JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
QUICK SEARCH:   [advanced]


     

Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on August 17, 2007; DOI: 10.1124/jpet.107.127894

0022-3565/07/3232-684-691$20.00
JPET 323:684-691, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.107.127894v1
323/2/684    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Botta, P.
Right arrow Articles by Valenzuela, C. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Botta, P.
Right arrow Articles by Valenzuela, C. F.

NEUROPHARMACOLOGY

Ethanol Sensitivity of GABAergic Currents in Cerebellar Granule Neurons Is Not Increased by a Single Amino Acid Change (R100Q) in the {alpha}6 GABAA Receptor Subunit

Paolo Botta, Manuel Mameli1, Kirsten L. Floyd, Richard A. Radcliffe, and C. Fernando Valenzuela

Department of Neurosciences, University of New Mexico Health Sciences Center Albuquerque, New Mexico (P.B., M.M., C.F.V.); Department of Pharmacology, University of Colorado Health Sciences Center, Aurora, Colorado (K.L.F.); Department of Pharmaceutical Sciences, University of Colorado at Denver and Health Sciences Center, Denver, Colorado (R.A.R); and Institute for Behavioral Genetics, University of Colorado, Boulder, Colorado (R.A.R.)

Received June 27, 2007; accepted August 16, 2007.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Cerebellar granule neurons (CGNs) extrasynaptically express GABAA receptors containing {alpha}6betax{delta} subunits, which mediate tonic inhibitory currents. Although it has been shown that the function of these receptors is potently and directly enhanced by ethanol, this finding has not been reproducible across different laboratories. In outbred Sprague-Dawley rats, a naturally occurring arginine (R) to glutamine (Q) mutation in position 100 of the {alpha}6 subunit was reported to increase the ethanol sensitivity of these receptors. However, we did not detect an action of this mutation in selectively bred rats (alcohol-tolerant and alcohol-nontolerant). Consequently, we reexamined the effect of the mutation on ethanol sensitivity in Sprague-Dawley rats. Using patch-clamp electrophysiological techniques in cerebellar vermis parasagittal slices, we found that 25 mM ethanol increases the tonic current amplitude, tonic current noise, and spontaneous inhibitory postsynaptic current (sIPSC) frequency to a similar extent in {alpha}6-100R/100R and {alpha}6-100Q/100Q CGNs. Exposure to 80 mM ethanol increased the tonic current amplitude to a significantly greater extent in {alpha}6-100R/100R than in {alpha}6-100Q/100Q CGNs; however, the effects of 80 mM ethanol on the tonic current noise and sIPSC frequency were not significantly different between these groups. In the presence of tetrodo-toxin, a non-N-methyl-D-aspartate receptor antagonist, exogenous GABA, and a GABA transporter inhibitor, neither 8 nor 40 mM ethanol consistently affected tonic current amplitude or noise in {alpha}6-100R/100R or {alpha}6-100Q/100Q CGNs. Thus, the {alpha}6-R100Q GABAA receptor subunit polymorphism does not in-crease the acute ethanol sensitivity of extrasynaptic receptors, lending further support to the hypothesis that ethanol modulates these currents indirectly via a presynaptic mechanism.

Studies indicate that ethanol enhances GABAergic transmission in several brain regions via presynaptic and postsynaptic mechanisms (reviewed in Siggins et al., 2005Go; Breese et al., 2006Go; Weiner and Valenzuela, 2006Go). Recently, ethanol has also been shown to enhance the function of {delta} subunit-containing extrasynaptic GABAA receptors (GABAA-Rs). Sundstrom-Poromaa et al. (2002Go) reported that 1 to 3 mM ethanol increases currents mediated by recombinant {alpha}4beta2{delta} GABAA-Rs in Xenopus oocytes and native {alpha}4betax{delta} GABAA-Rs in acutely dissociated CA1 hippocampal neurons from a rat model of premenstrual syndrome. Subsequently, ethanol was shown to potentiate Xenopus oocyte-expressed {alpha}4beta3{delta} and {alpha}6beta3{delta} recombinant receptors at concentrations ≥3mMand the imidazobenzodiazepine Ro 15-4513 competitively blocked this effect (Wallner et al., 2003Go, 2006Go; Hanchar et al., 2006Go; Olsen et al., 2007Go). Tonic currents mediated by {alpha}4betax{delta} GABAA-Rs in dentate gyrus granule cells and ventrobasal thalamic neurons were shown to be significantly potentiated by ethanol (≥30 mM) in a protein kinase C{delta}-dependent manner (Wei et al., 2004Go; Liang et al., 2006Go; Fleming et al., 2007Go; Jia et al., 2007Go; Messing et al., 2007Go; Mody et al., 2007Go). Glykys et al. (2007Go) reported that ethanol (≥20 mM) enhances {alpha}1betax{delta} GABAA-R-dependent currents in hippocampal molecular layer interneurons. Hanchar et al. (2005Go) demonstrated that a single amino acid change (R100Q) in the {alpha}6 subunit enhances the potentiating effect of ethanol on currents mediated by recombinant {alpha}6beta3{delta} but not {alpha}6beta2{delta} receptors. Extrasynaptic receptors containing {alpha}6betax{delta} subunits are selectively expressed in cerebellar granule neurons (CGNs). Hanchar et al. (2005Go) found that 10 mM ethanol directly potentiates these receptors in slices from Sprague-Dawley rats homozygous for {alpha}6-100Q, which also display higher sensitivity to ethanol-induced motor impairment.

Although these results suggest that extrasynaptic GABAA-Rs are targets of ethanol, the findings of several studies are inconsistent with this notion. Mehta et al. (2007Go) and Korpi et al. (2007Go) did not detect effects of ethanol on [3H]Ro 15-4513 binding to {delta} subunit-containing GABAA-Rs. Borghese et al. (2006Go) found that {alpha}4beta3{delta} GABAA-Rs expressed in either Xenopus oocytes or fibroblasts are minimally affected by subanesthetic concentrations of ethanol and that 30 mM ethanol does not affect tonic GABAergic currents in dentate gyrus granule cells (reviewed in Borghese and Harris, 2007Go). Lack of a direct effect of acute ethanol (50–100 mM) exposure on tonic GABAergic currents in dentate gyrus granule cells was also recently reported by another group (Talani et al., 2007Go). Yamashita et al. (2006Go) found that ethanol (10, 30, and 100 mM) had either no effect or an inhibitory effect on currents mediated by {alpha}4beta3{delta}, {alpha}6beta2{delta}, or {alpha}6beta3{delta} GABAA-R subunits expressed in Chinese hamster ovary cells. Similarly, an inconsistent effect of ethanol (30 mM) on steady-state currents induced by continuous application of low GABA concentrations was observed in cultured CGNs. Casagrande et al. (2007Go) did not detect a significant effect of 10 and 30 mM ethanol on currents evoked by low GABA concentrations in cultured CGNs. Carta et al. (2004Go) found that ethanol (≥20 mM) (see Carta et al. for ethanol dose-response data) increases both the frequency of spontaneous inhibitory postsynaptic currents (sIPSCs) and tonic current noise and that this effect was not observed when spontaneous action potentials were blocked with tetrodotoxin (TTX). Ethanol also increased the frequency of spontaneous action potentials in Golgi cells, suggesting that it enhances phasic and tonic GABAergic transmission onto CGNs via an indirect presynaptic mechanism (Carta et al., 2004Go). Studies carried out with alcohol-tolerant (AT) (homozygous for {alpha}6-100R) and alcohol-nontolerant (ANT) (homozygous for {alpha}6-100Q) rats suggest that the {alpha}6 GABAA-R subunit polymorphism does not contribute to ethanol-induced ataxia (Radcliffe et al., 2004Go; Botta et al., 2007Go; Korpi et al., 2007Go). Electrophysiological experiments with AT and ANT rats indicate that the {alpha}6 GABAA-R subunit polymorphism does not modulate ethanol sensitivity of phasic or tonic GABAergic currents in CGNs (Valenzuela et al., 2005Go; Botta et al., 2007Go). We conclude that, although several independent studies have shown that tonic GABAergic currents are modulated by ethanol, it is still uncertain if this is a consequence of direct potentiation of {delta} subunit-containing extrasynaptic GABAA-Rs (Lovinger and Homanics, 2007Go).

The purpose of this study was to reexamine the influence of the {alpha}6-R100Q subunit polymorphism on ethanol sensitivity of these receptors in CGNs. We hypothesized that confounding genetic factors present in AT and ANT rats and/or our choice of experimental conditions prevented us from detecting an effect of this polymorphism (Otis et al., 2005Go; Valenzuela et al., 2005Go). We tested this hypothesis using similar ethanol concentrations and experimental conditions to those used by Hanchar et al. (2005Go).


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Genotyping. Male Sprague-Dawley rats (22–23 days old) were obtained from Charles River Laboratories (area H-41; Hollister CA). The rats were housed at the University of New Mexico Health Sciences Center Animal Resource Facility. All animal procedures were approved by the University of New Mexico Health Sciences Center Institutional Animal Care and Use Committee. Ear punch samples (1–2 mm in diameter) were obtained and shipped frozen to the University of Colorado Health Sciences Center for {alpha}6 subunit single nucleotide polymorphism genotyping, which was accomplished using the Amplification Refractory Mutation System method as detailed in Saba et al. (2001Go). Briefly, ear punch samples were incubated in digestion buffer (10 mM NaOH and 0.1 mM EDTA) at 95°C for 10 min. DNA was quantified by spectrophotometry and diluted with H2O accordingly. Two PCR amplifications were performed on each sample using standard reagents and cycling conditions (12 min at 95°C; 30 cycles: 30 s at 94°C, 30 s at 55°C, 60 s at 72°C; and 7 min at 72°C). One reaction contained a forward primer that was complementary to the sequence of the 3' to 5' DNA strand for {alpha}6-100R (TAAGATCTGGACTCCGGACACATTTTTGCG) and the second reaction contained a forward primer complementary to the sequence of the 3' to 5' DNA strand for {alpha}6-100Q (TAAGATCTGGACTCCGGACACATTTTTGCA); the {alpha}6 single nucleotide polymorphism is at the last position of the primer (note that the last base of the R (CGA) and Q codons (CAA) is not part of the forward primer sequence). A common reverse primer was included in each reaction to yield a product of 118 base pairs (CATGGTGTACAGGATCGTTC). Both reactions also contained a control primer pair to verify that the amplification was successful (forward: TTCTCCCCTGGCTCTTCAG; reverse: AGTTCCCTTCATCTTCAAGTTGAG; product = 268 base pairs). The method relies on the tolerance of Taq polymerase for a single mismatch placed at the third position from the 3' end of the forward primer sequence (C has been replaced with G), but not two mismatches as would be the case, for example, when the 100R primer hybridizes to 100Q template. Thus, amplification takes place only in the presence of a matching combination of forward primer and template. PCR products were analyzed with a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA), which uses a microfluidics based method of electrophoresis. An example of a virtual gel image is shown in Fig. 1, where subjects 15, 6, and 7 are heterozygous (100R/100Q), subject 16 is homozygous for glutamine (100Q/100Q), and subject 8 is homozygous for arginine (100R/100R). Genotyping was performed in a total of 56 rats, and these were found to follow an expected 25:50:25 Mendelian distribution ({chi}2, p > 0.8): G/G (100R/100R; n = 14), 25%; G/A (100R/100Q; n = 30), 54%; and A/A (100Q/100Q; n = 12), 21%, in agreement with the report of Hanchar et al. (2005Go).


Figure 1
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 1. Representative results of a genotyping assay for the {alpha}6-R100Q polymorphism. Shown are bands corresponding to PCR products (118 base pairs) obtained with a forward primer that was complementary to the {alpha}6-100R genotype (first reaction) and the {alpha}6-100Q genotype (second reaction) for five different Sprague-Dawley rats. Both reactions also contained a control primer pair to verify that the amplification was successful (product = 268 base pairs). Subjects 15, 6, and 7 are heterozygous ({alpha}6-100R/100Q), subject 16 is homozygous for glutamine ({alpha}6-100Q/100Q) and subject 8 is homozygous for arginine ({alpha}6-100R/100R). PCR products were analyzed with a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA) which uses a microfluidics-based method of electrophoresis.

 
Electrophysiology. Unless indicated, all chemicals were from Sigma-RBI-Fluka (St. Louis, MO). Experiments were performed in parasagittal vermis cerebellar slices that were prepared from the genotyped rats (homozygous only) when they were 27 to 38 days old. Animals were euthanized by rapid decapitation under deep anesthesia with ketamine (250 mg/kg i.p.) and 200- to 250-µm-thick slices were prepared with a Vibratome. Slices were cut in cold solution containing 220 mM sucrose, 26 mM NaHCO3, 10 mM glucose, 6 mM MgSO4, 3 mM KCl, 1.25 mM NaH2PO4, 0.2 mM CaCl2, and 0.43 mM ketamine. This solution was preequilibrated with 95% O2 plus 5% CO2. Immediately after the slicing procedure, slices were transferred to a chamber containing artificial cerebrospinal fluid (ACSF) and allowed to recover at 36°C for 45 min, followed by storage at room temperature in the same ACSF (Aitken et al., 1995Go). ACSF contained 126 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 1 mM MgSO4, 26mM NaHCO3, 2 mM CaCl2, and 10 mM glucose equilibrated with 95% O2 plus 5% CO2. After a total recovery time ≥80 min, slices were transferred to a chamber perfused with ACSF at a rate of 2 to 3 ml/min. Whole-cell patch-clamp electrophysiological recordings from CGNs were performed under infrared-differential interference contrast microscopy with Axopatch 200B or Multiclamp 700B amplifiers (Molecular Devices, Sunnyvale, CA). Patch pipettes had resistances of 4 to 6 M{Omega}. Similarly to the conditions of Hanchar et al. (2005Go), recordings were obtained in ACSF at 23°C with an internal solution containing 140 mM CsCl, 10 mM HEPES (pH 7.3), 1 mM EGTA, 4 mM magnesium ATP, 0.4 mM GTP, and 4 mM QX-314 (Tocris-Cookson, Ellisville, MO) at a holding membrane potential of –70 mV. When indicated, TTX, bicuculline methiodide, GABA, NO-711, 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX) (Axxora Life Sciences, Inc., San Diego, CA), and ethanol (190 proof, spectrophotometric grade, Sigma Chemical, St. Louis, MO) were added to the ACSF. CGNs were identified on the basis of their location in the granule layer and their small size (capacitance <5 pF). Access resistance was between 20 and 40 M{Omega}, and we did not compensate for this; if access resistance changed more than 25%, the recording was discarded.

Data Analysis. Data were acquired and analyzed with pClamp 8 or 9 (Molecular Devices, Sunnyvale, CA); sIPSCs were analyzed with the Mini Analysis program (Synaptosoft, Decatur, GA). The tonic current was calculated by fitting a Gaussian distribution to all-point histograms, constraining the values to 2 bins more negative than the peak to limit the influence of sIPSCs on the fit (Hanchar et al., 2005Go). Tonic current amplitude was defined as the mean steady-state current recorded in the absence minus that recorded in the presence of 20 µM of the GABAA-R antagonist bicuculline. The tonic current noise was defined as the S.D. of the steady-state current recorded in the absence minus that recorded in the presence of bicuculline. The effect of ethanol was calculated with respect to the average of control and washout responses. The Kolmogorov-Smirnov test was used initially to test for significant differences between treatments on sIPSCs in individual cells. Pooled data were statistically analyzed with Prism 4 (GraphPad Software, Inc., San Diego, CA). Data are presented as means ± S.E.M.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
We recorded GABAergic currents from cerebellar granule neurons in ACSF at 23°C and –70 mV using the internal solution described by Hanchar et al. (2005Go). Under these conditions, we detected phasic sIPSCs that were superimposed on the well characterized tonic current that is present in these neurons (Fig. 2, A and B) (Kaneda et al., 1995Go; Tia et al., 1996Go; Rossi and Hamann, 1998Go; Hamann et al., 2002Go). Both the sIPSCs and the tonic current were antagonized by bicuculline, confirming that these currents were mediated by GABAA-Rs. Although there was a trend toward an increase in basal tonic current amplitude in CGNs from {alpha}6-100Q/100Q rats (Fig. 2, A and B; Table 1), the magnitudes of the tonic current amplitude and noise were not significantly different in CGNs from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats (Table 1). Acute application of either a subanesthetic (25 mM; the legal intoxication limit in the United States is 17.4 mM = 0.08 g/dl) or a hypnotic (80 mM = 0.37 g/dl) concentration of ethanol for 5 min increased the tonic current amplitude and noise in a reversible and concentration-dependent manner (Fig. 2; compare with Fig. 3 in Hanchar et al., 2005Go). The acute effect of 25 mM was not significantly different in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats (p > 0.05 by two-way ANOVA followed by a Bonferroni post hoc test). We did detect a statistically significant difference in sensitivity to 80 mM (p < 0.05 by two-way ANOVA followed by a Bonferroni post hoc test). This concentration increased tonic current amplitude to a greater extent in slices from {alpha}6-100R/100R than {alpha}6-100Q/100Q rats (Fig. 2C). The ethanol-induced increase of tonic current noise was not significantly different in slices from {alpha}6-100R/100R versus {alpha}6-100Q/100Q rats at any of the concentrations tested (Fig. 2D).


Figure 2
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 2. Comparison of the effect of ethanol on CGN tonic currents in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q Sprague-Dawley rats. A, sample traces of tonic GABAergic currents recorded from {alpha}6-100R/100R CGNs in the absence and presence of the indicated ethanol (EtOH) concentrations followed by bicuculline (BIC; 20 µM). Shown on the left are Gaussian distribution fits. B, same as in A but for {alpha}6-100Q/100Q CGNs. C, summary of the percent change induced by the indicated concentrations of ethanol on tonic current amplitude. D, same as in C but for tonic current noise. Number of determinations is given above or inside the bars. Bars represent the mean ± S.E.M. *, p < 0.05 by two-way ANOVA followed by a Bonferroni post hoc test.

 

View this table:
[in this window]
[in a new window]

  		TABLE 1 Basal electrophysiological parameters for CGN phasic and tonic GABAergic currents in slices from {alpha} 6-100R/100R and {alpha} 6-100Q/100Q Sprague-Dawley rats

Number of determinations is given in parentheses. Statistical analyses were performed by a two-tailed unpaired t test.

 

We next analyzed the effect of ethanol on phasic GABAergic currents in these neurons. Basal sIPSC frequency was significantly lower in CGNs from {alpha}6-100R/100R than {alpha}6-100Q/100Q rats (Table 1). Basal sIPSC amplitude and decay time (defined as the time to decay from 90 to 37% of the peak) were not significantly different in CGNs from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats (but see Santhakumar et al., 2006Go, who reported that sIPSCs in CGNs from {alpha}6-100Q/100Q rats have prolonged decay rates with respect to those from {alpha}6-100R/100R rats). Ethanol induced a dose-dependent and reversible increase in sIPSC frequency without consistently affecting amplitude or decay (Fig. 3). These effects were similar in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats (compare with Fig. 3 in Hanchar et al., 2005Go). Ethanol (25 mM) induced a significant (p < 0.01 by the Kolmogorov-Smirnov test) leftward shift in the interevent interval cumulative probability distributions in 6 of 13 and 5 of 13 granule cells from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats, respectively. Ethanol (25 mM) induced a significant shift in the amplitude cumulative probability distributions in 2 of 7 and 2 of 8 granule cells from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats, respectively. Ethanol (80 mM) induced a significant leftward shift in the interevent interval cumulative probability distributions in 10 of 17 and 10 of 13 granule cells from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats, respectively. Ethanol (80 mM) induced a significant shift in the amplitude cumulative probability distributions in 4 of 9 and 3 of 9 granule cells from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats, respectively. Pooled data are shown in Fig. 3, C and D, where it is evident that the time course of the effect of ethanol on sIPSC frequency is similar in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats. Figure 3, E through F, shows that ethanol did not differentially affect sIPSC amplitude or decay in slices from {alpha}6-100R/100R versus {alpha}6-100Q/100Q rats. Figure 4 shows that there was no correlation between the baseline levels of tonic current amplitude and sIPSC frequency and the effect of ethanol on these parameters in {alpha}6-100R/100R and {alpha}6-100Q/100Q CGNs (for average values, see Table 1).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 3. Effect of ethanol on CGN sIPSCs in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q Sprague-Dawley rats. A, shown in the left panels are sample traces illustrating the effect of 80 mM ethanol on sIPSC frequency in CGNs from {alpha}6-100R/100R rats. Note the expanded time scale with respect to that of the traces shown in Fig. 2. B, same as in A but for {alpha}6-100Q/100Q rats. The right panels show the corresponding cumulative probability plots for interevent interval and average sIPSC traces. Note that the control (——) and ethanol (– – –) superimposed traces are virtually indistinguishable. Note that the sIPSC decay is faster in the {alpha}6-100R/100R and {alpha}6-100Q/100Q in these two particular examples; however, on average, this parameter was not significantly different between the groups (Table 1). C, time course of the effect of 25 mM on CGN sIPSC frequency; n = 13 for {alpha}6-100R/100R and n = 13 for {alpha}6-100Q/100Q rats. D, time course of the effect of 80 mM on CGN sIPSC frequency; n = 15 for {alpha}6-100R/100R and n = 13 for {alpha}6-100Q/100Q. E, ethanol did not consistently affect sIPSC amplitude. F, ethanol did not significantly affect sIPSC decay time (from 90 to 37% of peak). Number of determinations is given above or inside the bars. Bars represent the mean ± S.E.M.

 

Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 4. Lack of correlation between baseline levels of tonic current amplitude and sIPSC frequency and the effect of ethanol on these parameters. Shown are scatter plots of baseline tonic current amplitude versus 80 mM ethanol-induced percent change in this parameter in CGNs from (A) {alpha}6-100R/100R (slope = 1.93 ± 2.9; r2 = 0.03) and (B) {alpha}6-100Q/100Q (slope = 0.79 ± 0.58; r2 = 0.14) Sprague-Dawley rats. Also shown are scatter plots of basal sIPSC frequency versus 80 mM ethanol-induced percent change in this parameter in CGNs from (C) {alpha}6-100R/100R (slope = 96.5 ± 146; r2 = 0.03) and (D) {alpha}6-100Q/100Q (slope =–49 ± 51; r2 = 0.07) Sprague-Dawley rats. In all cases, the slopes were not significantly different from 0 (p = 0.2–0.5).

 

Finally, we investigated whether ethanol affects extrasynaptic receptors directly (Fig. 5). We used the same conditions reported by Hanchar et al. (2005Go); i.e., the effect of ethanol was assessed in the continuous presence of TTX (0.5 µM), the non-NMDA receptor antagonist NBQX (2 µM), the GABA transporter inhibitor NO-711 (10 µM), and exogenous GABA (300 nM). In the presence of these agents, the tonic current amplitude increased by 92 ± 19%, (n = 5) and 85 ± 18% (n = 4) in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats, respectively. The tonic current noise increased by 64 ± 13% (n = 5) and 56 ± 7% (n = 4) in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q rats, respectively. Under these conditions, neither 8 nor 40 mM ethanol induced consistent changes in tonic current amplitude or noise in slices from either {alpha}6-100R/100R or {alpha}6-100Q/100Q rats (Fig. 5; compare with Fig. 4 in Hanchar et al., 2005Go). The effects of ethanol on mIPSCs could not be assessed as these events were not discernible from the tonic current noise background.


Figure 5
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 5. Lack of a direct effect of ethanol on CGN tonic currents in slices from {alpha}6-100R/100R and {alpha}6-100Q/100Q Sprague-Dawley rats. A, sample traces of tonic GABAergic currents recorded from {alpha}6-100R/100R CGNs in the absence and presence of TTX (0.5 µM), NBQX (2 µM), NO-711 (10 µM), and GABA (300 nM). In the presence of these agents, ethanol (EtOH; 8 mM) did not affect the tonic current. Bicuculline (BIC; 20 µM) blocked the tonic current. Shown on the left of the traces are Gaussian distribution fits. B, same as in A but for {alpha}6-100Q/100Q CGNs. C, summary of the percent change induced by the indicated concentrations of ethanol on tonic current amplitude. D, same as in C but for tonic current noise. Number of determinations is given above the bars. Bars represent the mean ± S.E.M.

 


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
{alpha}6 GABAA Receptor Subunit Polymorphism Does Not Increase Ethanol Sensitivity of Tonic Currents. Under our experimental conditions, CGN tonic currents in slices from Sprague-Dawley rats homozygous for {alpha}6-100Q did not display higher sensitivity to ethanol than those homozygous for {alpha}6-100R. Although we found that a subanesthetic concentration of ethanol (25 mM) produces an increase in tonic current amplitude similar to that reported by Hanchar et al. (2005Go) for 30 mM ethanol in {alpha}6-100R/100R rats, this effect was not significantly different from that observed in {alpha}6-100Q/100Q rats. In {alpha}6-100R/100R rats, a hypnotic concentration of ethanol (80 mM) produced greater potentiation of tonic currents than that observed by Hanchar et al. (2005Go) but, in contrast to the results of that study, we actually detected a significantly greater effect on tonic current amplitude in {alpha}6-100R/100R than in {alpha}6-100Q/100Q rats. This finding suggests that the sensitivity of CGN tonic GABAergic current amplitude to hypnotic ethanol concentrations is reduced by the {alpha}6-R100Q substitution; however, it should be kept in mind that the substitution did not have a significant effect on tonic current noise.

Several methodological factors that could have potentially accounted for the discrepancies between our findings and those of Hanchar et al. (2005Go) can be ruled out. First, both studies used Sprague-Dawley rats from the same colony and age range and used similar slice preparation and recording conditions. There were only a few differences between our experimental procedures and those used in that study. We used ketamine to anesthetize the rats and also added this agent to the cutting solution to decrease NMDA receptor-mediated excitotoxicity. We stored the slices in ketamine-free ACSF. Hanchar et al. (2005Go) used the inhalational anesthetic halothane and their slice cutting and storage solutions contained the NMDA receptor antagonist, DL-amino-5-phosphonovaleric acid. Although we recently determined that these technical differences do not significantly modify sensitivity of CGN tonic currents to ethanol (Botta et al., 2007Go), it is uncertain whether these can influence the impact of the {alpha}6-R100Q mutation on ethanol sensitivity. Second, we used the same procedure to analyze the data (i.e., fitting a Gaussian distribution to all-point histograms). Finally, the basal properties of tonic currents were not dramatically different between the two studies. Hanchar et al. (2005Go) reported that the mean tonic current under control conditions was approximately –10 pA and that it did not differ significantly between the genotypes. Under our recording conditions, the mean basal tonic current amplitudes were –15 and –21 pA for the {alpha}6-100R/100R and {alpha}6-100Q/100Q Sprague-Dawley rats, respectively, and these were not significantly different between the genotypes. Thus, differences in experimental procedures, quality of the recordings, and data analysis methodology are unlikely to explain the disagreement between our findings. It should be noted, however, that both male and female rats appear to have been used for electrophysiological experiments by Hanchar et al. (2005Go), whereas we used only male rats. Therefore, we cannot eliminate the possibility that gender modulates the ethanol sensitivity of CGN tonic currents in {alpha}6-100Q/100Q and {alpha}6-100R/100R Sprague-Dawley rats.

{alpha}6 GABAA-R Subunit Polymorphism Does Not Affect Ethanol Sensitivity of sIPSCs. We previously reported that ethanol increases the frequency but not the amplitude or decay time of sIPSCs in CGNs (see Carta et al., 2004Go for ethanol dose-response data). Hanchar et al. (2005Go) reproduced these results and also reported that the {alpha}6-R100Q mutation approximately doubles the magnitude of the ethanol-induced increase of sIPSC frequency. In our hands, the mutation did not alter sIPSC sensitivity to ethanol; 25 mM increased sIPSC frequency by 1.5- to 2-fold and 80 mM by 2- to 3-fold, both in {alpha}6-100Q/100Q and {alpha}6-100R/100R Sprague-Dawley rats. These values are similar to those reported by Hanchar et al. (2005Go) for {alpha}6-100R/100R Sprague-Dawley rats and are in general agreement with those reported by Carta et al. (2004Go). Basal sIPSC frequency, amplitude, and decay time reported here are similar to those observed by Hanchar et al. (2005Go) and other investigators (Tia et al., 1996Go; Wall and Usowicz, 1997Go; Brickley et al., 2001Go). Thus, differences in the basal characteristics of sIPSCs recorded from CGNs in the two studies are unlikely to be responsible for the discrepancies between the findings of Hanchar et al. (2005Go) and those of the present study, particularly considering that basal sIPSC frequency is not correlated with the effect of ethanol on this parameter (Fig. 4). The choice of anesthetic, cutting solution, or incubation solution might not be a factor either as it did not significantly affect the action of ethanol on sIPSC frequency (Botta et al., 2007Go).

Ethanol Does Not Directly Affect Tonic Currents in CGNs. We previously reported that the effects of 50 and 100 mM ethanol on CGN tonic current amplitude and noise were abolished by TTX, suggesting that ethanol acted indirectly via an increase in spillover of GABA released in an action potential-dependent manner (Carta et al., 2004Go). Hanchar et al. (2005Go) reported that ethanol (10 mM) increased the CGN tonic current in the presence of TTX and that this effect was significantly greater in slices from {alpha}6-100Q/100Q than from {alpha}6-100R/100R Sprague-Dawley rats. However, the experimental conditions used by Hanchar et al. (2005Go) were different from those used by Carta et al. (2004Go). Specifically, Hanchar et al. (2005Go) not only exposed the CGNs to TTX but also to exogenous GABA, a GABA transporter inhibitor, and NBQX, which increased tonic current amplitude by approximately 2- to 3-fold. Although we found a similar increase in the tonic current in the presence of these agents, we did not detect an effect of ethanol in slices from either {alpha}6-100Q/100Q or {alpha}6-100R/100R Sprague-Dawley rats. These findings support our original conclusion that ethanol does not directly modulate {alpha}6betax{delta} GABAA-Rs expressed in CGNs (Carta et al., 2004Go). It is not entirely surprising that these receptors are insensitive to low ethanol concentrations, given that they probably contain the beta2 subunit (reviewed in Wisden et al., 1996Go) and {alpha}6beta2{delta} recombinant receptors display little sensitivity to subanesthetic ethanol concentrations (Wallner et al., 2003Go; Hanchar et al., 2005Go; Yamashita et al., 2006Go). Moreover, the {alpha}6-R100Q mutation does not have an impact on ethanol sensitivity in receptors containing {alpha}6beta2{delta} subunits (Hanchar et al., 2005Go).

In conclusion, the results of the present study, taken together with results from studies performed with AT and ANT rats (reviewed in Botta et al., 2007Go; Korpi et al., 2007Go) do not support the hypothesis that the R100Q mutation in the {alpha}6 GABAA-R subunit increases ethanol sensitivity of tonic GABAergic currents. Our results with outbred Sprague-Dawley rats do not agree with the argument that confounding genetic differences probably arose during selective breeding of the AT and ANT rats and that these could mask an effect of the {alpha}6 subunit polymorphism on ethanol sensitivity of extrasynaptic GABAA-Rs in CGNs (Otis et al., 2005Go; Santhakumar et al., 2007Go). The differences in alcohol-induced motor impairment that were observed between {alpha}6-100Q/100Q and {alpha}6-100R/100R Sprague-Dawley rats are unlikely to be a consequence of this single amino acid substitution. Moreover, our results are in line with those obtained with recombinant and native receptors expressed in cultured cells, indicating that GABAA-Rs containing {alpha}6betax{delta} subunits do not display high sensitivity to ethanol (Yamashita et al., 2006Go; Casagrande et al., 2007Go). Our overall conclusion is that extrasynaptic GABAA-Rs expressed in CGNs are not directly modulated by acute ethanol exposure under our experimental conditions. Although we cannot eliminate the possibility that different methodological approaches are required to observe a direct effect of ethanol on CGN extrasynaptic GABAA-Rs, the results presented here do support the hypothesis that these receptors are, at least in part, indirectly modulated via a presynaptic action of ethanol on Golgi cell excitability (Carta et al., 2004Go; Botta et al., 2007Go). We are currently characterizing the mechanism by which ethanol produces this effect.


   Acknowledgements
 
We thank L. Donald Partridge and Mario Carta for critically reading the manuscript.


   Footnotes
 
This work was supported by National Institutes of Health Grant AA14973.

P.B. and M.M. contributed equally to this work.

Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.107.127894.

ABBREVIATIONS: GABAA-R, type-A {gamma}-aminobutyric acid receptor; CGN, cerebellar granule neuron; Ro 15–4513, ethyl 8-azido-6-dihydro-5-methyl-6-oxo-4H-imidazo[1,5-{alpha}]-[1,4]benzodiazepine-3-carboxylate; IPSC, inhibitory postsynaptic current; sIPSC, spontaneous IPSC; TTX, tetrodotoxin; AT, alcohol-tolerant; ANT, alcohol-nontolerant; ACSF, artificial cerebrospinal fluid; NO-711, 1-(2-(((diphenylmethylene)amino)oxy) ethyl)-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid; ANOVA, analysis of variance.

1 Current affiliation: Department of Basic Neurosciences, University of Geneva, Geneva, Switzerland. Back

Address correspondence to: Dr. C. Fernando Valenzuela, Department of Neurosciences, MSC08 4740, 1 University of New Mexico, Albuquerque, NM 87131-0001. E-mail: fvalenzuela{at}salud.unm.edu


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Aitken PG, Breese GR, Dudek FF, Edwards F, Espanol MT, Larkman PM, Lipton P, Newman GC, Nowak TS Jr, Panizzon KL, et al. (1995) Preparative methods for brain slices: a discussion. J Neurosci Methods 59: 139–149.[CrossRef][Medline]

Borghese CM and Harris RA (2007) Studies of ethanol actions on recombinant delta-containing {gamma}-aminobutyric acid type A receptors yield contradictory results. Alcohol 41: 155–162.[CrossRef][Medline]

Borghese CM, Storustovu S, Ebert B, Herd MB, Belelli D, Lambert JJ, Marshall G, Wafford KA, and Harris RA (2006) The {delta} subunit of {gamma}-aminobutyric acid type A receptors does not confer sensitivity to low concentrations of ethanol. J Pharmacol Exp Ther 316: 1360–1368.[Abstract/Free Full Text]

Botta P, Radcliffe RA, Carta M, Mameli M, Daly E, Floyd KL, Deitrich RA, and Valenzuela CF (2007) Modulation of GABAA receptors in cerebellar granule neurons by ethanol: a review of genetic and electrophysiological studies. Alcohol 41: 187–199.[CrossRef][Medline]

Breese GR, Criswell HE, Carta M, Dodson PD, Hanchar HJ, Khisti RT, Mameli M, Ming Z, Morrow AL, Olsen RW, et al. (2006) Basis of the gabamimetic profile of ethanol. Alcohol Clin Exp Res 30: 731–744.[CrossRef][Medline]

Brickley SG, Farrant M, Swanson GT, and Cull-Candy SG (2001) CNQX increases GABA-mediated synaptic transmission in the cerebellum by an AMPA/kainate receptor-independent mechanism. Neuropharmacology 41: 730–736.[CrossRef][Medline]

Carta M, Mameli M, and Valenzuela CF (2004) Alcohol enhances GABAergic transmission to cerebellar granule cells via an increase in Golgi cell excitability. J Neurosci 24: 3746–3751.[Abstract/Free Full Text]

Casagrande S, Cupello A, Pellistri F, and Robello M (2007) Only high concentrations of ethanol affect GABAA receptors of rat cerebellum granule cells in culture. Neurosci Lett 414: 273–276.[CrossRef][Medline]

Fleming RL, Wilson WA, and Swartzwelder HS (2007) Magnitude and ethanol sensitivity of tonic GABAA receptor-mediated inhibition in dentate gyrus changes from adolescence to adulthood. J Neurophysiol 97: 3806–3811.[Abstract/Free Full Text]

Glykys J, Peng Z, Chandra D, Homanics GE, Houser CR, and Mody I (2007) A new naturally occurring GABAA receptor subunit partnership with high sensitivity to ethanol. Nat Neurosci 10: 40–48.[CrossRef][Medline]

Hamann M, Rossi DJ, and Attwell D (2002) Tonic and spillover inhibition of granule cells control information flow through cerebellar cortex. Neuron 33: 625–633.[CrossRef][Medline]

Hanchar HJ, Chutsrinopkun P, Meera P, Supavilai P, Sieghart W, Wallner M, and Olsen RW (2006) Ethanol potently and competitively inhibits binding of the alcohol antagonist Ro15-4513 to {alpha}4/6beta3{delta} GABAA receptors. Proc Natl Acad Sci USA 103: 8546–8551.[Abstract/Free Full Text]

Hanchar HJ, Dodson PD, Olsen RW, Otis TS, and Wallner M (2005) Alcohol-induced motor impairment caused by increased extrasynaptic GABAA receptor activity. Nat Neurosci 8: 339–345.[CrossRef][Medline]

Jia F, Pignataro L, and Harrison NL (2007) GABAA receptors in the thalamus: {alpha}4 subunit expression and alcohol sensitivity. Alcohol 41: 177–185.[CrossRef][Medline]

Kaneda M, Farrant M, and Cull-Candy SG (1995) Whole-cell and single-channel currents activated by GABA and glycine in granule cells of the rat cerebellum. J Physiol 485: 419–435.[Abstract/Free Full Text]

Korpi ER, Debus F, Linden AM, Malecot C, Leppa E, Vekovischeva O, Rabe H, Bohme I, Aller MI, Wisden W, et al. (2007) Does ethanol act preferentially via selected brain GABAA receptor subtypes? The current evidence is ambiguous. Alcohol 41: 163–176.[CrossRef][Medline]

Liang J, Zhang N, Cagetti E, Houser CR, Olsen RW, and Spigelman I (2006) Chronic intermittent ethanol-induced switch of ethanol actions from extrasynaptic to synaptic hippocampal GABAA receptors. J Neurosci 26: 1749–1758.[Abstract/Free Full Text]

Lovinger DM and Homanics GE (2007) Tonic for what ails us? High-affinity GABAA receptors and alcohol. Alcohol 41: 139–143.[CrossRef][Medline]

Mehta AK, Marutha Ravindran CR, and Ticku MK (2007) Low concentrations of ethanol do not affect radioligand binding to the {delta}-subunit-containing GABAA receptors in the rat brain. Brain Res 1165: 15–20[CrossRef][Medline]

Messing RO, Choi DS, Wei W, Kharazia VN, Deitchman JK, Lesscher HMB, and Mody I (2007) Protein kinase C{delta} regulates GABA-mediated tonic inhibition and motor response to ethanol. Alcohol Clin Exp Res 31 (Suppl): 296A.

Mody I, Glykys J, and Wei W (2007) A new meaning for "Gin & Tonic": tonic inhibition as the target for ethanol action in the brain. Alcohol 41: 145–153.[CrossRef][Medline]

Olsen RW, Hanchar HJ, Meera P, and Wallner M (2007) GABAA receptor subtypes: the "one glass of wine" receptors. Alcohol 41: 201–209.[CrossRef][Medline]

Otis TS, Hanchar HJ, Dodson PD, Olsen RW, and Wallner M (2005) Response to letter to the editor. Alcohol Clin Exp Res 29: 1358.[CrossRef]

Radcliffe RA, Erwin VG, Draski L, Hoffmann S, Edwards J, Deng XS, Bludeau P, Fay T, Lundquist K, Asperi W, et al. (2004) Quantitative trait loci mapping for ethanol sensitivity and neurotensin receptor density in an F2 intercross derived from inbred high and low alcohol sensitivity selectively bred rat lines. Alcohol Clin Exp Res 28: 1796–1804.[CrossRef][Medline]

Rossi DJ and Hamann M (1998) Spillover-mediated transmission at inhibitory synapses promoted by high affinity {alpha}6 subunit GABAA receptors and glomerular geometry. Neuron 20: 783–795.[CrossRef][Medline]

Saba L, Porcella A, Congeddu E, Colombo G, Peis M, Pistis M, Gessa GL, and Pani L (2001) The R100Q mutation of the GABAA {alpha}6 receptor subunit may contribute to voluntary aversion to ethanol in the sNP rat line. Brain Res Mol Brain Res 87: 263–270.[Medline]

Santhakumar V, Hanchar HJ, Wallner M, Olsen RW, and Otis TS (2006) Contributions of the GABAA receptor {alpha}6 subunit to phasic and tonic inhibition revealed by a naturally occurring polymorphism in the {alpha}6 gene. J Neurosci 26: 3357–3364.[Abstract/Free Full Text]

Santhakumar V, Wallner M, and Otis TS (2007) Ethanol acts directly on extrasynaptic subtypes of GABAA receptors to increase tonic inhibition. Alcohol 41: 211–221.[CrossRef][Medline]

Siggins GR, Roberto M, and Nie Z (2005) The tipsy terminal: presynaptic effects of ethanol. Pharmacol Ther 107: 80–98.[CrossRef][Medline]

Sundstrom-Poromaa I, Smith DH, Gong QH, Sabado TN, Li X, Light A, Wiedmann M, Williams K, and Smith SS (2002) Hormonally regulated {alpha}4beta2{delta} GABAA receptors are a target for alcohol. Nat Neurosci 5: 721–722.[Medline]

Talani G, Zucca S, Sanna E and Biggio G (2007) Ethanol increases GABAergic tonic currents in rat dentate gyrus granule cells in a neurosteroid-dependent manner. Alcohol Clin Exp Res 31 (Suppl): 81A.

Tia S, Wang JF, Kotchabhakdi N, and Vicini S (1996) Developmental changes of inhibitory synaptic currents in cerebellar granule neurons: role of GABAA receptor {alpha}6 subunit. J Neurosci 16: 3630–3640.[Abstract/Free Full Text]

Valenzuela CF, Carta M, and Mameli M (2005) Letter to the editor. Alcohol Clin Exp Res 29: 1356–1357.[CrossRef][Medline]

Wall M and Usowicz MM (1997) Development of action potential-dependent and independent spontaneous GABAA receptor-mediated currents in granule cells of postnatal rat cerebellum. Eur J Neurosci 9: 533–548.[CrossRef][Medline]

Wallner M, Hanchar HJ, and Olsen RW (2003) Ethanol enhances {alpha}4beta3{delta} and {alpha}6beta3{delta} {gamma}-aminobutyric acid type A receptors at low concentrations known to affect humans. Proc Natl Acad Sci U S A 100: 15218–15223.[Abstract/Free Full Text]

Wallner M, Hanchar HJ, and Olsen RW (2006) Low-dose alcohol actions on {alpha}4beta3{delta} GABAA receptors are reversed by the behavioral alcohol antagonist Ro15-4513. Proc Natl Acad Sci U S A 103: 8540–8545.[Abstract/Free Full Text]

Wei W, Faria LC, and Mody I (2004) Low ethanol concentrations selectively augment the tonic inhibition mediated by {delta} subunit-containing GABAA receptors in hippocampal neurons. J Neurosci 24: 8379–8382.[Abstract/Free Full Text]

Weiner JL and Valenzuela CF (2006) Ethanol modulation of GABAergic transmission: the view from the slice. Pharmacol Ther 111: 533–554.[CrossRef][Medline]

Wisden W, Korpi ER, and Bahn S (1996) The cerebellum: a model system for studying GABAA receptor diversity. Neuropharmacology 35: 1139–1160.[CrossRef][Medline]

Yamashita M, Marszalec W, Yeh JZ, and Narahashi T (2006) Effects of ethanol on tonic GABA currents in cerebellar granule cells and mammalian cells recombinantly expressing GABAA receptors. J Pharmacol Exp Ther 319: 431–438.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
 J. Neurophysiol.Home page
A. Belmeguenai, P. Botta, J. T. Weber, M. Carta, M. De Ruiter, C. I. De Zeeuw, C. F. Valenzuela, and C. Hansel
Alcohol Impairs Long-Term Depression at the Cerebellar Parallel Fiber-Purkinje Cell Synapse
J Neurophysiol, December 1, 2008; 100(6): 3167 - 3174.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
F. Jia, D. Chandra, G. E. Homanics, and N. L. Harrison
Ethanol Modulates Synaptic and Extrasynaptic GABAA Receptors in the Thalamus
J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 475 - 482.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
H. E. Criswell, Z. Ming, M. K. Kelm, and G. R. Breese
Brain Regional Differences in the Effect of Ethanol on GABA Release from Presynaptic Terminals
J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 596 - 603.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
T. S. Otis
Comments on "Ethanol Sensitivity of GABAergic Currents in Cerebellar Granule Neurons Is Not Increased by a Single Amino Acid Change (R100Q) in the {alpha}6 GABAA Receptor Subunit"
J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 399 - 400.
[Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
C. F. Valenzuela, R. A. Radcliffe, P. Botta, and M. Mameli
Response to Comment on "Ethanol Sensitivity of GABAergic Currents in Cerebellar Granule Neurons Is Not Increased by a Single Amino Acid Change (R100Q) in the {alpha}6 GABAA Receptor Subunit"
J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 401 - 403.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.107.127894v1
323/2/684    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Botta, P.
Right arrow Articles by Valenzuela, C. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Botta, P.
Right arrow Articles by Valenzuela, C. F.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
Molecular Interventions Drug Metabolism and Disposition