants were treated every third passage with 0.35 mg/ml neomycin to select for cells that maintained the plasmid containing either the Neo or COX-2 plasmid.
|
RT-PCR for COX-2 mRNA Expression. Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The resulting RNA pellet was washed with 75% ethanol and dissolved in RNase-free water. Total RNA was converted to cDNA using ImProm-II reverse transcriptase kit from Promega Corporation (Southampton, UK) according to the manufacturer's instructions. Samples were then subject to the PCR reaction in a Touchgene thermal cycler (Techne; supplied by Jencons PLS, East Grinstead, W. Sussex, UK). cDNA was amplified using Taq Polymerase (5 units/µl), buffer containing 500 mM KCl, 100 mM Tris-Hcl, pH 9.0, 1% Triton X-100, 15 mM MgCl2, 10 mM dNTPs, and 10 µM sense and antisense primers were obtained from Genosys Inc. (supplied by Sigma-Aldrich). To ensure equivalent loading of cDNA for PCR, total RNA was approximated by performing RT-PCR of the β2-microglobulin housekeeping gene. The sense strand was 5'-ACCCCACTGAAAAAGATGA-3', and the antisense sense strand was 5'-ATCTTCAAACCTCCATGATG-3'. After an initial denaturation step of 94.0°C for 3 min, 35 cycles of PCR were performed: denaturing at 94.0°C for 45 s, annealing at 54.0°C for 45 s, and chain extension at 72.0°C for 90 s. This gave rise to a 120-bp product that was separated on a 1.2% agarose gel and visualized with ethidium bromide. The strength of the bands were used to approximate levels of total RNA, and cDNA loading for COX-2 PCR was adjusted accordingly.
Chemosensitivity Testing. Cell cytotoxicity assays were performed via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium assay, using the method described by Mosmann (1983). Drugs were all dissolved in dimethyl sulfoxide as stock solutions apart from carboplatin, which was dissolved in sterile 0.9% saline as a stock solution and stored at –20°C. All cells were plated at 3 x 104/ml in 96-well plates in a volume of 200 µl. Cells were allowed to grow and attach in the humidified incubator for 24 h at 37°C and 5% CO2, unless stated otherwise. Typically, eight different concentrations of drugs were used, with a 2- to 3-log-fold range. Cells were incubated with drug for 72 h (equivalent to three or four cell doublings). The assay was terminated when the cells were incubated with 0.05 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium for approximately 4 h at 37°C. The medium was removed, and the resulting formazan product was dissolved in 200 µl of dimethyl sulfoxide. The absorbance of each well was read at 540 nm using an automated plate reader (Labsystems Multiskan RC; Thermo Electron Corporation, Waltham, MA) with Genesis 3.05 software. A graph of cell viability against drug concentration was produced from the mean absorbance values by calculating the percentage growth of drug treated cells against control cells. From these graphical data, the IC50 values were derived.
Annexin V Analysis for Apoptotic Response. LNCaPneo and LNCaPCOX-2 cells were seeded into tissue culture flasks to give approximately 30 to 40% confluence, allowed to attach for 2 to 3 h, and then treated with 100 µM carboplatin for 48 h. An annexin V-fluorescein isothiocyanate-conjugated apoptosis detection kit incorporating propidium iodide was used as described by the manufacturer's protocol (CN Biosciences). Samples were analyzed by flow cytometry, using the FL1 (fluorescein isothiocyanate) and FL3 (propidium iodide) lines, and each reading was taken using 10,000 events.
Western Blotting. After seeding into tissue culture flasks, cells were left to attach for 24 h. Exponentially growing cells were treated with 100 µM carboplatin for 72 h alongside untreated control cells. Whole-cell lysates were then obtained by trypsinizing the monolayer of adherent cells, combining them with the floating cell population and washing with PBS at 4°C. Cell pellets were then subjected to osmotic rupture in hypotonic detergent-based buffer (1 mM phenylmethanesulfonyl fluoride, 1 mM NaVO4, 2 µg/ml aprotinin, and 2 µg/ml leupeptin as protease inhibitors, 150 mM NaCl in 50 mM Tris buffer, 0.2% SDS, 1% Nonidet P-40, pH 7.5) and 50 µg of protein/sample electrophoresed on SDS-polyacrylamide gel electrophoresis gels with subsequent transfer blotting. Membranes were incubated overnight at 4°C with primary antibody, i.e., to survivin, Bcl-2, p53, p27kip2 AKT, or phospho-AKT (Ser473). After washing, membranes were incubated with a secondary horseradish peroxidase-linked appropriate species antibody preparation at room temperature for 1 h with chemiluminescence used for visualization. After the probing of each membrane with the primary antibody of choice, the membrane was stripped and reprobed using an actin antibody (Autogen Bioclear) to act as a loading control.
Drug Treatment of LNCaP Cells for Quantitative PCR Analysis. LNCaPneo and LNCaP-COX-2 cells were seeded into tissue culture flasks at sufficient density to give 40 to 50% confluence. Cultures were incubated under standard culture conditions for 24 h to allow cells to attach. Each cell line was treated with either a low dose of celecoxib at 100 nM or a high dose at 30 µM, with untreated control flasks being set up at the same time. The dose of 100 nM was estimated to be in the range for a COX-2-dependent dose, whereas the dose of 30 µM was selected to represent a subcytotoxic dose that was deemed to represent a concentration at which COX-2-independent effects may be seen. This dose was approximately an IC20 concentration (i.e., the dose of drug to reduce cell viability by 20% relative to control cells). Cells were incubated for 48 h, and then the RNA was extracted as for the PCR methodology. Experiments were set up on three separate occasions to provide three biological replicates.
RNA Extraction. RNA was extracted from LNCaPneo and LNCaPCOX-2 cells using the TRIazol reagent as described above for the RT-PCR analysis. The quality of the resulting RNA was checked with an Agilent 2100 Bioanalyser using an RNA Nano-Labchip according to the manufacturer's instructions (Agilent Technologies UK Ltd., Stockport, Cheshire, UK). The RNA was diluted with RNase free water and assessed for quality (260:280 nm absorbance ratio, approximately 2.00) and quantity using the Nanodrop spectrophotometer (supplied by Labtech International, Ringmer, East Sussex, UK).
Real-Time Quantitative PCR. cDNA was made using the Im-PromII reverse transcription system (Promega). Real-time quantitative PCR was performed using the Stratagene QPCRMX3005P thermal cycler (Stratagene Europe, Amsterdam, The Netherlands). Reactions were performed in a 20-µl volume with 5 pmol primers and 4 mM MgCl2 using the Brilliant SYBR Green QPCR Master Mix reagent (Stratagene). For surviving, the protocol was 10 min at 95°C for activating the hot start Taq polymerase, then 20 s at 95°C, 20 s at 60°C, and 20 s at 72°C for 45 cycles. For desmin, the protocol was 94°C for 10 min, then 45 cycles of 30 s at 94°C, 60 s at 60°C, and 60 s at 72°C. For glutathione S-transferase (GSTpi), the protocol was 95°C for 10 min, then 40 cycles of 95°C for 20 s and 60°C for 60 s. For SRP72kDa, the protocol was 95°C for 10 min, then 35 cycles of 95°C for 60 s, 62°C for 2 min, and 72°C for 3 min. All analyses were set up in duplicate and were also repeated on at least two occasions. Relative expression of genes was normalized to that of actin and gene expression in each sample calculated as 2–
Cr.
Primers. Primer sequences were designed using Primer 3 software and supplied by Invitrogen. These were for survivin, forward, ACCAGGTGAGAAGTGAGGGA, and reverse, AACAGTAGAGGAGCCAGGGA; for desmin, forward, CCAACAAGAACAACGACG, and reverse, TGGTATGGACCTCAGAACC; for GSTpi, forward, CATCTCCCTCATCTACACCAACTATGA, and reverse, GTCTTGCCTCCCTGGTTCTG; for NAG-1, forward, CTCCAGATTCCGAGAGTTGC, and reverse, AGAGATACGCAGGTGCAGGT; and for β actin, forward, GCATCCACGAAACTACCTTC, and reverse, CAGGAGGAGCAATGATCTTG.
Statistical Analysis. For comparison of all data obtained for LNCaPneo with LNCaPCOX-2, we used the SPSS 12.0.1 program (SPSS Inc., Chicago, IL). Comparison of means was carried out using the one-way ANOVA or equality of means test, as appropriate. Differences were considered significant if a p value of 0.05 or less was obtained.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
COX-2-Expressing Cancer Cells Show Diminished p53 Response and Increased Phospho-AKT. Carboplatin treatment clearly induced a p53 response in LNCaPneo cells with a concomitant transactivation of p27kip1 (Fig. 4A). These findings are consistent with LNCaP cells being wild type for p53. A much weaker response was shown for LNCaPCOX-2 cells under the same conditions. Likewise, there was a reduction in the activation of AKT, as shown by diminished p-AKT in response to carboplatin in LNCaPneo cells, which was absent for LNCaPCOX-2 cells (Fig. 4B).
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). In addition, COX-2 inhibitors have been considered as part of combination chemotherapy for the treatment of a variety of cancers (Dawson et al., 2007; Javle et al., 2007).
In contrast to other studies (Soriano et al., 1999; Hashitani et al., 2003; Lin et al., 2005), the LNCaPCOX-2 model system failed to show increased sensitivity to celecoxib compared with the control LNCaPneo cells. Moreover, we failed to see a sensitization of the LNCaPCOX-2 cells to agents such as carboplatin if using a carboplatin/celecoxib combination (with isobologram analysis; data not shown). The reasons behind this are unclear but may relate to the cytostatic as well as cytotoxic nature of carboplatin. In addition, despite increased COX-2 expression in our model, this did not render cells more sensitive to the cytotoxic effects of celecoxib. This is in contrast to other studies that clearly showed a chemosensitizing effect in COX-2-expressing cells treated with a cytotoxic agent combined with a COX-2 inhibitor (Hashitani et al., 2003; Lin et al., 2003). Moreover, in contrast to our study, the latter studies were also able to demonstrate increased chemosensitivity of their COX-2-expressing cells to COX-2 inhibitors.
In non-COX-2-expressing cells, celecoxib has been shown to be cytotoxic (Patel et al., 2005) because LNCaP and PC-3 cells devoid of COX-2 expression treated with celecoxib (2.5–5.0 µM) showed a cell cycle blockade at G1. In the same study, it was shown that the PC-3 xenograft models (devoid of COX-2 expression) were reduced in volume after treatment with celecoxib at a dose corresponding to plasma concentrations in the range of 2 to 5 µM. Hence, the idea emerged that celecoxib possesses properties that are independent of its activity as a COX-2 inhibitors. Such COX-2-independent effects have been shown to include antiangiogenic activity and cell cycle arrest (G1 blockade) where levels of prostaglandin E2 were shown to be unaffected in xenograft models treated with celecoxib in the absence of COX-2 expression (Patel et al., 2005). In agreement with that particular study, we were able to demonstrate G1 cycle arrest in both LNCaPCOX-2 and -neo cells treated with celecoxib at 5 µM, and the blockade was of similar magnitude for both cell lines (data not shown).
The resistance of LNCaPCOX-2 cells to carboplatin coincided with a reduction in apoptosis. Moreover, our studies have identified the involvement of Akt- and COX-2-dependent signaling in the resistance of the LNCaPCOX-2 cells. The phosphatidylinositol-3-kinase/Akt axis is a pleiotropic apoptosis-suppressing pathway that is particularly involved in trophic factor deficiency-induced apoptosis through the differential regulation of pro- and antiapoptotic gene expression via their downstream targets glycogen synthase kinase-3 (Beurel and Jope, 2006) and FoxO (van der Horst and Burgering, 2007). We plan to investigate further the phosphatidylinositol-3-kinase/AKT axis and downstream effectors in our COX-2-expressing LNCaP model.
Although there is evidence in the literature for COX-2 inhibition giving rise to an enhanced TRAIL-induced apoptosis (Yamanaka et al., 2006), we were unable to see such an effect in the model used in the present study (data not shown). In support of our observations, Chen et al. (2001) showed that elevated AKT activity protected LNCaP cells from TRAIL-induced apoptosis. In our study, LNCaPCOX-2 showed increased constitutive active AKT expression versus LNCaPneo cells; however, both cell lines were resistant to TRAIL-induced apoptosis.
Another regulator of apoptosis that may participate in cancer is survivin. The expression of this member of the IAP family is well known to be controlled by Akt (Papapetropoulos et al., 2000). Survivin is expressed in most human tumors, whereas in normal differentiated tissues, it is more or less undetectable. Krajewska et al. (2003) showed that elevated IAPs were a common feature of prostate cancers including prostatic intraepithelial neoplasia, but they showed no relationship with Gleason-grade or prostatic-specific antigen levels. A report by Krysan et al. (2004a) showed that survivin levels correlated positively with COX-2 expression levels in nonsmall cell lung cancer cells, both in vitro and in vivo. The underlying mechanism was shown to be COX-2-modulated survivin ubiquitination and stabilization. A further study by the same group (Krysan et al., 2004b) showed that inhibition of survivin expression by small interfering RNA enhanced apoptosis in nonsmall cell lung cancer cells in the presence of COX-2. We now show evidence to support those findings in our prostate cancer model. The levels of survivin both at the mRNA and protein levels were shown to be significantly increased in the presence of COX-2. Moreover, we show for the first time that treatment with the selective COX-2 inhibitor celecoxib can give rise to significantly reduced survivin levels, as demonstrated by quantitative PCR analysis. In addition to these findings, we have found that treatment of newly diagnosed prostate cancer with celecoxib in the neoadjuvant (preoperative) setting was associated with reduced survivin mRNA expression (P. Sooriakumaran, P. Macanas Pirard, C. P. Smith, G. Bucca, E. Laing, R. Laing, S. Langley, and H. M. Coley, unpublished data).
NAG1 is a downstream target of p53 and has been shown to mediate induction of apoptosis in human colorectal cancer cells (Okazaki et al., 2006). As its name suggests, study of this gene is highly relevant to the setting of celecoxib treatment in prostate cancer. Despite the wild-type p53 status LNCaP cells, it seems that NAG1 was only induced in COX-2-expressing cells in the present study. We decided to examine the NAG-1 gene because work in our laboratory has implicated dysregulation of this gene as a consequence of resistance to platinum anticancer agents in head and neck cancer and also in ovarian cancer cell line models (unpublished data).
Desmin is a smooth muscle differentiation marker along with laminin and vimentin, whose transcriptional regulation is controlled by Akt (Jiang et al., 1999). Study of these markers is highly relevant to the problem of prostate cancer because they are reported to be lost or significantly decreased in hormone-induced prostate cancer (Wong and Tam, 2002). In dysplastic sites, there were clear areas of negligible or negative desmin immunostaining, particularly in poorly differentiated tumor regions. In the same study, normal control prostate lobes showed strong levels of desmin expression (Wong and Tam, 2002). Our observation of increased desmin expression in COX-2-expressing LNCaP cells, and its reversal after celecoxib treatment (at nontoxic concentrations), could point to a reversal of the dedifferentiated phenotype seen for prostate cancer.
In the precancerous setting, chronic inflammation of the prostate is considered a risk factor for prostate cancer (Lehrer et al., 2005). Sun et al. (2001) demonstrated that exogenous prostatic-specific antigen itself is able to induce reactive oxygen species (ROS) in PC-3 and DU145 cell lines. Furthermore, a prooxidant state as a result of imbalance in the favor of ROS versus antioxidant processes has been reported for both the precancerous pathology described as high-grade prostatic intraepithelial neoplasia and prostate cancer (Nelson et al., 2002). These findings provide a rationale for using COX-2 inhibitors in the chemoprevention of prostate cancer. The GST group of enzymes forms a significant component of cellular antioxidant defense mechanisms. In the case of prostate cancer, it is the GSTpi form that has particular relevance. Human prostate cancer is characterized by an early and profoundly reduced level of GSTpi. The build-up of ROS due to inflammatory processes associated with early stages of prostate carcinogenesis may be protected by the activity of GSTpi. Immunohistochemical studies have shown that areas of proliferative inflammatory atrophy, associated with chronic inflammatory prostatic disease, also show increased levels of Bcl-2, COX-2, and GSTpi as well as decreased apoptosis (Zha et al., 2001; Nelson et al., 2002). Conversely a decrease, or even absence of GSTpi due to promoter methylation, is often seen in prostate cancer (Crocitto et al., 2004). In the present study, we saw extremely low levels of GSTpi mRNA in the LNCaPCOX-2 model versus LNCaPneo cells. After treatment with celecoxib, the increase in GSTpi levels in COX-2-expressing cells was highly significant. These effects point to a COX-2-dependent effect as the increments seen for LNCaPneo under similar conditions were virtually negligible. The reduction in GST in carboplatin-resistant cells is counterintuitive because it has been established for some time that increases in components of the glutathione pathway in anticancer drugs resistance (for review, see Townsend and Tew, 2003). However, one should consider anticancer drug resistance as a potentially multifactorial phenomenon. In the model, we describe that it is clear that there is a shift in the balance between apoptotic and antiapoptotic factors that seems pivotal in mediating the response to cytotoxic insult.
In conclusion, we show data that indicates a role for celecoxib as both an inducer of apoptosis and an agent that can correct inappropriate gene expression levels associated with malignant progression in human prostate cancer. We provide evidence to support the use of celecoxib in the management of prostate cancer in both the adjuvant and chemoprevention settings.
|
Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: COX, cyclooxygenase; RT, reverse transcription; PCR, polymerase chain reaction; GSTpi, glutathione S-transferase ; NAG-1, nonsteroidal anti-inflammatory drug-activated gene; IAP, inhibitor of apoptosis protein; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; ROS, reactive oxygen species.
Address correspondence to: Dr. Helen M. Coley, Postgraduate Medical School, University of Surrey, Guildford, Surrey GU2 7WG, UK. E-mail: h.coley{at}surrey.ac.uk
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Beurel E and Jope RS (2006) The paradoxical pro- and anti-apoptotic actions of GSK3 in the intrinsic and extrinsic apoptosis signalling pathways. Prog Neurobiol 79: 173–189.[CrossRef][Medline]
Chen X, Thakkar H, Tyan F, Gim S, Robinson H, Lee C, Pandey SK, Nwokorie C, Onwudiwe N, and Srivastava RK (2001) Constitutively active AKT is an important regulator of TRAIL sensitivity in prostate cancer. Oncogene 20: 6073–6083.[CrossRef][Medline]
Crocitto LE, Korns D, Kretzner L, Shevchuk T, Blair SL, Wilson TG, Ramin SA, Kawachi MH, and Smith SS (2004) Prostate cancer molecular markers GSTP1 and hTERT in expressed prostatic secretions as predictors of biopsy results. Urology 64: 821–825.[CrossRef][Medline]
Davies G, Martin LA, Sacks N, and Dowsett M (2002) Cyclooxygenase-2 (COX-2) aromatase and breast cancer: a possible role for COX-2 inhibitors in breast cancer chemoprevention. Ann Oncol 13: 669–678.
Dawson SJ, Michael M, Biagi J, Foo KF, Jefford M, Ngan SY, Leong T, Hui A, Milner AD, Thomas RJ, et al. (2007) A phase I/II trial of celecoxib with chemotherapy and radiotherapy in the treatment of patients with locally advanced oesophageal cancer. Invest New Drugs 25: 123–129.[CrossRef][Medline]
Giovannucci E and Willett WC (1994) Dietary factors and risk of colon cancer. Ann Med 26: 443–452.[Medline]
Gupta S, Srivastava M, Ahmad N, Bostwick DG, and Mukhtar H (2000) Overexpression of cyclooxygenase-2 in human prostate adenocarcinoma. Prostate 42: 73–78.[CrossRef][Medline]
Hashitani S, Urade M, Nishimura N, Maeda T, Takaoka K, Noguchi K, and Sakurai K (2003) Apoptosis induction and enhancement of cytotoxicity of anticancer drugs by celecoxib, a selective cyclooxygenase-2 inhibitor in human head and neck carcinoma cell lines. Int J Oncol 23: 665–672.[Medline]
Javle MM, Cao S, Durrani FA, Pendvala L, Lawrence DD, Smith PF, Creaven PJ, Noel DC, Iver RV, and Rustum YM (2007) Celecoxib and mucosal protection: translation from an animal model to a phase I clinical trial of celecoxib, irinotecan and 5-fluorouracil. Clin Cancer Res 13: 965–971.
Jiang BH, Aoki M, Zheng JZ, Li J, and Vogt PK (1999) Myogenic signalling of phosphatidylinositol 3-kinase requires the serine-threonine kinase Akt/protein kinase B. Proc Natl Acad Sci U S A 96: 2077–2081.
Kinoshita T, Takahashi Y, Sakashita T, Inoue H, Tanabe T, and Yoshimoto T (1999) Growth stimulation and induction of epidermal growth factor receptor by overexpression of cyclooxygenases 1 and 2 in human colon carcinoma cells. Biochim Biophys Acta 1438: 120–130.[Medline]
Koga H, Sakisaka S, Ohishi M, Kawaguchi T, Taniguchi E, Sasatomi K, Harada M, Kusaba T, Tanaka M, Kimura R, et al. (1999) Expression of cyclooxygenase-2 in human hepatocellular carcinoma: relevance to tumor dedifferentiation. Hepatology 29: 688–696.[CrossRef][Medline]
Krajewska M, Krajewski S, Banares S, Huang X, Turner B, Bubendorf L, Kallioniemi OP, Shabaik A, Vitiello A, Peehl D, et al. (2003) Elevated expression of inhibitor of apoptosis proteins in prostate cancer. Clin Cancer Res 9: 4919–4925.
Krysan K, Dalwadi H, Sharma S, Pold M, and Dubinett S (2004a) Cyclooxygenase 2-dependent expression of survivin is critical for apoptosis resistance in non-small cell lung cancer. Cancer Res 64: 6359–6362.
Krysan K, Merchant Fh, Zhu L, Dohadwala M, Luo J, Lin Y, Heuze-Vourc'h N, Pold M, Seligson D, Chia D, et al. (2004b) COX-2-dependent stabilization of survivin in non-small cell lung cancer. FASEB J 18: 206–208.
Lehrer S, Diamond EJ, Mamkine B, Droller MJ, Stone MM, and Stock RG (2005) C-reactive protein is significantly associated with prostate-specific antigen and metastatic disease in prostate cancer. BJU Int 95: 961–962.[CrossRef][Medline]
Lin J, Hsiao P-W, Chiu TH, and Chao J-I (2005) Combination of cyclooxygenase-2 inhibitors and oxaliplatin increases the growth inhibition and death in human colon cancer cells. Biochem Pharmacol 70: 658–667.[CrossRef][Medline]
Liu XH, Yao S, Kirschenbaum A, and Levine AC (1998) NS398, a selective cyclooxygenase-2 inhibitor induces apoptosis and down-regulates bcl-2 expression in LNCaP cells. Cancer Res 58: 4245–4249.
Mosmann T (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65: 55–63.[CrossRef][Medline]
Nelson WG, DeWeese TL, and deMarzo AM (2002) The diet, prostate inflammation and the development of prostate cancer. Cancer Metastasis Rev 21: 3–16.[CrossRef][Medline]
Nguyen KH (2004) NSAID use confers a survival advantage for prostate cancer patients treated with radiation therapy. Int J Radiat Oncol Biol Phys 2182: S445–S446.
Okazaki R, Moon Y, Norimura T, and Eling T (2006) Ionizing Radiation enhances the expression of the nonsteroidal anti-inflammatory drug activated gene (NAG1) by increasing the expression of p53 in human colon cancer cells. Radiation Res 165: 125–130.[CrossRef][Medline]
Oshima M, Dinchuk JE, Kargman SL, Oshima M, Dinchuk JE, Kargman SL, Oshima H, Hancock B, Kwong E, Trzaskos JM, et al. (1996) Suppression of intestinal polyposis in Apc
716 knockout mice by inhibition of cyclooxygenase 2 (COX-2). Cell 87: 803–809.[CrossRef][Medline]
Papapetropoulos A, Fulton D, Mahboubi K, Kalb RG, O'Connor DS, Li F, Altieri DC, and Sessa WC (2000) Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J Biol Chem 275: 9102–9105.
Patel MI, Subbaramaiah K, Du B, Chang M, Yang P, Newman RA, Cordon-Cardo C, Thaler HT, and Dannenberg AJ (2005) Celecoxib inhibits prostate cancer growth: evidence of a cyclooxygenase-2 independent mechanism. Clin Cancer Res 11: 1999–2007.
Schreinemachers DM and Everson RB (1994) Aspirin use and lung, colon and breast cancer incidence in a prospective study. Epidemiology 5: 138–146.[Medline]
Soriano AF, Helfrich B, Chan DC, Heasley LE, Bunn PA, and Chou TC (1999) Synergistic effects of new chemotherapeutic agents and conventional cytotoxic agents against human lung cancer cell lines. Cancer Res 59: 6178–6184.
Soslow R, Dannenburg AJ, Rush D, Woerner BM, Khan KN, Masferrer J, and Koki AT (2000) COX-2 is expressed in human pulmonary, colonic and mammary tumors. Cancer 89: 2637–2645.[CrossRef][Medline]
Sun XY, Donald SP, and Phang JM (2001) Testosterone and prostate specific antigen stimulate generation of reactive oxygen species in prostate cancer cells. Carcinogenesis 22: 1775–1780.
Tanji N, Kikugawa T, and Yokoyama M (2000) Immunohistochemical study of cyclooxygenases in prostatic adenocarcinoma; relationship to apoptosis and Bcl-2 protein expression. Antiicancer Res 20: 2313–2319.
Townsend DM and Tew KD (2003) The role of glutathione-S-transferase in anticancer drug resistance. Oncogene 22: 7369–7375.[CrossRef][Medline]
Tsujii M and DuBois RN (1995) Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell 83: 493–501.[CrossRef][Medline]
Tucker ON, Dannenburg AJ, Yang EK, Zhang F, Teng L, Daly JM, Sosolow RA, Masferrer JL, Woerner BM, Koki AT, et al. (1999) Cyclooxygenase-2 expression is up-regulated in human pancreatic cancer. Cancer Res 59: 987–990.
van der Horst A and Burgering BM (2007) Stressing the role of FoxO proteins in lifespan and disease. Nat Rev Mol Cell Biol 8: 440–450.[CrossRef][Medline]
Wang W, Bergh A, and Damber JE (2005) Cyclooxygenase-2 expression correlates with local chronic inflammation and tumor neovascularization in human prostate. Clin Cancer Res 11: 3250–3256.
Wong YC and Tam NNC (2002) Dedifferentiation of stromal smooth muscle as a factor in prostate carcinogenesis. Dedifferentiation 70: 633–645.[CrossRef]
Yamanaka Y, Shiraki K, Inoue T, Miyashita K, Fuke H, Yamaguchi Y, Yamamoto N, Ito K, Sugimoto K, and Nakano T (2006) COX-2 inhibitors sensitize human hepatocellular carcinoma cells to TRAIL-induced apoptosis. Int J Mol Med 18: 41–47.[Medline]
Yoshimura R, Sano H, Masuda C, Kawamura M, Tsubouchi Y, Chargui J, Yoshimura N, Hla T, and Wada S (2000) Expression of cyclooxygenase-2 in prostate carcinoma. Cancer 89: 589–596.[CrossRef][Medline]
Zha S, Gage WR, Sauvagoet J, Sria EA, Putzi MJ, Ewing CM, Faith DA, Nelson WG, de Marzo AM, and Isaacs WB (2001) Cyclooxygenase-2 is up-regulated in proliferative inflammatory atrophy of the prostate but not in prostate carcinoma. Cancer Res 61: 8617–8623.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
