QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.106.104505v1 318/3/1108    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Broad, L. M. Articles by Sher, E. Search for Related Content PubMed PubMed Citation Articles by Broad, L. M. Articles by Sher, E.

NEUROPHARMACOLOGY

Identification and Pharmacological Profile of a New Class of Selective Nicotinic Acetylcholine Receptor Potentiators

Eli Lilly and Company Ltd., Lilly Research Centre, Windlesham, Surrey, United Kingdom (L.M.B., R.Z., K.H.P., M.L., L.W., G.I.M., C.P.D., S.R.B., E.S.); and Lilly Corporate Center, Indianapolis, Indiana (R.E., S.P.H.).

Received March 27, 2006; accepted May 30, 2006.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Here we report the discovery, by high-throughput screening, of three novel (2-amino-5-keto)thiazole compounds that act as selective potentiators of nicotinic acetylcholine receptors. Compound selectivity was assessed at seven human nicotinic acetylcholine receptors (11, 24, 32, 34, 42, 44, and 7) expressed in mammalian cells or Xenopus oocytes. At 24, 42, 44, and 7, but not 11, 32, or 34, submaximal responses to nicotinic agonists were potentiated in a concentration-dependent manner by all compounds. At similar concentrations, no potentiation of 5-hydroxytryptamine, -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, GABA_A, and N-methyl-D-aspartate receptors or voltage-gated Na⁺ and Ca²⁺ channels was observed. Furthermore, these compounds did not inhibit acetylcholine esterase. Further profiling revealed that these compounds enhanced the potency and maximal efficacy of a range of nicotinic agonists at 42 nicotinic acetylcholine receptors, a profile typical of allosteric potentiators. At concentrations required for potentiation, the compounds did not displace [³H]epibatidine from the agonist-binding site, and potentiation was observed at all agonist concentrations, suggesting a noncompetitive mechanism of action. Blockade of common second messenger systems did not affect potentiation. At concentrations higher then required for potentiation the compounds also displayed intrinsic agonist activity, which was blocked by competitive and noncompetitive nicotinic acetylcholine receptor (nAChR) antagonists. These novel selective nicotinic receptor potentiators should help in clarifying the potential therapeutic utility of selective nAChR modulation for the treatment of central nervous system disorders.

Seventeen distinct nAChR subunits have been identified. Nicotinic receptors of the neuromuscular junction are composed of 1, 1, , and or , with a stoichiometry of ₂(), whereas neuronal nAChRs are composed of either heteromeric (2–6 and 2–4) or homomeric (7–10) subunit combinations. The subunit composition and stoichiometry of native neuronal nAChRs is not fully defined, although peripheral ganglionic nAChRs contain the 3 subunits and nAChRs with 42 or 7 subunits are broadly expressed in the central nervous system (McGehee and Role, 1995).

There is currently significant interest in the development of selective nAChR agonists and positive allosteric modulators for the treatment of various neurological and psychiatric disorders (Lloyd and Williams, 2000; Astles et al., 2002). This interest stems from several lines of evidence implicating nAChRs in both physiological and pathological mechanisms in the central nervous system.

7 and 42 nAChRs are normally expressed at high levels in areas involved in learning and memory and play a physiological role in the modulation of neurotransmission within these regions (Dani, 2001; Sher et al., 2004). Under pathological conditions, such as in Parkinson's and Alzheimer's disease or schizophrenia, reduced cholinergic activity and loss or malfunction of nAChRs are common features and can be correlated to cognitive deficits and progressive dementia (Leonard et al., 2000; Court et al., 2001; Quik and Kulak, 2002). The involvement of nAChRs in the modulation of cognitive function has been demonstrated in both animal models and clinical studies (Levin and Rezvani, 2000). In animal models, improvements in memory performance can be obtained using nonselective nAChR agonists, such as nicotine and epibatidine, whereas nAChR antagonists such as mecamylamine and dihydro--erythroidine induce learning impairments. In clinical studies, broad nAChR agonists are similarly reported to improve attention, memory, and learning in both normal and disease states (Levin and Rezvani, 2000). The therapeutic utility of nonselective nAChR agonists, however, is limited by a low therapeutic index, mainly caused by activation of the autonomic nervous system and, possibly, muscle receptors. The expectation that selective central nAChR agonists may show a better side effect profile, while retaining efficacy, is supported by the recent development of subtype selective nAChR agonists, which confirmed a role for 7 and 42 nAChR subtypes in the modulation of cognitive function in animal models (Lippiello et al., 1996; Meyer et al., 1997; Gatto et al., 2004).

A more physiological approach for targeting central nAChRs is through the use of positive allosteric modulators, which would potentiate the receptor only when the endogenous cholinergic system is operating and would not chronically stimulate the receptors themselves. However, selective nAChR potentiators are only recently starting to emerge (Hurst et al., 2005; Sher et al., 2005), and the nonselective potentiators currently available are not suitable for examining their therapeutic value in animal models or clinical studies. For example, 5-hydroxyindole has been shown to selectively potentiate 7 nAChRs compared with other nAChR subtypes (Zwart et al., 2002) but is active only at high micromolar to millimolar concentrations and displays cross-reactivity at 5-HT₃Rs (Kooyman et al., 1993). Ivermectin displays selectivity for 7 over other nAChR subtypes (Krause et al., 1998) but also acts on glycine (Shan et al., 2001) and purinergic 2X receptors (Khakh et al., 1999). Interestingly, galantamine, an acetylcholine (ACh) esterase inhibitor used for the treatment of Alzheimer's disease, is reported to act also as a positive allosteric modulator of nAChRs, and this activity might underlie part of its clinical efficacy (Maelicke et al., 2000; Woodruff-Pak et al., 2002). However, galantamine is not selective across the nAChR subtypes, it also modulates NMDA receptors (Moriguchi et al., 2004), and it is an ACh esterase inhibitor.

We recently performed a high-throughput screen of a large Eli Lilly proprietary chemical library on recombinant human nAChRs, using a calcium dye and the fluorescent imaging plate reader (FLIPR) technology. The screening protocols were designed to allow for the identification of both agonist and antagonists and potentiators. The present study reports on the identification of a novel chemical class of selective nicotinic receptor modulators that potentiate central but not ganglionic or neuromuscular nAChRs.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
nAChR Expression in Xenopus Oocytes and Electrophysiological Characterization. Adult female Xenopus laevis frogs were obtained from Blades Biological (Edenbridge, UK) and housed at Lilly, Windlesham (Surrey, UK), according to Home Office regulations.

All experimental protocols have been detailed previously (Zwart et al., 2002). In brief, nuclei of stages V and VI oocytes were injected with plasmids containing human 7, 4, 3, 2, or 4 nicotinic receptor subunits (in pcDNA3) using a Drummond variable volume microinjector (Drummond Scientific, Broomall, PA). Approximately 2 ng of 7, or a combination of 1 ng of 4 or 3 and 1 ng of 2 or 4, was injected into each oocyte in a total injection volume of 18.4 nl. After cDNA injection, oocytes were incubated for 3 to 5 days at 18°C in a modified Barth's solution [88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO₃, 0.3 mM Ca(NO₃)₂, 0.41 mM CaCl₂, 0.82 mM MgSO₄, 15 mM HEPES, and 50 mg/l neomycin, pH 7.6, 235 mOsm] before experiments.

During experiments, oocytes were placed in a recording chamber and continuously superfused with saline (115 mM NaCl, 2.5 mM KCl, 1.8 mM CaCl₂, 10 mM HEPES, pH 7.3, 235 mOsm), at a rate of 10 ml/min. A BPS-8 solution exchange system (ALA Scientific Inc., Westbury, NY) was used to switch between control and drug-containing saline. Oocytes were superfused with drug-free solution for 5 min (2 min for 7) between agonist applications to allow the nAChRs to recover from desensitization. Single oocytes were used for each concentration of potentiator tested because effects of potentiation were slow to reverse. All experiments were performed at room temperature.

Currents were recorded from oocytes impaled by two microelectrodes filled with 3 M KCl (0.5–2.5 M), and a holding potential of –60 mV was applied, using a Geneclamp 500B amplifier (Axon Instruments, Foster City, CA). Membrane currents were filtered (four-pole low-pass Bessel filter, –3 dB at 1 kHz), digitized (1000 samples/record), and stored on disk for off-line computer analysis.

Mammalian Cell Culture. All cells were grown at 37°C in a humidified incubator with 95% air and 5% CO₂. HEK-293 cells stably expressing human recombinant 24, 32, 34, 42, or 44 nAChRs, chimeric human 7/mouse 5-HT₃ receptors, or human 5-HT₃ receptors were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin, 4 mM glutamine, and 50 µg/ml geneticin. Rhabdomyosarcoma cells were cultured in the same medium as detailed above, without geneticin. GH4 cells stably expressing human recombinant 7 receptors were cultured in F-10 nutrient mixture supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin, 4 mM glutamine, and 50 µg/ml geneticin.

For FLIPR experiments, all cell lines, except 32 nAChRs, were plated at 0.5 or 1.0 x 10⁶ cells/ml (100 µl/well) into poly-D-lysine-coated 96-well plates and incubated overnight, at 37°C, before assaying. HEK cells expressing 32 nAChRs, however, were plated 48 h before use and incubated at 29°C to aid functional receptor expression.

For the preparation of primary cultures of cortical neurons, used for the study of native AMPA, GABA_A, and NMDA receptors and voltage-gated Ca²⁺ and Na⁺ channels, pregnant Sprague-Dawley rats (Harlan, Bicester, Oxon, UK) were anesthetized in a CO₂ atmosphere and subsequently killed by dislocation of the neck, according to standard licensed procedures. Cortices of the 17- to 18-day-old fetuses were dissected, trypsinized, and triturated, and the isolated cells were plated onto poly-D-lysine-coated 96-well microtiter plates (BioCoat; BD Biosciences, San Jose, CA) at a density of 6.6 x 10⁵ cells/ml, in a volume of 0.1 ml of neurobasal medium containing B27 supplement (GIBCO BRL, Gaithersburg, MD) and incubated for 7 to 9 days before use.

Cell Population Calcium Measurements Using a FLIPR. Experimental protocols have been detailed previously (Craig et al., 2004). In brief, cells in 96-well plates were loaded with 10 µM Fluo-3-AM/0.05% Pluronic F-127 in Tyrode's buffer (137 mM NaCl, 2.7 mM KCl, 2.5 mM CaCl₂, 1 mM MgCl₂, 12 mM NaHCO₃, 0.2 mM NaHPO₄, and 5.5 mM glucose, pH 7.3) by incubation at room temperature in the dark. After 1 h, media were replaced with Tyrode's buffer in the absence of Fluo-3, and cell plates were transferred to a FLIPR (Molecular Devices, Sunnyvale, CA) for experiments. Fluorescence was recorded every 1 s for 60 s, and drug addition was made after 10 s to allow an initial baseline to be viewed. Once added, drugs were present for the duration of the experiments. Parameters for drug addition to the cell plate were programmed using FLIPR system software, and compound delivery was automated through a 96-tip head pipetter. Responses were measured as peak fluorescence minus basal fluorescence intensity and are expressed as a percentage of a maximal agonist response. For potentiation experiments, the EC_10–40 values for epibatidine used to assess potentiator activity were 1 nM for 24 and 44, 5 nM for 34 and 42, 10 nM for 32, and 20 nM for 7 nAChRs and 1-muscle nAChRs. For cross-reactivity experiments, EC_70–90 agonist concentrations were selected to assess compound activity and were 30 nM epibatidine (42 nAChRs), 1 µM 5-HT (5-HT₃Rs), 3 µM AMPA (AMPA receptors), 10 µM NMDA (NMDA receptors), 1 µM GABA (GABA_ARs), 3 µM veratridine (voltage-gated Na⁺ channels), or 25 mM K⁺_ex (voltage-gated Ca²⁺ channels), respectively. All drugs were prepared in 96-well plates by hand or using a Biomek 2000 (Beckman Instruments Inc., Fullerton, CA). Data files were saved to the computer and stored for off-line analysis using FLIPR system software, Microsoft Excel (Microsoft, Redmond, WA), and Origin 6.1 (OriginLab Corp, Northampton, MA). Statistical analysis was performed to determine significant differences (p < 0.05) using Student's t test.

Membrane Preparation for Binding Assays. Cell pastes from large-scale production of HEK-293 cells expressing human 42, 44, or 34 nAChRs were homogenized in 4 volumes of Tris buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM KCl, pH 7.4). The homogenate was centrifuged twice (40,000g, 10 min, 4°C), and the pellets were resuspended in 4 volumes of Tris buffer after the first spin and 8 volumes after the second spin. The resuspended homogenate was centrifuged (100g, 10 min, 4°C), and the supernatant was kept and recentrifuged (40,000g, 20 min, 4°C). The pellet was resuspended in Tris buffer supplemented with 10% (w/v) sucrose. The membrane preparation was stored in 1-ml aliquots at –80°C until required. The protein concentration of the membrane preparation was determined using a bicinchoninic acid protein assay reagent kit.

Nicotinic Receptor Radioligand Binding Scintillation Proximity Assay. Ninety-six-well SPA radioligand binding assays were performed in a final volume of 250 µl of Tris buffer with 1 (42, 44) or 2 (34) nM [³H]epibatidine (53 Ci/mmol; GE Healthcare, Little Chalfont, Buckinghamshire, UK), 1 (42, 44) or 1.5 (34) mg/well wheat germ agglutinin-coated polyvinyltoluene scintillation proximity assay (SPA) beads (GE Healthcare), and 30 µg/well membrane protein for all three nAChR types. Nonspecific binding (<10% for all three assays) was determined using 10 µM epibatidine. Reactions were allowed to equilibrate for 2 to 4 h at room temperature prior to reading on a Trilux Scintillation counter (PerkinElmer Life and Analytical Sciences, Boston, MA). Data were analyzed using a standard four-parameter logistic equation (Multicalc; PerkinElmer Life and Analytical Sciences) to provide IC₅₀ values that were converted to K_i values using the Cheng-Prusoff equation (Cheng and Prusoff, 1973).

Acetylcholinesterase Assay. The acetylcholinesterase assay was performed at Cerep, using an experimental protocol detailed previously (Ellman et al., 1961) and human recombinant acetylcholinesterase expressed in HEK-293 cells.

Materials. All expression constructs containing human nicotinic receptor subunit cDNA in pcDNA3 and stable cell lines expressing nAChRs were obtained from Merck Research Laboratories (La Jolla, CA). Chimeric human 7/mouse 5-HT₃ nicotinic receptors and the HEK 7/5-HT₃ receptor cell line were constructed as detailed previously (Craig et al., 2004). The complete coding sequence for the human 5-HT₃ receptor was amplified from a human hippocampus cDNA library (QUICK-Clone; BD Biosciences) using PCR. A 1519-bp fragment was isolated using primers designed to anneal to loci within the 5'- and 3'-untranslated regions of the 5-HT₃ sequence (GenBank accession no. D49394 [GenBank] ; forward primer, ACTCCTATGCTTGGAAAGCTC; reverse primer, AAATCCTCTGTCCCCACCTAA). This initial product was used as a template in a further round of PCR with nested primers that were modified to introduce BamHI and XhoI restriction sites at the 5' and 3' ends of the product, respectively (forward primer, TAATGGATCCTCGCTATGCTGCTGTGGGTCC; reverse primer, CAATCTCGAGCTAACCAGGACTGTACCCCCT). For expression studies, the product of the second PCR was ligated into the multiple cloning sequence of pcDNA3.1 (+) (Invitrogen, Paisley, UK) at the BamHI and XhoI sites. The sequence of the construct was verified by automated sequencing (Cytomyx, Cambridge, UK). A HEK cell line stably expressing this human 5-HT₃ receptor cDNA was developed after transfection of HEK cells using GenePorter (Gene Therapy Systems Inc., San Diego, CA) and growth under geneticin resistance selection (500 µg/ml). Clones were isolated under limiting dilution, and a final clone was selected by screening for function using a FLIPR.

2087101, 2087133, 1078733, and TC-2559 were synthesized at Lilly (Erl Wood, UK). ACh, nicotine, and mecamylamine were purchased from Sigma-RBI (Poole, UK). Epibatidine, cytisine, galantamine, dihydro--erythroidine (dHE), okadaic acid, and calyculin A were from Tocris Cookson (Bristol, UK). Phorbol myristate acetate (PMA), H-7, staurosporine, cholera toxin, pertussis toxin, and forskolin were from Calbiochem (San Diego, CA). Fluo-3-AM and Pluronic F-127 were from Molecular Probes (Leiden, The Netherlands). All cell culture reagents were from Sigma (Poole, Dorset, UK), except for fetal calf serum, which was from Invitrogen.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Potentiation of 24, 42, 44, and 7 nAChRs Stably Expressed in Mammalian Cells by 2087101, 1078733, and 2087133. The activity of three novel (2-amino-5-keto)thiazole compounds 2087101, 1078733, and 2087133 (Fig. 1) was assessed in mammalian cells expressing exogenous (24, 32, 34, 42, 44, 7) or endogenous (11) human nAChRs. Changes in intracellular calcium in response to nAChR stimulation were evaluated in populations of these cells using fluo-3 and a FLIPR (example traces, Fig. 2A). The ability of compounds 2087101, 1078733, and 2087133 to potentiate submaximal (EC_10–40) responses to epibatidine was assessed. Over the concentration range tested (1 nM-30 µM), each of the compounds caused a concentration-dependent potentiation of responses mediated by 24, 42, 44, and 7 but not 11, 34, or 32 nAChRs (Fig. 2B). 24 nAChRs were potentiated to a maximum of 221 ± 8, 170 ± 6, and 145 ± 4% of low epibatidine controls in the presence of 2087101, 2087133, and 1078733, respectively. The same values for 44 were 312 ± 6, 293 ± 8, and 200 ± 4%; for 42, 289 ± 12, 407 ± 20, and 350± %; and for 7, 275 ± 18, 227 ± 18, and 324 ± 15%.

View larger version (10K): [in this window] [in a new window]   Fig. 1. Chemical structures of three novel (2-amino-5-ke- to)thiazole compounds 2087101, 1078733, and 2087133.

View larger version (22K): [in this window] [in a new window]   Fig. 2. Potentiation of human 24, 42, 44, and 7 nAChRs but not 11, 32, or 34 nAChRs expressed in mammalian cells by 2087101, 1078733, and 2087133. A, example traces showing calcium responses in HEK cells stably expressing human 42 nAChRs after addition of a maximal (1 µM, solid line) or submaximal (5 nM) concentration of epibatidine, in the absence (dashed line) or presence (dotted line) of 3 µM 2087101, as indicated. B, concentration-dependent effects of compounds 2087101 (), 1078733 (*), and 2087133 () on submaximal (EC10–40) epibatidine-induced responses in mammalian cells expressing human 11, 24, 32, 34, 42, 44, and 7 nAChRs, as indicated. Data are mean ± S.E.M. from at least five similar experiments. Cells were preincubated with 1 nM to 30 µM 2087101, 1078733, and 2087133 for 10 min before addition of an EC10–30 epibatidine.

Potentiation of 42, 44, and 7 nAChRs Expressed in Xenopus Oocytes by 2087101, 1078733, and 2087133. The activity of compounds 2087101, 1078733, and 2087133 was confirmed using voltage-clamped Xenopus oocytes expressing exogenous human 42, 7, 44, 34, and 32 nAChRs. The effect of 3 µM 2087101, 1078733, and 2087133 on submaximal (EC_10–30) ACh-induced inward current responses was assessed after coapplication (heteromeric nAChRs) or a 2-min preincubation (7 nAChRs), as indicated (Fig. 3A). The amplitudes of submaximal ACh-induced responses (100%) at 42, 44, and 7 nAChRs were potentiated to 742 ± 63, 255 ± 32, and 369 ± 149% in the presence of 3 µM 2087101; 1274 ± 602, 695 ± 182, and 126 ± 28% in the presence of 3 µM 2087133; and 1939 ± 269, 853 ± 220, and 244 ± 16% in the presence of 3 µM 1078733, respectively. No potentiation of ACh-induced responses was observed in the presence of 2087101 (96 ± 9 and 89 ± 18%), 2087133 (96 ± 4 and 105 ± 3%), or 1078733 (87 ± 20 and 90 ± 7%) at 32 and 34 nAChRs, respectively, compared with controls.

View larger version (28K): [in this window] [in a new window]   Fig. 3. Potentiation of human 42, 44, and 7 nAChRs but not 32 or 34 nAChRs expressed in Xenopus oocytes by 2087101, 1078733, and 2087133. A, example traces showing inward currents in voltage-clamped Xenopus oocytes expressing nAChRs in response to superfusion with a submaximal (EC10–30) concentration of acetylcholine in the absence or presence of 3 µM 2087101, 1078733, or 2087133, as indicated. B, concentration-dependent potentiation of submaximal (EC10–30) acetylcholine-induced responses in Xenopus oocytes expressing human 42, 44, and 7 nAChRs by 2087101 (30 nM to 30 µM), as indicated. Data are mean ± S.E.M. from at least three similar experiments. For heteromeric nAChRs, potentiators were coapplied with agonist, whereas for 7 nAChRs, oocytes were preincubated with potentiator for 2 min before application of acetylcholine.

Effects of 2087101 on the Potency and Efficacy of Nicotinic Agonist-Induced nAChR Responses. Using 2087101 as an example of this novel class of potentiator, studies were undertaken to determine whether these compounds increased the apparent affinity and efficacy of nAChRs for both full and partial agonists.

Firstly, potentiation was assessed as a function of epibatidine concentration at 34, 42, 44, and 7 nAChRs stably expressed in mammalian cells. The effect of 1 to 3 µM 2087101 on a range of epibatidine-induced responses (0.1 nM to 10 µM) was assessed after an 10-min preincubation with potentiator. 2087101 caused a significant increase in both the potency and efficacy of epibatidine at 42, 44n and 7 nAChRs, whereas it had no discernible effect on epibatidine-induced responses at 34 nAChRs (Fig. 4A; Table 1).

View larger version (21K): [in this window] [in a new window]   Fig. 4. Nicotinic receptor agonists display increased potency and maximal efficacy in the presence of 2087101. A, epibatidine concentration-response curves in mammalian cells stably expressing human 34, 42, 44, or 7 nAChRs measured in the absence () or presence of 1 () or 3 () µM 2087101, as indicated. Cells were preincubated with 2087101 for 10 min before agonist application. B, acetylcholine concentration-response curves in Xenopus oocytes expressing human 42 nAChRs measured in the absence () or presence () of 1 µM 2087101. C, concentration-response curves for nicotine, TC-2559, and cytisine in HEK cells stably expressing human 42 nAChRs measured in the absence () or presence () of 1 µM 2087101, as indicated. Cells were preincubated with 2087101 for 10 min before agonist application. For all experiments, data are mean ± S.E.M. from at least three similar experiments.

View this table: [in this window] [in a new window]   TABLE 1 The potency and efficacy of epibatidine at 42, 44, and 7 nAChRs stably expressed in mammalian cells are significantly increased by 2087101 Fluo-3-AM-loaded cells stably expressing human 34, 42, 44, and 7 nAChRs were challenged with epibatidine in the presence or absence of 1 µM 2087101 (42, 44) or 3 µM 2087101 (34, 7) as indicated. Cell population Ca2+ measurements were recorded using a FLIPR. Each value represents the mean ± S.E.M. from at least four independent experiments.

In Xenopus oocytes expressing 42 nAChRs, the effect of coapplication of 1 µM 2087101 on a range of ACh-induced inward current responses (100 nM to 1 mM) was assessed and compared with the responses in the absence of potentiator (Fig. 4B). 2087101 caused an increase in both the potency and efficacy of acetylcholine. In control oocytes, acetylcholine displayed EC₅₀ and E_max values of 153 µM and 135 ± 26%, respectively, whereas the corresponding values in 2087101-treated oocytes were 6 µM and 166 ± 13%, respectively.

The effect of 2087101 on the pharmacological profile of a number of partial nAChR agonists was also compared in HEK-293 cells stably expressing 42 nAChRs. The effects of 1 µM 2087101 on TC-2559, cytisine, and nicotine-induced concentration response curves was assessed after 10-min preincubation with the potentiator and compared with the profile in its absence (Fig. 4C). Both potency and efficacy of these partial agonists were significantly increased in the presence of 2087101 (Table 2).

View this table: [in this window] [in a new window]   TABLE 2 The potency and efficacy of TC-2559, nicotine, and cytisine at 42 nAChRs stably expressed in HEK cells are significantly increased by 2087101 Fluo-3-AM-loaded HEK cells stably expressing human 4 nAChRs were challenged with agonists, as indicated, in the presence or absence of 1 µM 2087101, as indicated. Cell population Ca2+ measurements were recorded using a FLIPR. Each value represents the mean ± S.E.M. from at least six independent experiments.

Comparison of Potentiation of 42 nAChRs by 2087101 and Galantamine. The activity of 2087101 was also compared with that of a known nicotinic potentiator, galantamine (Samochocki et al., 2003). The effect of the two potentiators on epibatidine-induced responses was assessed in HEK-293 cells stably expressing 42 nAChRs after an 10-min preincubation with a range of agonist concentrations (30 nM to 10 µM). In the presence of 1 µM galantamine, the potency (EC₅₀ = 17 ± 2 versus 28 ± 2 nM) but not the efficacy (E_max = 93 ± 1 versus 89 ± 2%) of epibatidine were significantly increased (Fig. 5A). The concentration window for potentiation by galantamine of the submaximal (EC₅₀) epibatidine-induced responses was relatively narrow, as previously reported (Samochocki et al., 2003), with significant potentiation only seen at 1 µM galantamine (Fig. 5B). In contrast, significant potentiation of submaximal (EC₅₀) epibatidine-induced responses by 2087101 was observed over a wider concentration range (Fig. 5B).

View larger version (11K): [in this window] [in a new window]   Fig. 5. Comparison of potentiation of 42 nAChRs stably expressed in mammalian cells by 2087101 and galantamine. A, epibatidine concentration-response curves in HEK cells stably expressing human 42 nAChRs measured in the absence () or presence () of 1 µM galantamine or 1 µM 2087101 (dotted line), as indicated. Cells were preincubated with potentiator for 10 min before agonist application. B, comparison of the concentration dependence of 2087101 and galantamine-induced potentiation of an EC50 concentration (30 nM) of epibatidine at 42 nAChRs. Data are mean ± S.E.M. from at least four similar experiments.

Activation of nAChRs by the potentiators was further confirmed by electrophysiological recordings in oocytes. Figure 6 shows the agonistic properties of 30 µM 1078733, compared with a maximal concentration of ACh. Furthermore, we confirmed that the agonist responses are mediated by the expressed nAChRs since both the competitive antagonist dHE (10 µM, Fig. 6) and the noncompetitive antagonist mecamylamine (data not shown) completely and reversibly blocked the potentiator's effects.

View larger version (8K): [in this window] [in a new window]   Fig. 6. Intrinsic agonist properties of 1078733 at 42 nAChRs. Example traces showing inward currents in voltage-clamped Xenopus oocytes expressing 42 nAChRs in response to superfusion with 1 µM ACh or 30 µM 1078733 in the absence and presence of 10 µM dHE. Between drug applications, the cells were washed in buffer alone for 5 min, except for the washout of the combination of the two drugs, where the cells were washed for 10 min. Similar results were obtained in three independent experiments.

The ability of the three compounds to displace [³H]epibatidine from 42, 44, and 34 nAChRs was established and compared with displacement by a standard agonist, cytisine. At concentrations up to 10 µM, 2087101, 1078133, and 2087133 did not displace [³H]epibatidine from 42, 44, or 34 nAChRs (data not shown), whereas cytisine generated the expected K_i values for each of the receptor subtypes tested (2.1, 2.63, and 551 nM for 42, 44, or 34 nAChRs, respectively).

Since some nAChR potentiators are reported to act via second messenger systems, the effects of a panel of common second messenger and G protein disruptors was studied. Acute pretreatment (10–20 min) of HEK-293 cells stably expressing 42 nAChRs with 1 µM PMA, 50 µM H-7, 100 nM staurosporine, or 10 µM forskolin to modulate protein kinases and 100 nM calyculin A or 100 nM okadaic acid to modulate protein phosphatases, respectively, failed to prevent potentiation of epibatidine-induced responses by 1 µM 2087101, as shown by a comparable decrease in EC₅₀ values and increase in E_max values in control versus treated cells (Fig. 7). Additionally, chronic pretreatment (16–20 h) of HEK-293 cells stably expressing 42 nAChRs with 200 ng/ml pertussis toxin or 500 ng/ml cholera toxin to disrupt G protein signaling, respectively, failed to prevent potentiation of epibatidine-induced responses by 1 µM 2087101 (Fig. 7).

View larger version (25K): [in this window] [in a new window]   Fig. 7. 2087101-Induced potentiation of 42 nAChRs is not affected by disruption of common second messenger systems. EC50 and Emax values for epibatidine concentration-response curves at 42 nAChRs stably expressed in HEK cells generated in the absence (open bars) or presence (filled bars) of 1 µM 2087101. Cells were either untreated or pretreated acutely (for 10–20 min) with 1 µM PMA, 50 µM H-7, 100 nM staurosporine, 10 µM forskolin, 100 nM calyculin A, or 100 nM okadaic acid or chronically (for 16–20 h) with 200 ng/ml pertussis toxin or 500 ng/ml cholera toxin, as indicated.

View larger version (16K): [in this window] [in a new window]   Fig. 8. Chimeric 7/5-HT3Rs are not potentiated by 2087101. Epibatidine concentration-response curves in HEK cells stably expressing chimeric 7/5-HT3Rs measured in the absence () or presence () of 3 or 10 µM () 2087101 are shown. Cells were preincubated with 20872101 for 10 min before agonist application. Data are mean ± S.E.M. from at least three independent experiments.

Selectivity Profile of Compounds 2087101, 1078733, and 2087133. To verify that compounds 2087101, 1078733, and 2087133 were selective potentiators of nAChRs, the compounds were profiled across a panel of ligand- and voltage-gated ion channels (Fig. 9). Compound activity was assessed on human recombinant 5-HT₃ receptors stably expressed in HEK-293 cells and at rat native AMPA receptors, NMDA receptors, GABA_A receptors, and voltage-gated Ca²⁺ and Na⁺ channels endogenously expressed in cortical neurons. Activity was compared with the effects seen on human recombinant 42 nAChRs stably expressed in HEK-293 cells. Addition of 3 µM 2087101, 1078733, or 2087133 failed to evoke an agonist response at any of the ion channels tested for cross-reactivity (data not shown). In addition, no significant potentiating effect was observed on responses to 1 µM 5-HT (5-HT₃ receptors), 3 µM AMPA (AMPA receptors), 10 µM NMDA (NMDA receptors), 25 mM K⁺ (voltage-gated Ca²⁺ channels), and 3 µM veratridine (voltage-gated Na⁺ channels) after an 10 min preincubation with 3 µM 2087101, 1078733, or 2087133 (Fig. 9).

View larger version (20K): [in this window] [in a new window]   Fig. 9. No cross-reactivity of 2087101, 2087133, or 1078733 on a panel of ligand- and voltage-gated ion channels. Responses to various receptor agonists and ion channel modulators were evaluated in HEK cells stably expressing exogenous 5-HT3Rs or rat cortical neurons endogenously expressing AMPA, NMDA, GABAA, voltage-gated Ca2+ channels, and voltage-gated Na+ channels, in the absence (100%) or presence (open bars) of 3 µM 20872101, 2087133 (striped bars), or 1078733 (filled bars), as indicated. Cells were preincubated with potentiator for 10 min before the applications of various agents. Data are mean ± S.E.M. from at least three independent experiments

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
We report the discovery of a novel class of nicotinic acetylcholine receptor potentiators, exemplified by compounds 2087101, 2087133, and 1078733. These compounds selectively potentiate human recombinant 7, 24, 42, and 44, but not 3- or 1-containing nAChRs or other ion channels.

The profile of nAChR potentiation, as exemplified by compound 2087101, is unique, even if it shares some features with other allosteric nAChR potentiators. For example, 2087101 increases both the potency and the efficacy of nAChR agonists at 42, 44, and 7 nAChRs. Potentiation by 2087101 is independent of agonist type because potentiation of a variety of full and partial agonists is observed, and it is present, albeit to a lower degree, at supramaximal agonist concentrations. As previously reported (Samochocki et al., 2003) and replicated in this study, galantamine, a known allosteric modulator of nAChRs, increases the apparent affinity of 42 nAChRs for agonists. However, unlike 2087101, galantamine only potentiates submaximal agonist-induced responses not having significant effects on agonist efficacy. This is a profile shared by 17-estradiol, another allosteric nAChR modulator, which is also reported to potentiate submaximal agonist responses at 4-containing nAChRs, thereby increasing agonist potency without affecting agonist efficacy (Paradiso et al., 2001; Curtis et al., 2002). In contrast, ethanol, a direct nAChR allosteric modulator, and nefiracetam, an indirect nAChR potentiator, potentiate 42 nAChRs even at saturating concentrations of agonist, leading to an increase in agonist efficacy, whereas the EC₅₀ for agonist remains relatively unaffected.

The mechanism of nAChR potentiation by compounds 2087101, 2087133, and 1078733 is likely to be a direct allosteric interaction on the nAChR. Firstly, potentiation is noncompetitive because it is independent of agonist concentration, and at concentrations required for nAChR potentiation, the compounds do not displace ³H agonist binding. Secondly, pharmacological modulation of common second messenger systems does not prevent nAChR potentiation. In contrast, potentiation of 42, muscle and 3-containing nAChRs by nefiracetam requires G_s protein kinase C and G_i/protein kinase A, respectively, because disruption of these second messenger pathways prevents potentiation (Oyaizu and Narahashi, 1999). Thirdly, at concentrations higher than those required for potentiation, 2087101, 2087133, and 1078733 exhibit intrinsic agonist activity. This is consistent with the "allosteric model" of ligand-gated channels (Hogg et al., 2005) and is indeed a feature shared with other allosteric ion channel modulators, including 17-estradiol, which induces small currents in the absence of nAChR agonists at 44 nAChRs (Curtis et al., 2002), and galantamine, which evokes single-channel nAChR activity (Pereira et al., 1994). In addition, the anthelmintic agent levamisole, which potentiates 32 and 34 nAChRs in the micromolar range, is also reported to display some weak partial agonist activity at millimolar concentrations (Levandoski et al., 2003).

The allosteric binding site for galantamine has been mapped to the N-terminal region of nAChRs by use of monoclonal antibodies and a chimeric 7/5-HT₃ receptor (Maelicke et al., 2000; Samochocki et al., 2003). Use of chimeric 4 and 3 nAChRs also allowed the site of potentiation for 17-estradiol to be mapped to the C-terminal domain of the 4 nAChR (Curtis et al., 2002). In the present study, we also used a chimeric 7/5-HT₃ receptor to determine whether the allosteric site for potentiation by 2087101 resides in the extracellular N-terminal domain of the nAChR. The chimera is composed of the N-terminal extracellular domain of the 7 nAChR and the transmembrane and C-terminal domains of the 5-HT₃ receptor and is reported to display a pharmacological profile similar to wild-type 7 nAChRs (Eisele et al., 1993; Craig et al., 2004). This chimera has previously been shown to be potentiated by both 5-hydroxy-indole (Craig et al., 2004) and galantamine (Samochocki et al., 2003). However, at variance with findings with these modulators, 2087101 did not potentiate agonist-induced responses at chimeric 7/5-HT₃ receptors, suggesting that its binding site might reside in regions downstream of the N terminus or, alternatively, that these regions are needed to achieve the selective conformational changes induced by 2087101.

At high concentrations, 2087101, 2087133, and 1078733 caused inhibition, even on nAChRs where no potentiation was evident. This is in line with previous reports of additional inhibitory actions seen with steroids (Paradiso et al., 2001), galantamine (Samochocki et al., 2003), and levamisole (Levandoski et al., 2003). The inhibitory action of these potentiators is thought to be largely mediated through sites distinct from those mediating potentiation. For galantamine and levamisole, this is proposed to be through a nonselective block of the pore, whereas for steroids, the site-mediating inhibitory action is unclear but has been shown to lie outside of the C-terminal region mediating 17-estradiol potentiation (Paradiso et al., 2001).

The profile of 2087101, 2087133, and 1078733 as selective potentiators of central, but not peripheral, ganglionic 3- or muscle 1-containing nAChRs or of other ion channels such as NMDA, AMPA, GABA_A, and voltage-gated sodium or calcium channels compares very favorably with that of currently known nAChR potentiators. For example, galantamine is reported to nonselectively potentiate central 42, 7, 64, and peripheral 34 nAChRs (Samochocki et al., 2003), as well as NMDA receptors (Moriguchi et al., 2004). Because galantamine also possesses anti-AChE activity, the interpretation of its mechanism of action, although not of its clinical efficacy, is further complicated. Nefiracetam is reported to potentiate 42-, 7-, and 3-containing and muscle nAChRs (Oyaizu and Narahashi, 1999) as well as GABA_A receptors (Huang et al., 1996) and voltage-gated calcium channels (Yoshii and Watabe, 1994). Likewise, anthelmintics such as levamisole and pyrental potentiate peripheral 3-containing and muscle nAChRs (Levandoski et al., 2003), and ethanol nonselectively acts on nAChRs among other ion channels including NMDA receptors, GABA_A receptors, and voltage-gated calcium channels (Zuo et al., 2001). Although 17-estradiol displays selectivity for 4- over 3-containing nAChRs (Curtis et al., 2002), it is also reported to potentiate kainate receptors (Gu and Moss, 1996). In addition, 17-estradiol obviously interacts with estrogen receptors.

The profile of these newly described compounds as selective potentiators of the two main central nAChR subtypes, 7 and 42 nAChRs, is intriguing. Activation of either 7 or 42 nAChRs with subtype-selective agonists produces procognitive effects, demonstrating a role for both subtypes in modulation of cognitive function (Lippiello et al., 1996; Levin and Rezvani, 2000). Selective action of these potentiators at central, but not peripheral ganglionic 3 or muscle 1-containing nAChRs, may give the specificity required to avoid undesirable side effects. Hurst et al. (2005) and Sher et al. (2005) recently described different and new selective 7 nAChR potentiators that significantly increase potency and efficacy of agonists at recombinant and native 7 receptors. On the other hand, the lack of selectivity between 7 or 42 nAChRs could be advantageous for different disease pathologies in which both 42 and 7 nAChRs have been implicated (Leonard et al., 2000; Court et al., 2001; Quik and Kulak, 2002). In any event, these compounds should prove useful as tools to establish whether nAChR potentiators can produce comparable procognitive enhancements as direct nAChR agonists or AChE inhibitors. In addition, the compounds should help clarify whether nAChR potentiators display additional advantages, such as the induction of less desensitization, compensation, or tolerance (because potentiation occurs only when endogenous agonist is present) or if the compounds display a favorable safety profile, as previously suggested (Maelicke et al., 2000), and ultimately if this type of compound has a therapeutic application.

	Acknowledgements

 
We gratefully acknowledge the contributions of Ruth Beattie, Ella Gowan, Annabel Martin, Sarah Glover, and Elizabeth Folly for cell culture support and stable cell line development; Peter Craig and Non Evans for molecular biology support; and Richard Broadmore, John Boot, Phil Szekeres, Nicola Hamil, and Mark Carew for technical assistance.

	Footnotes

 
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.106.104505.

ABBREVIATIONS: nAChR, nicotinic acetylcholine receptor; 5-HT, 5-hydroxytryptamine; ACh, acetylcholine; NMDA, N-methyl-D-aspartate; FLIPR, fluorescent imaging plate reader; HEK, human embryonic kidney; AMPA, -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid; SPA, scintillation proximity assay; PCR, polymerase chain reaction; 2087101, [2-(4-fluoro-phenylamino)-4-methyl-thiazol-5-yl]-thiophen-3-yl-methanone; 2087133, [2-(4-fluoro-phenylamin)-4-methyl-thiazol-5-yl]-p-tolyl-methanone; 1078733, benzo[1,3]dioxol-5-yl-[2-(4-fluoro-phenylamino)-4-methylthiazol-5-yl-methanone; TC-2559, [(E)-N-methyl-4-[3-(5-ethoxypyridin)yl]-3-buten-1-amine; dHE, dihydro--erythroidine; PMA, phorbol myristate acetate; AM, acetomethyl ester; H-7, 1-(5-isoquinolinesulfonyl)-2-methyl piperazine dihydrochloride.

¹ Current affiliation: Amgen, Cambridge Research Center, Cambridge, MA.

Address correspondence to: Emanuele Sher, Eli Lilly and Company Ltd., Lilly Research Centre, Erl Wood Manor, Windlesham, Surrey GU20 6PH, United Kingdom. E-mail: sher_emanuele{at}lilly.com

	References

Top Abstract Materials and Methods Results Discussion References

 

Astles PC, Baker SR, Boot JR, Broad LM, Dell CP, and Keenan M (2002) Recent progress in the development of subtype selective nicotinic acetylcholine receptor ligands. Curr Drug Targets CNS Neuro Disord 1: 337–348.[CrossRef]

Cheng YC and Prusoff WH (1973) Relationship between the inhibition constant (K_i) and the concentration of inhibitor which causes 50 per cent inhibition (I₅₀) of an enzymatic reaction. Biochem Pharmacol 22: 3099–3108.[CrossRef][Medline]

Court J, Martin-Ruiz C, Piggott M, Spurden D, Griffiths M, and Perry E (2001) Nicotinic receptor abnormalities in Alzheimer's disease. Biol Psychiatry 49: 175–184.[CrossRef][Medline]

Craig PJ, Bose S, Zwart R, Beattie RE, Folly EA, Johnson LR, Bell E, Evans NM, Benedetti G, Pearson KH, et al. (2004) Stable expression and characterisation of a human 7 nicotinic subunit chimera: a tool for functional high-throughput screening. Eur J Pharmacol 502: 31–40.[CrossRef][Medline]

Curtis L, Buisson B, Bertrand S, and Bertrand D (2002) Potentiation of human 42 neuronal nicotinic acetylcholine receptor by estradiol. Mol Pharm 61: 127–135.[Abstract/Free Full Text]

Dani JA (2001) Overview of nicotinic receptors and their roles in the central nervous system. Biol Psychiatry 49: 166–174.[CrossRef][Medline]

Eisele J-L, Bertrand S, Galzi J-L, Devillers-Thlery A, Changeux J-P, and Bertrand D (1993) Chimaeric nicotinic-serotonergic receptor combines distinct ligand binding and channel specificities. Nature (Lond) 366: 479–483.[CrossRef][Medline]

Ellman GL, Courtney KD, Andres V, and Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7: 88–95.[CrossRef][Medline]

Gatto GJ, Bohme GA, Caldwell WS, Letchworth SR, Traina VM, Obinu MC, Laville M, Reibaud M, Pradier L, Dunbar G, et al. (2004) TC-1734: an orally active neuronal nicotinic acetylcholine receptor modulator with antidepressant, neuroprotective and long-lasting cognitive effects. CNS Drug Rev 10: 147–166.[Medline]

Gu Q and Moss RL (1996) 17-Estradiol kainate-induced currents via activation of the cAMP cascade. J Neurosci 16: 3620–3629.[Abstract/Free Full Text]

Hogg RC, Buisson B, and Bertrand D (2005) Allosteric modulation of ligand-gated ion channels. Biochem Pharm 70: 1267–1276.[CrossRef][Medline]

Huang C-S, Yan Ma J, Marszalec W, and Narahishi T (1996) Effects of the nootropic drug nefiracetam on the GABA_A receptor-channel complex in dorsal root ganglion neurons. Neuropharmacology 35: 1251–1261.[CrossRef]