![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL
Departments of Pharmacology and Toxicology (C.G., H.Z., D.K., C.K., M.A., C.H.G., H.O., A.G.), Oral and Maxillofacial Surgery (F.P.), and Molecular Pathology (K.K.), University Hospital Tuebingen, Tuebingen, Germany
Received April 11, 2006; accepted June 29, 2006.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
-adrenergic receptors had no effect on EPO secretion. High-salt (HS) diet reduced EPO secretory response at 600 ppm CO by 55% compared with INN rats on normal salt diet (p < 0.01). In addition, DNX increased EPO secretion in rats on low-salt and HS diet, whereas plasma renin activity did not correlate with EPO levels under these experimental conditions. In summary, our data suggest that renal nerves contribute to the half-maximal EPO secretory response to CO exposure, possibly via NPY receptors.
; Jelkmann and Metzen, 1996). EPO secretion and renal mRNA content are inversely correlated to renal oxygen supply (Scholz et al., 1991). Because renal ischemia in isolated perfused kidneys elicited a much weaker EPO secretory response compared with systemic hypoxia in vivo, it was postulated that additional factors such as nerves and humoral factors may contribute to EPO secretory response to hypoxia (Pagel et al., 1989).
Despite that multiple studies have investigated the role of renal nerves on EPO secretion, the published data are contradictory. Beynon (1977). reported increased EPO levels in rats exposed to 6 h of hypoxia (10% O2) following denervation (DNX) of the left kidney and after contralateral nephrectomy compared with control rats with intact renal nerves. In contrast Fink and Fisher (1976) found reduced EPO levels in rabbits exposed to 5 h of hypoxia (0.42 atmospheres) following bilateral renal denervation in control animals. Eckardt et al. (1992) showed in rats that denervation of one kidney does not effect EPO mRNA following systemic exposure to hypoxia, hemorrhage, and carbon monoxide (CO) compared with the contralateral innervated control kidney.
Moreover, combination of renal denervation and -adrenergic receptor blockade showed to inhibit the hypoxia-stimulated EPO secretion compared with controls (Fink and Fisher, 1976). However, Jelkmann et al. (1979) could not confirm these findings, since his group reported unchanged EPO levels following long-term administration of a selective 2-adrenergic agonist in rabbits (Jelkmann et al., 1979). Studies in humans showed that EPO secretion was higher following administration of fenoterol, a 2-adrenergic receptor agonist following hemorrhage and under normoxic conditions (Gleiter et al., 1997, 1998; Freudenthaler et al., 1999a). Despite these efforts, the role of renal nerves on EPO secretion remains only poorly understood.
Neuropeptide Y (NPY), another cotransmitter of the sympathetic nervous system, is discussed to be involved in regulation of EPO secretion. NPY is present in almost all renal sympathetic nerve endings (Chevendra and Weaver, 1992) and was shown to be absent in kidneys following renal denervation (Chevendra and Weaver, 1992; Eckardt et al., 1992). Furthermore NPY is involved in renal hemodynamics by inducing vasoconstriction, with only little effect on glomerular filtration rate (Bischoff and Michel, 1998).
Another systemic factor that could modulate renal EPO secretion is the renin-angiotensin system. Infusion of angiotensin II (AII) into the renal artery of dogs and an increase of endogenous AII following reduction of renal perfusion pressure increased EPO serum levels (Fisher et al., 1967). Studies in human volunteers demonstrated that elevation of plasma renin activity (PRA) and thus AII levels, as well as intravenous infusion of AII, elevated EPO concentrations in a dose-dependent manner. These effects were greatly reduced by administration of the AII receptor antagonist losartan (Freudenthaler et al., 1999a, 2000; Gossmann et al., 2001). However, alteration of endogenous angiotensin II levels following high-(HS) and low-salt (LS) diet showed no effect on EPO secretion in healthy volunteers (Freudenthaler et al., 2003), whereas high-salt diet increased EPO concentrations in essential hypertensive patients (Naomi et al., 1993).
Because the current data about the role of renal nerves on EPO secretion are equivocal and because the impact of renal nerves on EPO secretion has never been investigated systematically, we reassessed the role of renal nerves on EPO secretion by constructing a dose-response relationship between the degree of hypoxia and EPO secretion. Furthermore, we investigated the effect of agonists and antagonists of -adrenergic and NPY receptors on EPO secretion. To alter endogenous AII levels, we chose high- and low-salt diet for 3 weeks as a long-term modulator of inhibition and stimulation of PRA, respectively, of EPO.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Experimental Design and Groups. Seven days following bilateral renal DNX, rats were exposed to different CO concentrations. Innervated kidneys in INN rats served as controls. For constructing a dose-response relationship in DNX and INN rats, we used five to eight rats for each CO concentration (0-1000 ppm). To compensate for the lack of transmitter release in DNX rats, we administered [Leu31, Pro34]-NPY (0.3 µg/min/kg) or isoproterenol (ISO; 3 µg/h/kg) i.v. via osmotic minipumps implanted 12 h before exposure to 600 ppm CO. To block these neurotransmitters in control rats, we administered in INN rats the -adrenergic receptor blocker propranolol (PROP; 4 mg/kg, i.p. 1 h before CO exposure) or NPY1 receptor antagonist (ANPY; 0.5 µg/min/kg i.v. via osmotic minipump implanted 12 h before CO exposure). To change the endogenous angiotensin II concentration in the plasma, we studied the effect of DNX on EPO serum concentrations in rats on high-(HS + DNX) and low-salt (LS + DNX) diet compared with controls without DNX (HS and LS) before exposure to 600 ppm CO. Rats were sacrificed after 4 h of CO exposure for taking blood samples and harvesting kidneys, which were stored at -80°C until analysis.
Renal Bilateral Denervation. Bilateral renal DNX was carried out in anesthetized rats with 70 mg/kg b.wt. ketamine i.p. (Parke-Davis, Freiburg, Germany) and 15 mg/kg b.wt. xylazine i.p. (Bayer, Leverkusen, Germany) as described previously (Muhlbauer et al., 1997). In brief, following abdominal midline incision, the renal arteries and veins were isolated and freed of connective tissue. After cutting all visible nerves, the vessels were painted for 2 min with a 10% phenolic alcohol solution. Sham denervation was performed under identical conditions of anesthesia with exposure of the left and right renal hilus for 2 to 4 min without destruction of renal nerves. Completeness of DNX was assessed by measuring renal norepinephrine content with high-pressure liquid chromatography (HPLC) at the end of CO exposure and was assumed to be achieved when the norepinephrine content was less than 15% of 200 ng/ml in innervated kidneys of control rats.
Implantation of Osmotic Minipumps. Rats were anesthetized with diethyl ether. A lateral 1.5-cm neck incision was made and the subcutaneous tissue was spread to form a pocket on the animal's back, and an Alzet osmotic minipump (1003D; Durect Corporation, Cupertino, CA) preloaded with the appropriate solution, was inserted. A polythene catheter fitted to the drug delivery portal of the osmotic minipump was inserted into the external jugular vein. Wounds were closed with nonreabsorptive material (Vicryl 3/0; Ethicon, Brussel, Belgium).
CO Experiments. CO was mixed with room air (inflow between 6 and 10 l/min) to generate CO concentrations between 200 and 1000 ppm CO in the cage. The actual CO concentration was monitored by a CO sensor (Testo, Reutlingen, Germany). Rats were exsanguinated under ether narcosis following 4 h of CO exposure, and blood was collected into serum tubes for determination of hematocrit, PRA, and EPO concentrations. Kidneys were freed from connective tissue, removed, and frozen immediately in liquid nitrogen by a freeze-clamp technique and stored at -80°C until measurement of catecholamines.
Analytics. Serum EPO concentrations were determined by enzyme-linked immunosorbent assay with a commercially available kit (Medac, Wedel, Germany). Arterial blood samples were analyzed for hematocrit. PRA was determined by its capacity to generate angiotensin I with addition of renin substrate by radioimmunoassay, as described previously (Albinus et al., 1998). For HPLC, correct renal denervation was assessed by measuring the renal tissue content of catecholamines using an HPLC method as described previously (Muhlbauer et al., 1997). For measurement of carboxyhemoglobin (HbCO), venous blood samples were stored at 0°C in an airtight closed hematokrit tube until measurement by spectrophotometry within 30 min after collection.
Real-Time Polymerase Chain Reaction. Total RNA from rat kidney was isolated using peqGold RNApure (PeqLab, Erlangen, Germany). Synthesis of cDNA was performed using oligo(dT15) and random hexamers as primers and avian myeloblastosis virus reverse transcriptase (PeqLab). PCR was carried out on the LightCycler instrument with the FastStart DNA Master SYBR Green I kit (Roche Diagnostics, Mannheim, Germany). Primer sequences used for amplification were as follows: EPO (RefSeq accession no. NM_017001
[GenBank]
): sense, 5'-1272CACGAAGCCATGAAGACAGA1291-3' and antisense, 5'-1372GGCTGTTGCCAGTGGTATTT1353-3'; and peptidyl prolyl isomerase A (PPIA) (NM_017101
[GenBank]
): sense, 5'-166GGGGAGAAAGGATTTGGCTA185-3' and antisense, 5'-422ACATGCTTGCCATCCAGCC404-3'. PPIA (cyclophilin A) served as internal control. Standard samples were included for comparison among different PCR runs. The relative expression ratio of the target gene EPO was calculated according to Pfaffl (2001).
In Situ Hybridization. Kidneys of control rats (INN) obtained after 4-h CO exposure to 400 and 1000 ppm were fixed in 4% paraformaldehyde/0.1 M sodium phosphate buffer, pH 7.2, overnight and embedded in paraffin. Five-micrometer tissue sections were dewaxed and hybridized as described previously (Klingel et al., 1992). Hybridization probes at a length of 502 base pairs were generated by in vitro transcription of a mouse EPO cDNA cloned into pGEM-3Z SP6 using T7 polymerase (antisense). The hybridization mixture [10 mM Tris-HCl, pH 7.4, 50% (v/v) deionized formamide, 600 mM NaCl, 1 mM EDTA, 0.02% polyvinylpyrrolidone, 0.02% Ficoll-Paque Plus, 0.05% bovine serum albumin, 10% dextran sulfate, 10 mM dithiothreitol, 200 µg/ml denatured sonicated salmon sperm DNA, and 100 µg/ml rabbit liver tRNA] contained either the 35S-labeled RNA antisense EPO or an unrelated plasmid vector control RNA probe at a concentration of 500 ng/ml. Hybridization with RNA probes proceeded at 42°C for 18 h. After washing steps, the slide preparations were dipped in NTB2 emulsion (Eastman Kodak, Rochester, NY) and exposed at 4°C for 3 weeks. After development, the slides were stained with hematoxylin and eosin.
Chemicals. All chemicals, the neuropeptide Y agonist [Leu31,Pro34]-NPY, the neuropeptide Y1 receptor antagonist Ile-Glu-Pro-Dapa-Tyr-Arg-Leu-Arg-Tyr-NH2, cyclic (2,4')(2',4) diamide (ANPY), PROP, and ISO were purchased from Sigma-Aldrich (Steinheim, Germany).
Statistical Methods. Data between the different groups were compared by the unpaired Student's t test, or by analysis of variance. All values are presented as mean ± S.E.M. p < 0.05 was considered to be statistically significant.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). Our in vivo data are in good agreement with those of Coburn and Forman (1987). Hematocrit values were between 44 and 48% after CO exposure in all groups.
|
|
Effect of Renal Nerves. EPO serum concentrations were significantly elevated following CO exposure (0-1000 ppm) in a dose-dependent manner in both INN and DNX rats, resulting in a 4-, 7-, 96-, and 190-fold increase following exposure to 200, 400, 800, and 1000 ppm CO, respectively (Fig. 3A). Renal EPO mRNA increased significantly in parallel to EPO serum levels following exposure to different CO concentrations compared with baseline concentrations without a difference between rats with or without renal denervation (Fig. 3B). EPO serum levels in DNX rats, however, were 2-fold higher following exposure to 600 ppm (527 ± 48 mU/ml) compared with INN rats (250 ± 41 mU/ml; p < 0.05; Fig. 3A), indicating a higher sensitivity of DNX rats to CO, which stimulates EPO secretion half-maximally. The increase of EPO serum concentrations at 600 ppm in rats with renal denervation was accompanied by a significant higher renal mRNA content in these rats compared with the respective INN rats (p < 0.05; Fig. 3B).
|
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). In contrast to the other studies, we determined completeness of renal denervation by measuring renal catecholamine content by a sensitive HPLC method (Muhlbauer et al., 1997). Furthermore, the bilateral denervation allows a direct comparison of changes in EPO serum concentrations and renal EPO mRNA content following denervation compared with controls. Exposure of rats to hypoxia was performed 7 days after denervation. In our model of CO-induced systemic hypoxia, we concentrated on the changes of EPO plasma levels. However, it should be mentioned that CO by itself can elicit specific effects on signaling in cells besides its hypoxia-dependent stimulation of EPO secretion. An extensive review on the action of CO in many tissues has been published by Wu and Wang (2005). Most recently, several studies reported on beneficial effects of low-dose CO (250 ppm) in pathophysiological conditions, such as postoperative ileus, endotoxic shock, and resuscitation of hemorrhagic shock (Mazzola et al., 2005; Moore et al., 2005; Zuckerbraun et al., 2005). Our analysis of the dose-dependent effects of CO on EPO secretion did not reveal an effect of renal innervation at low (200-400 ppm) or high (800-1000 ppm) CO concentrations. If CO can contribute to cell signaling, this effect is likely to be saturated and overridden by the severe reduction of oxygen delivery to the tissue, at least when EPO secretion is considered.
The dose-dependent increase of EPO serum concentrations and renal EPO mRNA, after exposure to different CO concentrations, was similar in INN and DNX rats. However, DNX rats revealed a significant higher EPO secretory response after exposure to 600 ppm compared with INN rats. In previous studies, animals were exposed to only severe and nearly maximal hypoxic stimuli (1000 ppm, 10% O2 or 0.42 atmospheres over 4, 6, or 5 h, respectively) (Fink and Fisher, 1976; Beynon, 1977; Eckardt et al., 1992). Therefore, an effect of renal nerves on EPO secretion at half-maximal stimulation could not be detected in these experiments. The increase of EPO serum concentrations as well as EPO mRNA after exposure to 1000 ppm CO in our study is in good agreement with the increases reported by Eckardt et al. (1992). The lack of an effect of renal denervation after exposure to 1000 ppm further suggests that this severe hypoxic stimulus with HbCO concentrations of 56% caused a maximum of EPO secretory response independent of renal innervation and plasma renin activity. Furthermore, increased circulating catecholamines during severe hypoxia could mask modulations of EPO production by renal nerves, as suggested previously by Fink et al. (1975). The difference of EPO secretory response after 600 ppm CO exposure could be the result of different changes in hemodynamic and tubular transport characteristics between INN and DNX. It is conceivable that denervated kidneys do not respond to centralization of circulating blood with renal vasoconstriction and subsequent fall in glomerular filtration rate to the same extent as innervated kidneys. Besides catecholamines, NPY also is a potent renal vasoconstrictor (Bischoff and Michel, 1998). Because a higher glomerular filtration rate imposes to the tubular system a higher workload for electrolyte reabsorption, renal interstitial oxygen partial pressure may be even lower in DNX compared with INN at 600 ppm CO and thus stimulate EPO secretion further. To address this question, in future experiments, it would be necessary to carry out experiments in anesthetized rats to measure single nephron glomerular filtration rate and local tissue oxygen partial pressure, especially in the outer medullary region where most of the EPO-secreting cells are located.
Another possibility for renal nerves to modulate EPO secretion at 600 ppm CO could be the afferent nerve traffic originating from the kidney after ischemia (Recordati et al., 1981; Bischoff and Michel, 1998). Because it has been proposed that the central nervous system is involved in the regulation of EPO secretion (von Wussow et al., 2005), the interrupted input of afferent renal nerve discharge for 7 days may have discrete effects on central nervous system-dependent control of EPO secretion.
To address the role of NPY, present in renal nerve endings (Eckardt et al., 1992), we examined the action of an agonist and an antagonist of NPY receptors. We have chosen a dose of NPY and of its antagonist against Y1 receptors that was found to be without effect on mean arterial pressure and renal hemodynamics in normoxic rats (Pelayo et al., 1989; Bischoff et al., 1997; Bischoff and Michel, 1998). A parenteral route of application of the NPY receptor agonist 12 h before the CO exposure was used to ensure constant NPY plasma levels during the 4-h CO exposure. Interestingly, NPY reversed the enhanced EPO response to 600 ppm CO in DNX rats. Whether NPY can reverse the assumed changes in renal hemodynamics and tubular transport rates (see above) or NPY has a direct inhibitory effect on EPO-secreting cells remains to be established. Correspondingly, administration of an NPY receptor antagonist in INN rats increased the EPO secretory response, although this increase did not reach significance (Fig. 4).
In contrast, neither -adrenergic stimulation in DNX nor blockade in INN rats had an effect on EPO secretion. Since Fisher et al. (1975) reported decreased EPO concentrations following administration of 4 mg/kg propranolol, we have chosen this dose for our experiments in INN rats. We administered a subpressoric dose of isoproterenol, which has been shown to not alter hemodynamics (Pelayo et al., 1989). Because of the relatively short half-life of isoproterenol in the plasma, we administered isoproterenol i.v. via Alzet pumps. Thus, the lack of an effect of propranolol and isoproterenol on EPO production in our study is not likely to be due to an insufficient dose. The data in the literature concerning the role of -adrenergic receptors on EPO production are contradictory, because it could be shown that a combination of renal denervation and -adrenergic receptor blockade inhibited the hypoxia-stimulated EPO secretion (Fink and Fisher, 1976), whereas Jelkmann et al. (1979) reported unchanged EPO levels following long-term administration of a selective 2-adrenergic agonist. Our experiments with -adrenergic agonists and antagonists argue against a significant role in CO-induced EPO secretion. The differences between our results and those of the literature may reflect differences in the experimental protocols and species.
In the second series of experiments, we chose to feed rats with an HS and LS diet over 3 weeks to change PRA and thus endogenous angiotensin levels. HS diet exhibited a significant reduced EPO secretory response at 600 ppm CO. This inhibition was abolished by bilateral denervation compared with INN rats on normal diet, suggesting that renal innervation is required for the expression of the EPO secretory response to HS diet. Rats kept on LS diet with DNX responded to CO exposure with significantly increased EPO levels as HS rats. In contrast, rats kept on LS diet with intact renal innervation (INN) did not respond with a change of EPO serum levels compared with control rats on NS diet (Fig. 5), in spite of very high PRA.
In animal and human studies, elevation of plasma renin activity or administration of angiotensin II was shown to increase EPO secretion (Fisher et al., 1967; Gould et al., 1973; Freudenthaler et al., 1999b; Gossmann et al., 2001). Furthermore, Kato et al. (2005) reported an overproduction of EPO in mice harboring the human renin and human angiotensinogen genes. When both genes were introduced into the AT1a receptor null background erythrocytosis was normalized, strongly supporting that angiotensin II was responsible for EPO overproduction. Since these studies are performed under normoxic conditions and since endogenous angiotensin following LS diet did not increase EPO secretory response in our study, we conclude that high PRA and therefore high levels of endogenous angiotensin II do not contribute significantly to EPO secretory response following CO exposure in rats.
The rat group that received a nearly maximal NaCl loading (HS) had a very low PRA and most likely very low plasma angiotensin II levels. These rats responded to 600 ppm CO exposure with a reduced EPO secretion. This observation would be in line with the above-mentioned findings that angiotensin II can stimulate EPO secretion. The lack of a tight correlation between EPO levels and mRNA in HS rats may be due to 1) simple data scatter or 2) reflect a reduced translational efficiency of EPO mRNA or 3) a diminished half-life of EPO in the blood under this high-salt-loading condition.
In summary, our data show that renal nerves modulate EPO secretion only at half-maximal CO concentrations. The increase in EPO serum concentrations following exposure to 600 ppm by bilateral renal denervation was reversed by NPY. Therefore, our data suggest that renal nerves exhibit an inhibition on EPO-producing cells after CO exposure mainly through release of NPY. This notion is supported by the observation that HS-induced reduction of EPO secretion was also blocked by denervation. Rats on LS showed a similar EPO response to denervation as rats on normal salt diet, suggesting that high endogenous angiotensin levels do not contribute to the control of EPO secretion in a LS condition. The mechanism of the inhibition of EPO secretion by release of the renal neurotransmitter NPY remains to be determined.
|
Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: EPO, erythropoietin; DNX, bilateral renal denervation; CO, carbon monoxide; NPY, neuropeptide Y; AI, angiotensin I; AII, angiotensin II; PRA, plasma renin activity; HS, high-salt diet; LS, low-salt diet; INN, intact renal innervation; ISO, isoproterenol; PROP, propranolol; ANPY, NPY antagonist; HPLC, high-performance liquid chromatography; HbCO, carboxyhemoglobin; PCR, polymerase chain reaction; NS, normal salt; veh, vehicle.
Address correspondence to: Dr. Almut Grenz, Department of Pharmacology and Toxicology, University Hospital Tuebingen, D-72074 Tuebingen, Germany. E-mail: almut.grenz{at}uni-tuebingen.de
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Albinus M, Finkbeiner E, Sosath B, and Osswald H (1998) Isolated superfused juxtaglomerular cells from rat kidney: a model for study of renin secretion. Am J Physiol 275: F991-F997.[Medline]
Beynon G (1977) The influence of the autonomic nervous system in the control of erythropoietin secretion in the hypoxic rat. J Physiol (Lond) 266: 347-360.
Bischoff A, Avramidis P, Erdbrugger W, Munter K, and Michel MC (1997) Receptor subtypes Y1 and Y5 are involved in the renal effects of neuropeptide Y. Br J Pharmacol 120: 1335-1343.[CrossRef]
Bischoff A and Michel MC (1998) Renal effects of neuropeptide Y. Pflueg Arch Eur J Physiol 435: 443-453.[CrossRef][Medline]
Chevendra V and Weaver LC (1992) Distributions of neuropeptide Y, vasoactive intestinal peptide and somatostatin in populations of postganglionic neurons innervating the rat kidney, spleen and intestine. Neuroscience 50: 727-743.[CrossRef][Medline]
Coburn RF and Forman HJ (1987) Carbon monoxide toxicity, in Handbook of Physiology (Fishman AP ed) pp 439-456, American Physiological Society, Bethesda, MD.
Eckardt KU, LeHir M, Tan CC, Ratcliffe PJ, Kaissling B, and Kurtz A (1992) Renal innervation plays no role in oxygen-dependent control of erythropoietin mRNA levels. Am J Physiol 263: F925-F930.[Medline]
Fink GD and Fisher JW (1976) Erythropoietin production after renal denervation or beta-adrenergic blockade. Am J Physiol 230: 508-513.
Fink GD, Paulo LG, and Fisher JW (1975) Effects of beta adrenergic blocking agents on erythropoietin production in rabbits exposed to hypoxia. J Pharmacol Exp Ther 193: 176-181.
Fisher JW, Samuels AI, and Langston JW (1967) Effects of angiotensin and renal artery constriction on erythropoietin production. J Pharmacol Exp Ther 157: 618-625.
Freudenthaler S, Benohr P, Grenz A, Selzer T, Schmidt T, Morike K, Osswald H, and Gleiter CH (2003) Do alterations of endogenous angiotensin II levels regulate erythropoietin production in humans?. Br J Clin Pharmacol 56: 378-387.[CrossRef][Medline]
Freudenthaler SM, Lucht I, Schenk T, Brink M, and Gleiter CH (2000) Dose-dependent effect of angiotensin II on human erythropoietin production. Pflueg Arch Eur J Physiol 439: 838-844.[CrossRef][Medline]
Freudenthaler SM, Schenck T, Lucht I, and Gleiter CH (1999a) Fenoterol stimulates human erythropoietin production via activation of the renin angiotensin system. Br J Clin Pharmacol 48: 631-634.[CrossRef][Medline]
Freudenthaler SM, Schreeb K, Korner T, and Gleiter CH (1999b) Angiotensin II increases erythropoietin production in healthy human volunteers. Eur J Clin Investig 29: 816-823.[CrossRef][Medline]
Gleiter CH, Becker T, Schreeb KH, Freudenthaler S, and Gundert-Remy U (1997) Fenoterol but not dobutamine increases erythropoietin production in humans. Clin Pharmacol Ther 61: 669-676.[CrossRef][Medline]
Gleiter CH, Schreeb KH, Goldbach S, Herzog S, Cunze T, and Kuhn W (1998) Fenoterol increases erythropoietin concentrations during tocolysis. Br J Clin Pharmacol 45: 157-159.[CrossRef][Medline]
Gossmann J, Burkhardt R, Harder S, Lenz T, Sedlmeyer A, Klinkhardt U, Geiger H, and Scheuermann EH (2001) Angiotensin II infusion increases plasma erythropoietin levels via an angiotensin II type 1 receptor-dependent pathway. Kidney Int 60: 83-86.[CrossRef][Medline]
Gould AB, Goodman SA, and Green D (1973) An in vivo effect of renin on erythropoietin formation. Lab Investig 28: 719-722.
Jelkmann W (1992) Erythropoietin: structure, control of production, and function. Physiol Rev 72: 449-489.
Jelkmann W, Beckman B, and Fisher JW (1979) Enhanced effects of hypoxia on erythropoiesis in rabbits following -2 adrenergic activation with albuterol. J Pharmacol Exp Ther 211: 99-103.
Jelkmann W and Metzen E (1996) Erythropoietin in the control of red cell production. Ann Anat 178: 391-403.[Medline]
Kato H, Ishida J, Imagawa S, Saito T, Suzuki N, Matsuoka T, Sugaya T, Tanimoto K, Yokoo T, Ohneda O, et al. (2005) Enhanced erythropoiesis mediated by activation of the renin-angiotensin system via angiotensin II type 1a receptor. FASEB J 19: 2023-2025.
Klingel K, Hohenadl C, Canu A, Albrecht M, Seemann M, Mall G, and Kandolf R (1992) Ongoing enterovirus-induced myocarditis is associated with persistent heart muscle infection: quantitative analysis of virus replication, tissue damage, and inflammation. Proc Natl Acad Sci USA 89: 314-318.
Mazzola S, Forni M, Albertini M, Bacci ML, Zannoni A, Gentilini F, Lavitrano M, Bach FH, Otterbein LE, and Clement MG (2005) Carbon monoxide pretreatment prevents respiratory derangement and ameliorates hyperacute endotoxic shock in pigs. FASEB J 19: 2045-2047.
Moore BA, Overhaus M, Whitcomb J, Ifedigbo E, Choi AM, Otterbein LE, and Bauer AJ (2005) Brief inhalation of low-dose carbon monoxide protects rodents and swine from postoperative ileus. Crit Care Med 33: 1317-1326.[CrossRef][Medline]
Muhlbauer B, Spohr F, Schmidt R, and Osswald H (1997) Role of renal nerves and endogenous dopamine in amino acid-induced glomerular hyperfiltration. Am J Physiol 273: F144-F149.[Medline]
Naomi S, Umeda T, Iwaoka T, Yamauchi J, Ideguchi Y, Fujimoto Y, Tokunaga H, and Sato T (1993) Endogenous erythropoietin and salt sensitivity of blood pressure in patients with essential hypertension. Am J Hypertens 6: 15-20.[Medline]
Pagel H, Jelkmann W, and Weiss C (1989) O2-supply to the kidneys and the production of erythropoietin. Respir Physiol 77: 111-117.[CrossRef][Medline]
Pelayo JC, Tucker BJ, and Blantz RC (1989) Effects of beta-adrenergic stimulation with isoproterenol on glomerular hemodynamics. Am J Physiol 257: F866-F873.[Medline]
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45.
Recordati G, Moss NG, Genovesi S, and Rogenes P (1981) Renal chemoreceptors. J Auton Nerv Syst 3: 237-251.[CrossRef][Medline]
Scholz H, Schurek HJ, Eckardt KU, Kurtz A, and Bauer C (1991) Oxygen-dependent erythropoietin production by the isolated perfused rat kidney. Pflueg Arch Eur J Physiol 418: 228-233.[CrossRef][Medline]
von Wussow, Klaus J, and Pagel H (2005) Is the renal production of erythropoietin controlled by the brain stem? Am J Physiol 289: E82-E86.
Wu L and Wang R (2005) Carbon monoxide: endogenous production, physiological functions, and pharmacological applications. Pharmacol Rev 57: 585-630.
Zuckerbraun BS, McCloskey CA, Gallo D, Liu F, Ifedigbo E, Otterbein LE, and Billiar TR (2005) Carbon monoxide prevents multiple organ injury in a model of hemorrhagic shock and resuscitation. Shock 23: 527-532.[Medline]
This article has been cited by other articles:
|
|
 |
|
  A. Grenz, H. Zhang, J. Weingart, S. von Wietersheim, T. Eckle, J. Schnermann, C. Kohle, D. Kloor, C. H. Gleiter, V. Vallon, et al. Lack of effect of extracellular adenosine generation and signaling on renal erythropoietin secretion during hypoxia Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1501 - F1511. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
