QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.106.119214v1 321/3/938    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Crosby, J. R. Articles by Gregory, S. A. Search for Related Content PubMed PubMed Citation Articles by Crosby, J. R. Articles by Gregory, S. A.

INFLAMMATION, IMMUNOPHARMACOLOGY, AND ASTHMA

Inhaled CD86 Antisense Oligonucleotide Suppresses Pulmonary Inflammation and Airway Hyper-Responsiveness in Allergic Mice

Departments of Antisense Drug Discovery (J.R.C., D.A.M., B.B., C.Y.-D., B.P.M.), Pharmacokinetics (R.S.G.), and Clinical Development (J.G.K., S.A.G.), ISIS Pharmaceuticals, Carlsbad, California; Kalypsys Pharmaceuticals, San Diego, California (M.G.); Pfizer, Chesterfield, Missouri (D.T.); and CombinatoRx, Helios, Singapore (T.P.C.)

Received for publication December 27, 2006
Accepted March 22, 2007.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
The B7-family molecule CD86, expressed on the surface of pulmonary and thoracic lymph node antigen-presenting cells, delivers essential costimulatory signals for T-cell activation in response to inhaled allergens. CD86-CD28 signaling is involved in priming allergen-specific T cells, but it is unclear whether these interactions play a role in coordinating memory T-helper 2 cell responses. In the ovalbumin (OVA)-induced mouse model of asthma, administration of CD86-specific antibody before systemic sensitization suppresses inhaled OVA-induced pulmonary inflammation and airway hyper-responsiveness (AHR). In previously OVA-sensitized mice, systemic and intranasal coadministration of CD86 antibody is required to produce these effects. To directly assess the importance of pulmonary CD86 expression in secondary immune responses to inhaled allergens, mice were sensitized and locally challenged with nebulized OVA before treatment with an inhaled aerosolized CD86 antisense oligonucleotide (ASO). CD86 ASO treatment suppressed OVA-induced up-regulation of CD86 protein expression on pulmonary dendritic cells and macrophages as well as on recruited eosinophils. Suppression of CD86 protein expression correlated with decreased methacholine-induced AHR, airway inflammation, and mucus production following rechallenge with inhaled OVA. CD86 ASO treatment reduced BAL eotaxin levels, but it did not reduce CD86 protein on cells in the draining lymph nodes of the lung, and it had no effect on serum IgE levels, suggesting a local and not a systemic effect. These results demonstrate that CD86 expression on pulmonary antigen-presenting cells plays a vital role in regulating pulmonary secondary immune responses and suggest that treatment with an inhaled CD86 ASO may have utility in asthma and other chronic inflammatory lung conditions.

Costimulation of allergen-loaded T cells by pulmonary mucosal APCs is necessary for the recruitment and activation of airway inflammatory cells and the production of AHR (Nakajima et al., 1994; Krinzman et al., 1996; Keane-Myers et al., 1997; Tsuyuki et al., 1997). Recruited and resident pulmonary inflammatory cells play important roles in asthma pathogenesis through their coordinated control of the release of a variety of protein and lipid mediators that attract additional effector cells and enhance airway smooth muscle responsiveness to bronchoconstrictive stimuli (Gundel et al., 1991; Garlisi et al., 1997). Despite the demonstrated role of costimulatory molecules in mediating experimental asthma, their contribution to the periodicity and persistence of asthma remains poorly understood. For example, regulatory CD4+CD25+ T cells (T reg) can prevent allergic airway inflammatory responses in experimental settings (Akbari et al., 2002; Zuany-Amorim et al., 2002), suggesting that deficits in T reg may predispose individuals to the development of allergy (Herrick and Bottomly, 2003). Yet, the same costimulatory pathways that activate allergen-specific T cells may be required for the generation of T reg (Lohr et al., 2003). Furthermore, although it is generally accepted that memory T cells regulate the chronic allergic inflammatory response that underlies persistent asthma, whether memory T cells require costimulatory signals from APCs for optimal memory T-cell reactivation by pulmonary allergens is not clear. An improved understanding of the relative roles of the costimulatory pathways in asthma pathology is therefore still needed to determine whether therapeutic strategies directed at these molecules are warranted.

Previous pharmacological and genetic studies have indicated a role for the B7/CD28 pathway (Krinzman et al., 1996; Keane-Myers et al., 1997; Mathur et al., 1999) and particularly CD80 or CD86 (Tsuyuki et al., 1997; Keane-Myers et al., 1998; Mark et al., 1998, 2000; Haczku et al., 1999) in the development of allergic asthma in mice. However, the requirement of CD80 and CD86 for restimulation of T cells has been difficult to resolve. Studies using APCs from B7 knockout mice have shown that in vitro Th2 recall responses generating IL-4 occur in the absence of B7 molecule expression (Schweitzer and Sharpe, 1998). Furthermore, CD80 and CD86 expression was not required for the lung inflammatory response to OVA-pulsed dendritic cells in previously sensitized mice (van Rijt et al., 2004). Other reports, however, support a role for B7 molecules in T-cell reactivation responses. A costimulatory signal provided through CD28 was shown to be required for allergen-induced IL-5 production in bronchial biopsy tissue of atopic mild asthmatic subjects (Jaffar et al., 1999). In a separate study, these investigators found that CD28-B7 costimulation was required for IL-5 and IL-13 production from peripheral blood mononuclear cells but not from bronchial tissue of moderate-to-severe asthmatics (Lordan et al., 2001). Larché et al. (1998) found that CD86- but not CD80-specific monoclonal antibody inhibited the proliferation of airway T cells from atopic asthmatics in response to allergen. Keane-Myers et al. (1998) also showed that CD86 antibody treatment 2 weeks after the initial OVA sensitization effectively suppressed the challenge response in a mouse asthma model. In this study, we used an aerosolized CD86 ASO to evaluate the role of CD86 in the secondary pulmonary inflammatory response to inhaled allergen. Our results suggest that inhibition of CD86 expression on pulmonary APC may be an effective therapeutic approach for the treatment of allergic or chronic lung disease.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Cell Transfection and mRNA Analysis. MH-S mouse alveolar macrophages (American Type Culture Collection, Manassas, VA) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 50 µM -mercaptoethanol, and 10 mM HEPES, pH 7 (Invitrogen, Carlsbad, CA). 2'-O-Methoxyethylribose (MOE)-modified phosphorothioate oligonucleotides were synthesized and purified as described previously (Dean et al., 2001). Chimeric oligonucleotides containing nuclease-resistant 2'-MOE phosphorothioate residues flanking a 2'-deoxyribonucleotide/phosphorothioate region that supports RNase H-based cleavage of the targeted mRNA were used in all experiments. The sequences of the murine CD86 ASO and seven base-pair mismatch control oligonucleotide are 5'-TCAAGTTTCTCTGTGCCCAA-3' and 5'-TCAAGTCCTTCCACACCCAA-3', respectively. Oligonucleotide transfections were performed. Total RNA was purified 48 h after ASO transfection by elution into 100 µl of water using the RNeasy 96 Plate kit (QIAGEN, Valencia, CA). RNA levels were quantified using the PerkinElmer ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA) by real-time fluorescence PCR detection. The CD86 primers/probe sequences used were forward primer, 5'-GGCCCTCCTCCTTGTGATG-3'; reverse primer, 5'-CTGGGCCTGCTAGGCTGAT-3', and probe, 5'-56-5-carboxyfluorescein/TGCTCATCATTGTATGTCACAAGAAGCCG/36-TAMRA-3'. The -actin primer/probe sequences were forward primer, 5'-CAAGATCATTGCTCCT CCTGAGCGCA-3'; reverse primer, 5'-GCTGATCCACATCTGCTGGAA-3'; and probe, 5'-56 –5-carboxyfluorescein/CAAGATCATTGCTCCTCCTGAGCGCA/36-TAMRA-3'.

T-Cell Costimulation Assay. The effects of ASO or control oligonucleotide treatment on the T-cell costimulatory activity of MH-S cells were assessed by coculturing ASO-transfected MH-S cells with anti-CD3 activated primary mouse CD4+ T cells. MH-S cells were seeded at 6500 cells/well the day before oligonucleotide treatment (approximately 50% confluence). MH-S cells were then transfected with ASO or control oligonucleotide as described above, washed, and cultured in growth medium for 48 h before Fc blockade (2 µg/ml for 10 min) and concomitant addition of soluble anti-CD3 antibody (100 µg/ml; BD Biosciences PharMingen, San Diego, CA) and CD4+ primary T cells. CD4+ T cells were purified from the spleens of female BALB/c mice (2–4 months of age) by immunomagnetic bead selection as per the manufacturer (Dynal Biotech, Lake Success, NY). The cells were then separated from the beads by immunomagnetics, washed, and counted. Twenty thousand CD4+ T cells were added per well, and coculture supernatants were evaluated for IL-2 levels by ELISA (BD Biosciences PharMingen) 16 h later.

Asthma Models and Oligonucleotide Administration. All mice used in this study were covered by a protocol approved by our Institutional Animal Care and Use Committee. A modification of the secondary challenge mouse OVA model of experimentally induced asthma was used in these studies, as described previously (Taube et al., 2002). Male BALB/c mice (6–8 weeks of age; Charles River Laboratories, Inc., Wilmington, MA) were sensitized by i.p. injection (100 µl) of 20 µg of chicken OVA (Sigma-Aldrich, St. Louis, MO.) emulsified in 2 mg of Imject Alum (Pierce Chemical, Rockford, IL). Mice were sensitized on day 0 and day 14. The mice were subsequently challenged locally by inhalation (20 min, daily) of an aerosol generated from 1% OVA in normal saline by ultrasonic nebulization on days 24 to 26. Mice were re-exposed to 1% nebulized OVA on days 66 and 67. Endpoints were measured on day 68. ASOs dissolved in saline were administered by aerosol delivery on days 56, 59, 61, 63, and 66. ASOs were suspended in 0.9% sodium chloride (Baxter Healthcare Corporation, Deerfield, IL) and delivered via inhalation using a nose-only delivery system as described previously (Silbaugh et al., 1987; Karras et al., 2007). A Lovelace nebulizer (model 01-100), was used to deliver the ASO at a flow rate of 1 l/min. The total flow rate of the delivery system was 10 l/min. The exposure chamber was equilibrated with the oligonucleotide aerosol suspension for 5 min before mice were placed in restraint tubes and attached to the chamber. Restrained mice were treated for a total of 10 min.

Determination of Inflammatory Cells in Bronchial Alveolar Lavage Fluid. Mouse lungs were lavaged two times with 0.5 ml of PBS containing 2% fetal calf serum. BAL fluid samples were centrifuged to generate a cell pellet and a cell-free supernatant. The recovered airway cells were resuspended in PBS-2% fetal calf serum, and a cytospin was performed. Cells were stained with Diff-Quik stain (Dade Behring, Inc., Newark, DE). Data are presented as the percentage of eosinophils present in the total recovered BAL cell population. Cell-free lavage fluid was frozen and stored at –80°C until analyzed. Murine cytokine and chemokine levels were measured using an ELISA assay as described by the supplier (BD Biosciences PharMingen).

Measurement of Airway Hyperresponsiveness. AHR was determined by inducing bronchoconstriction with methacholine aerosol at escalating doses (Hamelmann et al., 1997). Total pulmonary airflow in unrestrained mice was estimated using a whole body plethysmograph (Buxco Electronics, Wilmington, NC). Pressure differences between a chamber containing an individual mouse and a reference chamber were used to extrapolate the enhanced pause (Penh). Penh is a dimensionless parameter that is a function of total pulmonary airflow in mice during each respiratory cycle. This parameter closely correlates with airway resistance as measured by traditional invasive techniques using ventilated mice (Hamelmann et al., 1997). For invasive lung measurements, mice were first weighed and anesthetized with 150 mg/kg ketamine mixed with 10 mg/kg xylazine. A tracheostomy was performed, and the mice were ventilated using the Flexivent system (SCIREQ, Montreal, QC, Canada) by using traditional mouse parameters. Increasing concentrations of methacholine were aerosolized using the Flexivent system with an Aeroneb lab nebulizer system, and resistance (RL) and compliance (CL) were measured. Values for all measurements were obtained using Excel software, and they are expressed as the mean ± S.E.M.

Assessment of Mucus Production. Lungs were inflated with 10% formalin overnight before imbedding in paraffin. Mucus cell development along the airway epithelium was assessed in paraffin-imbedded 4-µm tissue sections stained with periodic acid-Schiff's reagent (PAS). The number of PAS-positive airways present in each lung section was determined. Parasagittal tissue sections were analyzed by bright field microscopy, and images were collected. Images were analyzed using Image-Pro Plus (Media Cybernetics, Silver Spring, MD) to derive an airway mucus index reflective of both the amount of mucus per airway and the number of airways affected (Karras et al., 2007). The mucus content of all the airways per section (proximal to distal) was measured from groups of five animals. Image Pro-Plus was used to quantify the area and intensity of PAS staining per airway. The data were quantified as follows: mucus index = (average PAS staining intensity of airway epithelium) x (area of airway epithelium staining with PAS)/(total area of conducting airway epithelium). This value is determined for each airway positive for mucus, and the sum of values for all positive airways is divided by the total number of airways in the lung.

Flow Cytometric Analysis of Cell Surface CD80 and CD86 Protein. Following transfection of MH-S cells with CD86 ASO or control oligonucleotides, protein expression was analyzed by immunostaining and flow cytometry. Cell surface Fc receptors were masked with Fc blocking antibody (BD Biosciences PharMingen) at a final concentration of 2 µg/ml for 10 min at room temperature. CD86 immunostaining was analyzed following addition of CD86-specific monoclonal antibody (BD Biosciences PharMingen) at a final concentration of 2 µg/ml. Ex vivo flow cytometric analyses of lung cells was performed following digestion with collagenase as reported previously (Karras et al., 2007). Eighty-microliter aliquots of lung cells were stained with combinations of premixed antibodies. Antibody combinations used were 1) CD11b (FITC; BD Biosciences PharMingen), GR-1 (PerCP; BD Biosciences PharMingen), CD80 or CD86 (PE; BD Biosciences PharMingen); 2) CD19 (FITC), CD3 (PerCP), CD80 or CD86 (PE); 3) CD83 (FITC), Mac-3 (PE), CD80 or CD86 (biotin; BD Biosciences PharMingen); and 4) MHC class II (FITC), CD11c (biotin), CD80 or CD86 (PE). The secondary antibody used was SAv-PE-Cy5. All antibodies were obtained from BD Biosciences PharMingen with the exception of the CD83 antibody, which was obtained from BioCarta (San Diego, CA). Samples were incubated at 4°C for 45 min and then washed once with PBS before secondary antibody was added at 1:200. Cells were incubated with the secondary antibody for 45 min at 4°C, washed twice with PBS, and then resuspended in 2% paraformaldehyde in PBS and held at 4°C until time of analysis. Samples not requiring secondary antibodies were incubated at 4°C for 45 min, washed twice with PBS, resuspended in 2% paraformaldehyde in PBS, and kept at 4°C until time of analysis. CD86 protein expression on total and gated populations of lung cells was analyzed using a FACScan (Becton Coulter, Palo Alto, CA) and macrophages (CD11b+ GR-1-SSClo) and eosinophils (CD11b+ GR-1lo) were grouped together, as described previously (Karras et al., 2007).

Statistics. Analysis of differences between entire dose-response curves in Penh response and the invasive resistance and compliance measurements were performed using two-way repeated measures analysis of variance using JMP statistical discovery software (SAS Institute, Cary, NC). Analysis of group differences in all other endpoints was performed using either a Student's t test or Dunnett's test, as indicated in each figure legend.

	Results

Top Abstract Materials and Methods Results Discussion References

 
In Vitro Characterization of CD86 ASO and Inhibition of CD86-Mediated T-Cell Costimulatory Activity by CD86 ASO in MH-S Alveolar Macrophage Cells. The CD86 ASO used in these studies was characterized in transfected mouse MH-S cells, including evaluation of potency, specificity, and mechanism of action. The data presented in Fig. 1, A and B, demonstrate dose-dependent reduction of CD86 mRNA and protein expression in MH-S cells following transfection with the CD86 ASO, as determined by TaqMan quantitative reverse transcription-PCR and immunostaining followed by flow cytometry, respectively. The IC₅₀ value for CD86 protein reduction in MH-S cells was approximately 1 nM. CD86 RNA and protein were maximally reduced at the highest ASO concentration tested (10 nM). MH-S cells were also transfected with a series of oligonucleotides containing either one-, three-, five-, or seven-base mismatches to the CD86 ASO sequence, and target mRNA reduction was evaluated in these treated cells (Fig. 1A; for sequences, see Table 1). Only the one-base mismatched oligonucleotide reduced CD86 mRNA expression, and no effect of the three-base mismatch oligonucleotide was confirmed in the CD86 protein analysis (Fig. 1B). These results provide evidence that a hybridization-based effect was responsible for the activity of the parent CD86 oligonucleotide, consistent with an antisense mechanism of action. The CD86 ASO was specific for CD86, because no effect on the related CD80 mRNA or protein was observed (data not shown; Fig. 1B).

View larger version (30K): [in this window] [in a new window]   Fig. 1. Specific and hybridization-dependent reduction of CD86 expression and T-cell costimulatory activity in MH-S alveolar macrophage cells following transfection with a murine CD86 ASO. A, evaluation of sequence-specific CD86 target RNA reduction in MH-S cells by quantitative reverse transcription-PCR 24 h following transfection with CD86 ASO or one-, three-, five-, or seven-base pair MM control oligonucleotides. B, analysis of CD80 and CD86 cell surface protein levels in MH-S cells transfected with CD86 ASO or a three-base mismatch control oligonucleotide, as assayed 24 h later by flow cytometry. C, inhibition of the T-cell costimulatory activity of MH-S cells following transfection with a murine CD86 ASO or treatment with a CD86-specific monoclonal antibody. IL-2 was quantified by ELISA using supernatants recovered after 16 h of coculture of MH-S cells with anti-CD3 activated primary CD4+ T cells. The data are presented as the mean ± S.D., and they are representative of duplicate (A and B) or triplicate (C) experiments with four replicate values for each data point. *, p < 0.05, statistically significant compared with control (Dunnett's test).

The effect of the CD86 ASO on inhibition of APC costimulatory activity was also evaluated. IL-2 production in cocultures of ASO-transfected MH-S cells with anti-CD3 activated primary CD4+ T lymphocytes was used as a surrogate of a functional costimulatory signal. T cells stimulated with anti-CD3 antibody produced a high level of IL-2 (300–800 pg/ml culture supernatant) following incubation for 16 h with plate-bound MH-S cells. In the absence of anti-CD3 or MH-S cells, no IL-2 was detected (Fig. 1C; data not shown). Treatment of the cells with a CD86 blocking antibody inhibited IL-2 production in a concentration-dependent manner, confirming the importance of CD86 signaling in the costimulation of primary CD4+ T cells (Fig. 1C). Transfection of MH-S cells with the CD86 ASO before the addition of T cells suppressed IL-2 production in a dose-dependent manner, whereas transfection with a three-base mismatch control oligonucleotide had no effect (Fig. 1C). The magnitude of functional inhibition correlated with the level of reduction of CD86 protein expression on the MH-S cell surface (compare Fig. 1, B and C), indicating that the CD86 ASO effect was antisense-mediated.

Pharmacokinetic Characterization of Aerosolized ASO Exposures in Mice. Nebulization of ASO in simple saline formulations produced aerosol particles in the respirable range (Karras et al., 2007). Following nose-only inhalation of the CD86 ASO, the concentration of CD86 oligonucleotide in mouse lung tissue was quantified using a hybridization-based ELISA. Concentrations of the CD86 ASO in lungs increased with dose following aerosol inhalation; this increase was proportional to dose as dose increased from 0.6 to 5 µg/kg, but it was smaller than proportional to dose as dose increased from 5 to 60 µg/kg, suggesting possible saturation in tissue uptake. Specifically, lung concentrations of 15, 131, and 425 ng of oligonucleotide/g tissue were detected on day 10 for doses of 0.6, 5, and 60 µg/kg, respectively (five doses administered over 10 days).

Kinetic analyses indicated that the inhaled mouse CD86 MOE-modified oligonucleotide was cleared slowly from mouse lung. Tissue half-life was determined to be 4.1 days following the administration of a single dose of 100 µg of oligonucleotide/kg (Karras et al., 2007), supporting an infrequent treatment regimen in mouse pharmacology studies. Based on these observations, we exposed mice to CD86 ASO inhalation three times per week for a total of five doses, and we evaluated target protein reduction and pharmacological responses to allergen challenge.

Inhalation of Aerosolized CD86 ASO Reduces CD86 Protein Expression on Alveolar Macrophages, Dendritic Cells, and Eosinophils in Allergen-Challenged Mice. CD86 is expressed constitutively at low levels on pulmonary macrophages, dendritic cells, eosinophils, and T cells in mice (Inaba et al., 1994). In response to inhaled allergen exposure, resident pulmonary dendritic cells (Huh et al., 2003) as well as recruited eosinophils (MacKenzie et al., 2001) transiently up-regulate CD86 expression. To characterize the kinetics of CD86 expression in response to OVA challenge, lungs were removed on various days, and the level of CD86 expression on individual cell types was determined using multicolor flow cytometry. Peak expression of CD86 was observed on lung dendritic cells, macrophages, and eosinophils 24 h after the first local OVA challenge (data not shown). This time point was selected for evaluation of CD86 ASO pharmacodynamic activity in lung cells. CD86 ASO was administered to BALB/c mice previously sensitized to OVA at a dose of 10 or 0.3 µg of oligonucleotide/kg/day (estimated inhaled dose) for a total of five treatments over a period of 10 days. Lungs were removed and treated with collagenase to generate single cell suspensions. Subsequent fluorescence-activated cell sorting analysis demonstrated that the mixed eosinophil and macrophage population had the highest percentage of CD86-positive cells following allergen challenge (Fig. 2A). Treatment with the CD86 ASO but not the mismatched control oligonucleotide reduced the percentage of CD86-positive cells in this mixed macrophage/eosinophil cell population. Likewise, the percentage of CD86-positive dendritic cells was also reduced following inhalation of aerosolized CD86 ASO. The mean fluorescence intensity (MFI) of CD86 expression in eosinophils/macrophages and dendritic cells was also significantly reduced in CD86 ASO- but not mismatch control oligonucleotide-treated mice (Fig. 2B). CD80 expression on lung cells was determined in parallel. Neither CD86 ASO nor mismatched control oligonucleotide treatment significantly altered the percentage of CD80-positive cells in any of dose groups (Fig. 2C) or the MFI (Fig. 2D), indicating that CD86 ASO treatment specifically reduced CD86 levels on relevant APCs in the mouse lung. These results are similar to previously published results using an inhaled IL-4R ASO in a mouse asthma model (Karras et al., 2007). Although CD86 can be expressed on activated T cells, we have not observed down-regulation of T-cell-specific target genes following ASO inhalation in mice, suggesting that lymphocyte CD86 expression is not likely to be affected.

View larger version (32K): [in this window] [in a new window]   Fig. 2. Reduction of CD86 protein levels in lung antigen-presenting cells from OVA-challenged mice following inhalation of a CD86 ASO but not a seven-base MM control oligonucleotide. Lungs were harvested 6 h following a second local OVA challenge, and cells were recovered after collagenase treatment of the tissue and analyzed by flow cytometry. The level of CD86 expression was quantitated by percentage of CD86-positive cells (A) and by MFI (B) either on total cells, lung granulocytes (CD11b-positive, GR-1 high), macrophages and eosinophils (CD11b-positive, GR-1 negative or low), and dendritic cells (CD11c-positive, MHC class II-positive). Cells were isolated from vehicle-treated naive mice or OVA-challenged mice treated with vehicle, an inhaled CD86 ASO, or a seven-base mismatch control oligonucleotide. C and D, lack of inhibition of CD80 protein levels on total cells, lung granulocytes, macrophages, eosinophils, and dendritic cells following inhalation of CD86 ASO. Data are expressed as the group mean percentage of CD86-positive cells or MFI ± S.E., n = 4/group. *, p < 0.05 for groups compared with vehicle using Dunnett's test.

View larger version (17K): [in this window] [in a new window]   Fig. 3. CD86 is required for allergen-mediated AHR in previously sensitized and challenged mice. OVA-sensitized and -challenged mice were rested for 1 month before treatment with aerosolized CD86 ASO or a seven-base MM control oligonucleotide (days 56, 59, 61, 63, and 66) and subsequent rechallenge with nebulized OVA (days 66 and 67). A, AHR data were collected on day 68, and they are presented as Penh values [percentage of vehicle (saline) control] measured in treated mice exposed to 100 mg/ml methacholine (similar effects were observed at lower concentrations of methacholine; data not shown). B and C, measures of airway RL and CL in naive or allergen-challenged mice treated with 100 µg/kg CD86 ASO, 100 µg/kg control oligonucleotide, or saline (vehicle), and evaluated following anesthesia, tracheostomy, intubation, and mechanical ventilation using a Flexivent system. Data are presented as group means ± S.E., n = 10/group except RL and CL, where n = 4 to 6/group. *, p < 0.05 for groups compared with vehicle using two-way analysis of variance and Dunnett's test. For B and C, comparisons were made using area under the curve analysis.

Administration of aerosolized CD86 ASO reduced airway eosinophilia (100 µg/kg dose) (Fig. 4) and demonstrated a nonstatistically significant trend toward reduction of lymphocytes and neutrophils (data not shown). Treatment with the mismatched control oligonucleotide did not reduce the percentage of eosinophils, lymphocytes, or neutrophils recovered from the airways. A second CD86 ASO of similar in vitro potency targeted to a different region of the CD86 mRNA was found to be a potent inhibitor of both OVA-induced Penh and airway eosinophilia responses following aerosol exposure in mice (data not shown). These results support a target-directed antisense mechanism of action.

View larger version (13K): [in this window] [in a new window]   Fig. 4. Allergen-induced airway recruitment of eosinophils is inhibited by treatment with an inhaled CD86 ASO but not a mismatched control oligonucleotide. Airway cells were recovered by BAL on day 68 of the rechallenge protocol, and they were evaluated by cytospin and differential cell count analysis. Kinetic studies demonstrated peak eosinophil recruitment to the airways at this respective time point in the rechallenge model (data not shown). Data are presented as group mean percentage cell type ± S.E., n = 16/group. *, p < 0.05 for groups compared with vehicle using Dunnett's test.

Local OVA challenge in allergic mice induces inflammatory cell recruitment to the lung parenchyma, goblet cell metaplasia, and the production of mucus (Fig. 5, top left). Bronchus-associated lymphoid tissue was also apparent after allergen challenge. Treatment with inhaled 10 and 100 µg/kg CD86 ASO, but not the mismatched control oligonucleotide, significantly reduced the PAS-positive staining compared with the vehicle-treated group (Fig. 5, compare middle and bottom panels with top left panel). CD86 treated mice also displayed reduced amounts of airway mucus compared with mismatch oligonucleotide-treated counterparts, as determined by digital image quantitation of PAS-stained sections (Fig. 5B). These data suggest that CD86-induced T-cell activation contributes to mucus overproduction in OVA-challenged allergic mice.

View larger version (61K): [in this window] [in a new window]   Fig. 5. CD86 ASO treatment reduces mucus production in the airways of OVA-challenged mice. Lungs were inflated with formalin, and they were removed on day 68 of the protocol after the mice had been rechallenged with OVA on days 66 and 67. Mucus expression was visualized by staining of formalin-fixed, paraffin-embedded lung sections with PAS stain. Representative sections from vehicle, naive, CD86 ASO, or MM control oligonucleotide (microgram per kilogram) treated mice are shown in A. Mucus production in all groups was quantitated by digital image analysis, and results are shown in B. Mucus production analyses were carried out in separate groups of mice from those used for other endpoints. *, p < 0.05 for groups compared with vehicle using Dunnett's test.

	Discussion

Top Abstract Materials and Methods Results Discussion References

Inhalation of an aerosolized CD86 ASO results in potent and specific down-regulation of CD86 protein expression on lung APCs. Pharmacokinetic analyses of CD86 ASO levels in mice following inhalation of aerosolized oligonucleotide solution showed that systemic absorption is low, on the order of 1% of the tissue concentration in the lung (R. Yu and R. Geary, unpublished observations). In Cynomolgous monkeys, after three administrations of aerosolized CD86 ASO via intubation directly into the airways at the top of the bronchial tree, 0.02% of the delivered dose was recovered in peribronchial lymph nodes and 0.2% was recovered in kidney, with no measurable oligonucleotide detected in liver. Immunohistochemical staining of oligonucleotide following either intratracheal instillation or aerosol inhalation revealed oligonucleotide distributed throughout the large and small airways and associated with alveolar macrophages and lung alveolar epithelium (Templin et al., 2000). An increase in the numbers of CD86+ DCs in the mediastinal lymph nodes was noted following successive OVA challenges. Inhalation of CD86 ASO before OVA challenge had no effect on the level of CD86 protein expressed on DCs from the mediastinal lymph node (M. Guha, unpublished observations). These data suggest that inhibition of CD86 in lung APCs is sufficient to suppress the secondary pulmonary immune response to allergen.

We observed pharmacological effects on allergen-induced airway cell infiltration, mucus production, and AHR in allergic mice despite no measurable decrease in Th2 cytokines in the BALF following inhaled CD86 ASO treatment. Other studies support B7-dependent immunosuppression in the absence of Th2 cytokine reduction. Schweitzer and Sharpe (1998) showed that restimulation of previously activated T cells with CD80/CD86–/– APCs inhibited proliferation and IL-2 production without affecting IL-4 secretion. In vivo studies in an intestinal nematode parasite model demonstrated that worm-induced increases in effector and memory Th2 cell IL-4 production are unabated in B7-deficient mice, whereas humoral immunity is inhibited (Ekkens et al., 2002). Lordan et al. (2001) showed that CD28/B7 blockade inhibited allergen-induced production of IL-5 and IL-13 by peripheral blood mononuclear cells collected from asthma patients. However, in bronchial explants, allergen restimulation only induced IL-5 expression, which was not affected by CD28/B7 inhibition (Lordan et al., 2001). The authors suggest that these divergent results demonstrate the importance of the tissue microenvironment in determining the results of pharmacological intervention. The roles of eotaxin and RANTES are less understood in asthma, but they are thought, in part, to mediate attraction of eosinophils and lymphocytes, respectively, to the lung following allergen exposure. This effect is consistent with the observed decrease in eosinophils and lymphocytes in mice that inhaled CD86 ASO (Fig. 4; data not shown). Caron et al. (2001) suggest that resident DC may participate in local restimulation of memory T cells. This was supported by the fact that histamine-activated DCs produce chemokines involved in memory T-cell recruitment. We postulate that inhibiting CD86 reduces the ability of resident lung DCs to stimulate T-cell production of chemokines.

Our results differ from those of van Rijt et al. (2004) showing that OVA-pulsed CD80/CD86–/– mouse DCs produced Th2 pulmonary immune reactivation responses that were similar to those induced by wild-type DCs upon intratracheal injection). Partial down-regulation of CD86 on DCs following antisense treatment may favor a different series of cell-cell interactions than germline deletion. In addition, the presence of intact CD80 expression in our model could additionally alter the B7 family interaction dynamics. Our results may also be explained by participation of other non-DC APCs, such as alveolar macrophages and eosinophils, in the reactivation response. Recently, the generation of eosinophil-deficient mice has demonstrated that these cells are required for some of the observed allergen-induced experimental pulmonary pathology (Lee et al., 2004). Previous work had shown that release of the major eosinophil proteins major basic protein and eosinophil peroxidase was not sufficient to produce the asthmatic phenotype in mice (Denzler et al., 2000), suggesting that the antigen-presenting capacity of eosinophils (Shi et al., 2000) may play an important role in the development of pulmonary inflammation. We therefore speculate that the down-regulation of CD86 expression on infiltrating eosinophils, in addition to alveolar macrophages and dendritic cells, following the initial nebulized OVA challenge may result in reduced pulmonary inflammation by blockade of APC activity and/or interference with eosinophil activation and effector function.

The oligonucleotides used in this study did not contain any of the reported murine immunostimulatory sequence motifs (Krieg et al., 1995), including the well documented CpG dinucleotide motif that has been shown to activate Th1 immune responses in vivo and to prevent allergen-induced inflammation (Krieg et al., 1995). Oligonucleotide treatment was well tolerated in OVA-challenged mice. In ASO-treated animals, no increases in airway granulocytes or lymphocytes above and beyond that induced by allergen exposure were observed, and no increases in Th1 cytokines (interferon- or IL-12) were detected in BAL fluid. ASO treatment produced no change in the baseline airway response to methacholine in allergen-sensitized mice and no structural changes in lung tissue, or alterations in liver or spleen weights or serum transaminase levels (J. Crosby, G. Hung, J. Karras, and S. Gregory, unpublished observations).

There remains a significant need for improved control of symptoms and disease exacerbations in moderate and severe asthma. Inhaled ASOs have the potential to regulate transcription of individual molecular targets in lung tissue in a highly specific manner (Nyce and Metzger, 1997) and to target molecules that cannot be effectively inhibited by conventional small molecule therapies. We have shown that pulmonary CD86 expression is sufficient to support the secondary immune response to allergen provocation in a mouse model of asthma. The contribution of B7 costimulation to activation of mucosal T-cell responses in human asthma, however, remains unclear. Elucidation of the relative role of CD86 in regulating chronic pulmonary inflammation and AHR will require studies in a chronic mouse model of asthma. Our results demonstrate that inhalation of second generation chemically modified antisense oligonucleotides can effectively diminish expression of targeted proteins in cells with antigen-presenting function in the lung while largely avoiding systemic exposure and thus highlight the potential of this approach in the clinical setting.

	Acknowledgements

 
We thank Drs. Rosie Yu and Richard Geary and Dominic Kowalski, Scott Cooper, Donna Witchell, Jinsoo Kim, John Matson, and Bill Gaarde for invaluable expertise and advice. We thank Shuting Xia for the statistical analysis. We also thank Drs. Steve Zuckerman and David Snyder (Eli Lilly & Co.) for contributions.

	Footnotes

 
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.106.119214.

ABBREVIATIONS: APC, antigen-presenting cell; MHC, major histocompatibility complex; Th, T-helper; AHR, airway hyper-responsiveness; T reg, regulatory CD4+CD25+ T cell; IL, interleukin; ASO, antisense oligonucleotide; 2'-MOE, 2'-O-methoxyethylribose; PCR, polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; BAL, bronchoalveolar lavage; PBS, phosphate-buffered saline; Penh, enhanced pause; RL, resistance; CL, compliance; PAS, periodic acid-Schiff's reagent; FITC, fluorescein isothiocyanate; PerCP, peridinin chlorophyll a protein; PE, phycoerythrin; MFI, mean fluorescence intensity; RANTES, regulated on activation normal T cell expressed and secreted; DC, dendritic cell; MM, mismatch.

Address correspondence to: Dr. Jeffrey R. Crosby, Antisense Drug Discovery, Isis Pharmaceuticals, 1896 Rutherford Rd., Carlsbad, CA 92008. E-mail: jcrosby{at}isisph.com

	References

Top Abstract Materials and Methods Results Discussion References

 

Akbari O, Freeman GJ, Meyer EH, Greenfield EA, Chang TT, Sharpe AH, Berry G, DeKruyff RH, and Umetsu DT (2002) Antigen-specific regulatory T cells develop via the ICOS-ICOS-ligand pathway and inhibit allergen-induced airway hyperreactivity. Nat Med 8: 1024–1032. 12145647[CrossRef][Medline]
Alegre ML, Shiels H, Thompson CB, and Gajewski TF (1998) Expression and function of CTLA-4 in Th1 and Th2 cells. J Immunol 161: 3347–3356. 9759851[Abstract/Free Full Text]
Caron G, Delneste Y, Roelandts E, Duez C, Bonnefoy JY, Pestel J, and Jeannin P (2001) Histamine polarizes human dendritic cells into Th2 cell-promoting effector dendritic cells. J Immunol 167: 3682–3686. 11564782[Abstract/Free Full Text]
Dean NM, Butler M, Monia BP, and Manoharan M (2001) Pharmacology of 2'-O-(2-methoxy)ethyl-modified antisense oligonucleotide, in Antisense Drug Technology: Principles, Strategies and Applications (Crooke ST ed) pp 319–338, Marcel Dekker, New York.
Denzler KL, Farmer SC, Crosby JR, Borchers MT, Cieslewicz G, Larson KA, Cormier-Regard S, Lee NA, and Lee JJ (2000) Eosinophil major basic protein-1 does not contribute to allergen-induced airway pathologies in mouse models of asthma. J Immunol 165: 5509–5517. 11067904[Abstract/Free Full Text]
Ekkens MJ, Liu Z, Liu Q, Foster A, Whitmire J, Pesce J, Sharpe AH, Urban JF, and Gause WC (2002) Memory Th2 effector cells can develop in the absence of B7–1/B7–2, CD28 interactions, and effector Th cells after priming with an intestinal nematode parasite. J Immunol 168: 6344–6351. 12055251[Abstract/Free Full Text]
Garlisi CG, Falcone A, Hey JA, Paster TM, Fernandez X, Rizzo CA, Minnicozzi M, Jones H, Billah MM, Egan RW, et al. (1997) Airway eosinophils, T cells, Th2-type cytokine mRNA, and hyperreactivity in response to aerosol challenge of allergic mice with previously established pulmonary inflammation. Am J Respir Cell Mol Biol 17: 642–651. 9374116[Abstract/Free Full Text]
Greenwald RJ, Freeman GJ, and Sharpe AH (2005) The B7 family revisited. Annu Rev Immunol 23: 515–548. 15771580[CrossRef][Medline]
Gundel RH, Letts LG, and Gleich GJ (1991) Human eosinophil major basic protein induces airway constriction and airway hyperresponsiveness in primates. J Clin Invest 87: 1470–1473. 2010556[Medline]
Haczku A, Takeda K, Redai I, Hamelmann E, Cieslewicz G, Joetham A, Loader J, Lee JJ, Irvin C, and Gelfand EW (1999) Anti-CD86 (B7.2) treatment abolishes allergic airway hyperresponsiveness in mice. Am J Respir Crit Care Med 159: 1638–1643. 10228138[Abstract/Free Full Text]
Hamelmann E, Schwarze J, Takeda K, Oshiba A, Larsen GL, Irvin CG, and Gelfand EW (1997) Noninvasive measurement of airway responsiveness in allergic mice using barometric plethysmography. Am J Respir Crit Care Med 156: 766–775. 9309991[Abstract/Free Full Text]
Herrick CA and Bottomly K (2003) To respond or not to respond: T cells in allergic asthma. Nat Rev Immunol 3: 405–412. 12766762[CrossRef][Medline]
Huh JC, Strickland DH, Jahnsen FL, Turner DJ, Thomas JA, Napoli S, Tobagus I, Stumbles PA, Sly PD, and Holt PG (2003) Bidirectional interactions between antigen-bearing respiratory tract dendritic cells (DCs) and T cells precede the late phase reaction in experimental asthma: DC activation occurs in the airway mucosa but not in the lung parenchyma. J Exp Med 198: 19–30. 12835476[Abstract/Free Full Text]
Inaba K, Witmer-Pack M, Inaba M, Hathcock KS, Sakuta H, Azuma M, Yagita H, Okumura K, Linsley PS, Ikehara S, et al. (1994) The tissue distribution of the B7-2 costimulator in mice: abundant expression on dendritic cells in situ and during maturation in vitro. J Exp Med 180: 1849–1860.[Abstract/Free Full Text]
Jaffar Z, Roberts K, Pandit A, Linsley P, Djukanovic R, and Holgate S (1999) B7 costimulation is required for IL-5 and IL-13 secretion by bronchial biopsy tissue of atopic asthmatic subjects in response to allergen stimulation. Am J Respir Cell Mol Biol 20: 153–162. 9870929[Abstract/Free Full Text]
Karras JG, Crosby JR, Guha M, Tung D, Miller DA, Gaarde WA, Geary RS, Monia BP, and Gregory SA (2007) Anti-inflammatory activity of inhaled IL-4 receptor-{alpha} antisense oligonucleotide in mice. Am J Respir Cell Mol Biol 36: 276–285. 16990616[Abstract/Free Full Text]
Keane-Myers AM, Gause WC, Finkelman FD, Xhou XD, and Wills-Karp M (1998) Development of murine allergic asthma is dependent upon B7–2 costimulation. J Immunol 160: 1036–1043. 9551945[Abstract/Free Full Text]
Keane-Myers A, Gause WC, Linsley PS, Chen SJ, and Wills-Karp M (1997) B7-CD28/CTLA-4 costimulatory pathways are required for the development of T helper cell 2-mediated allergic airway responses to inhaled antigens. J Immunol 158: 2042–2049. 9036947[Abstract]
Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, and Klinman DM (1995) CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 546–549. 7700380[CrossRef][Medline]
Krinzman SJ, De Sanctis GT, Cernadas M, Mark D, Wang Y, Listman J, Kobzik L, Donovan C, Nassr K, Katona I, et al. (1996) Inhibition of T cell costimulation abrogates airway hyperresponsiveness in a murine model. J Clin Invest 98: 2693–2699. 8981913[Medline]
Larché M, Till SJ, Haselden BM, North J, Barkans J, Corrigan CJ, Kay AB, and Robinson DS (1998) Costimulation through CD86 is involved in airway antigen-presenting cell and T cell responses to allergen in atopic asthmatics. J Immunol 161: 6375–6382. 9834128[Abstract/Free Full Text]
Lee JJ, Dimina D, Macias MP, Ochkur SI, McGarry MP, O'Neill KR, Protheroe C, Pero R, Nguyen T, Cormier SA, et al. (2004) Defining a link with asthma in mice congenitally deficient in eosinophils. Science 305: 1773–1776.[Abstract/Free Full Text]
Lohr J, Knoechel B, Jiang S, Sharpe AH, and Abbas AK (2003) The inhibitory function of B7 costimulators in T cell responses to foreign and self-antigens. Nat Immunol 4: 664–669. 12766766[CrossRef][Medline]
Lordan JL, Davies DE, Wilson SJ, Dent G, Corkhill A, Jaffar Z, Roberts K, Djukanovic R, and Holgate ST (2001) The role of CD28 –B7 costimulation in allergen-induced cytokine release by bronchial mucosa from patients with moderately severe asthma. J Allergy Clin Immunol 108: 976–981. 11742276[CrossRef][Medline]
MacKenzie JR, Mattes J, Dent LA, and Foster PS (2001) Eosinophils promote allergic disease of the lung by regulating CD4⁺ Th2 lymphocyte function. J Immunol 167: 3146–3155. 11544300[Abstract/Free Full Text]
Mark DA, Donovan CE, De Sanctis GT, He HZ, Cernadas M, Kobzik L, Perkins DL, Sharpe A, and Finn PW (2000) B7–1 (CD80) and B7–2 (CD86) have complementary roles in mediating allergic pulmonary inflammation and airway hyperresponsiveness. Am J Respir Cell Mol Biol 22: 265–271. 10696062[Abstract/Free Full Text]
Mark DA, Donovan CE, De Sanctis GT, Krinzman SJ, Kobzik L, Linsley PS, Sayegh MH, Lederer J, Perkins DL, and Finn PW (1998) Both CD80 and CD86 costimulatory molecules regulate allergic pulmonary inflammation. Int Immunol 10: 1647–1655. 9846693[Abstract/Free Full Text]
Mathur M, Herrmann K, Qin Y, Gulmen F, Li X, Krimins R, Weinstock J, Elliott D, Bluestone JA, and Padrid P (1999) CD28 interactions with either CD80 or CD86 are sufficient to induce allergic airway inflammation in mice. Am J Respir Cell Mol Biol 21: 498–509. 10502560[Abstract/Free Full Text]
Nakajima H, Sano H, Nishimura T, Yoshida S, and Iwamoto I (1994) Role of vascular cell adhesion molecule 1/very late activation antigen 4 and intercellular adhesion molecule 1/lymphocyte function-associated antigen 1 interactions in antigen-induced eosinophil and T cell recruitment into the tissue. J Exp Med 179: 1145–1154. 7511681[Abstract/Free Full Text]
Nyce JW and Metzger WJ (1997) DNA antisense therapy for asthma in an animal model. Nature 385: 721–725. 9034188[CrossRef][Medline]
Schweitzer AN and Sharpe AH (1998) Studies using antigen-presenting cells lacking expression of both B7–1 (CD80) and B7–2 (CD86) show distinct requirements for B7 molecules during priming versus restimulation of Th2 but not Th1 cytokine production. J Immunol 161: 2762–2771. 9743334[Abstract/Free Full Text]
Sharpe AH and Freeman GJ (2002) The B7-CD28 superfamily. Nat Rev Immunol 2: 116–126. 11910893[CrossRef][Medline]
Shi HZ, Humbles A, Gerard C, Jin Z, and Weller PF (2000) Lymph node trafficking and antigen presentation by endobronchial eosinophils. J Clin Invest 105: 945–953. 10749574[Medline]
Silbaugh SA, Stengel PW, Dillard RD, and Bemis KG (1987) Pulmonary gas trapping in the guinea pig and its application in pharmacological testing. J Pharmacol Methods 18: 295–303. 3695538[CrossRef][Medline]
Taube C, Duez C, Cui ZH, Takeda K, Rha YH, Park JW, Balhorn A, Donaldson DD, Dakhama A, and Gelfand EW (2002) The role of IL-13 in established allergic airway disease. J Immunol 169: 6482–6489. 12444158[Abstract/Free Full Text]
Templin MV, Levin AA, Graham MJ, Aberg PM, Axelsson BI, Butler M, Geary RS, and Bennett CF (2000) Pharmacokinetic and toxicity profile of a phosphorothioate oligonucleotide following inhalation delivery to lung in mice. Antisense Nucleic Acid Drug Dev 10: 359–368. 11079575[Medline]
Tsuyuki S, Tsuyuki J, Einsle K, Kopf M, and Coyle AJ (1997) Costimulation through B7–2 (CD86) is required for the induction of a lung mucosal T helper cell 2 (TH2) immune response and altered airway responsiveness. J Exp Med 185: 1671–1679. 9151904[Abstract/Free Full Text]
van Rijt LS, Vos N, Willart M, Kleinjan A, Coyle AJ, Hoogsteden HC, and Lambrecht BN (2004) Essential role of dendritic cell CD80/CD86 costimulation in the induction, but not reactivation, of TH2 effector responses in a mouse model of asthma. J Allergy Clin Immunol 114: 166–173. 15241361[CrossRef][Medline]
Walunas TL, Lenschow DJ, Bakker CY, Linsley PS, Freeman GJ, Green JM, Thompson CB, and Bluestone JA (1994) CTLA-4 can function as a negative regulator of T cell activation. Immunity 1: 405–413. 7882171[CrossRef][Medline]
Zuany-Amorim C, Sawicka E, Manlius C, Le Moine A, Brunet LR, Kemeny DM, Bowen G, Rook G, and Walker C (2002) Suppression of airway eosinophilia by killed Mycobacterium vaccae-induced allergen-specific regulatory T-cells. Nat Med 8: 625–629. 12042815[CrossRef][Medline]

This article has been cited by other articles:

				K.-I. Inoue, E. Koike, H. Takano, R. Yanagisawa, T. Ichinose, and T. Yoshikawa Effects of Diesel Exhaust Particles on Antigen-Presenting Cells and Antigen-Specific Th Immunity in Mice Experimental Biology and Medicine, February 1, 2009; 234(2): 200 - 209. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.106.119214v1 321/3/938    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Crosby, J. R. Articles by Gregory, S. A. Search for Related Content PubMed PubMed Citation Articles by Crosby, J. R. Articles by Gregory, S. A.