|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CARDIOVASCULAR
Department of Pharmacology, Faculty of Medicine of Ribeirão Preto (C.R.T.) and Department of Pharmacology, Institute of Biomedical Sciences (D.A.C., A.C.M., A.Y., R.C.T.), University of Sao Paulo, Sao Paulo, Sao Paulo, Brazil; Department of Pharmacology, Faculty of Medicine, Université de Sherbrooke, Sherbrooke, Québec, Canada (E.L., P.D.-J.); and Department of Clinical, Toxicological and Food Science Analysis (V.L.L., S.A.U.) and Department of Physics and Chemistry, Laboratory of Pharmacology (A.M.d.O.), Faculty of Pharmaceutical Sciences, University of Sao Paulo, Ribeirão Preto, Sao Paulo, Brazil
Received for publication
February 16, 2006
Accepted
April 27, 2006.
| Abstract |
|---|
|
|
|---|
The positive correlation between the duration of ethanol intake and the development of cardiovascular abnormalities reported by previous studies (Abdel-Rahman and Wooles, 1987
; Strickland and Wooles, 1988
) suggests that the period of exposure to ethanol is a major factor in the development of cardiovascular complications. However, the time scale for ethanol treatment varies among most of the published studies (Abdel-Rahman et al., 1985
; Chan et al., 1985
; Utkan et al., 2001
), albeit most reports related to changes in vascular reactivity used only single periods of treatment (Utkan et al., 2001
; Brown et al., 2002
).
Endothelin (ET)-1, the predominant isoform of the ET peptide family, has potent vasoconstrictor, mitogenic, and proinflammatory properties and is implicated in numerous cardiovascular diseases (Yanagisawa et al., 1988
; Tostes and Muscara, 2005
). Interestingly, Nanji et al. (1994
) observed increased plasma ET-1 levels in rats treated with ethanol, suggesting that the peptide plays a role in the cardiovascular complications induced by ethanol consumption. However, to our knowledge, no studies have evaluated the vascular responses to ET-1 in ethanol-treated rats
Therefore, the aim of this study was to determine whether there are any changes in vascular reactivity to ET-1 in carotid arteries from ethanol-treated rats. The carotid artery was chosen based on evidence of the importance of this vascular bed in the cerebral blood flow (Eugene et al., 1999
). As we are not familiar with any reports in the literature that deal with the time course for the effect of ethanol intake on the vascular responsiveness to ET-1, we investigated the effect of ethanol intake for 2, 6, and 10 weeks.
| Materials and Methods |
|---|
|
|
|---|
The rats, initially weighing 300 to 350 g (80-100 days old), were randomly divided into three groups: control, isocaloric, and ethanol. Control rats received tap water ad libitum. Rats from the isocaloric group received a solution containing an isocaloric amount of sucrose (290.5 g/l) instead of ethanol. Rats in the ethanol group received 20% (v/v) ethanol in their drinking water (Resstel et al., 2006
; Tirapelli et al., 2006
). To avoid a considerable loss of animals, the ethanol-treated group was submitted to a brief and gradual adaptation period. The animals received 5% ethanol in their drinking water in week 1, 10% in week 2, and 20% in week 3. At the end of week 3, the experimental stage began. The same procedure was adopted for the isocaloric group. In these groups, the caloric content of the liquid diet was adjusted to match that of the ethanol-exposed groups. The isocaloric groups were included in the study protocol to evaluate whether alterations in caloric intake after ethanol consumption would explain the possible influences of ethanol on arterial responses. The rats were treated for 2, 6, and 10 weeks and weighed weekly.
Blood Ethanol and Serum Glucose Measurements
Blood was collected from the aorta of anesthetized rats, and ethanol analysis was carried out using a CG-17A gas chromatograph (Shimadzu, Kyoto, Japan) as described previously (Tirapelli et al., 2005
). For glucose measurements, the blood was centrifuged, and the serum was analyzed for glucose content using available commercial kits (Labtest Diagnóstica, Sao Paulo, Brazil) and the AutoAnalyzer (model ABAA VP; Abbott Laboratories, Chicago, IL).
Vessel Ring Preparation
The rats were anesthetized and killed by aortic exsanguination. The carotid artery was quickly removed, cleaned of adherent connective tissues, and cut into rings (5-6 mm in length), which were placed in a 5-ml organ chamber (basal tension of 1.0 g) as described previously (Tirapelli et al., 2005
). In some rings, the endothelium was removed mechanically by gently rolling the lumen of the vessel on a thin wire. Endothelial integrity was assessed qualitatively by the degree of relaxation caused by acetylcholine (1 µM) in the presence of contractile tone induced by phenylephrine (0.1 µM). For studies of endothelium-intact vessels, the ring was discarded if relaxation with acetylcholine was not
80%. For studies of endothelium-denuded vessels, the rings were discarded if there was any degree of relaxation.
Experimental Protocols
Concentration-Response Curves for ET-1 and Phenylephrine. Cumulative concentration-response curves for ET-1 (10-12-10-7 M) or phenylephrine (10-10-10-5 M) were performed in endothelium-intact and -denuded rings by a stepwise increase in the concentration of the agonists. Additions were made as soon as a steady response was obtained from the preceding concentration. The vascular responsiveness to these agonists was studied in carotid rings from control, isocaloric, and ethanol-treated rats after 2, 6, and 10 weeks.
Effects of BQ-123 and BQ-788 on ET-1-Induced Contraction. The antagonists were added 30 min before the construction of the concentration-response curves for ET-1. Both the selective ETA (BQ-123, Ihara et al., 1992) and ETB (BQ-788, Ishikawa et al., 1994
) receptor antagonists were tested. After incubation with the antagonists, concentration-response curves for ET-1 (10-12-3 x 10-7 M) were obtained. Six concentrations of BQ-123 (0.001, 0.01, 0.3, 1, 3, and 5 µM) and four concentrations of BQ-788 (0.1, 0.3, 1, and 3 µM) were tested in endothelium-intact rings. The curves for ET-1 in the presence of the antagonists were obtained in rings from control, isocaloric, and 2-week ethanol-treated rats. Each ring was used for a single experiment because we observed tachyphylaxis for ET-1 in the rat carotid (Tirapelli et al., 2005
).
IRL1620-Induced Contraction. Cumulative concentration-response curves for IRL1620 (10-10-3 x 10-7 M) were performed in endothelium-intact and -denuded rings from control, isocaloric, and 2-week ethanol-treated rats.
ET-1, IRL1620, and Acetylcholine-Induced Relaxation. Endothelium-intact rings were precontracted with phenylephrine (0.1 µM). After they reached a stable and sustainable contraction, ET-1 (10-14-3 x 10-11 M), IRL1620 (10-10-3 x 10-8 M), or acetylcholine (10-10-10-5 M) was added cumulatively to the organ bath.
A possible influence of ethanol consumption on the mechanisms underlying the relaxant effect induced by IRL1620 was studied in endothelium-intact rings from control and ethanol-treated rats. These mechanisms were evaluated by experiments performed in the presence of NG-nitro-L-arginine methyl ester (L-NAME) (a nonselective NO synthase inhibitor, 100 µM), indomethacin (a cyclooxygenase inhibitor, 10 µM), or 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ) (a guanylyl cyclase inhibitor, 1 µM). Concentrations of the channel blockers tetraethylammonium chloride (TEA) (a nonselective K+ channel blocker, 10 mM), apamin (selective blocker of low-conductance Ca2+-activated channels, 1 µM), glibenclamide (selective blocker of ATP-sensitive K+ channels, 3 µM), charybdotoxin (selective blocker of large conductance Ca2+-activated K+ channels, 0.1 µM), and 4-aminopyridine (4-AP) (selective blocker of voltage-dependent K+ channels, 1 mM) were used according to Nelson and Quayle (1995
). All drugs were incubated for 30 min before further experimental procedures. Relaxations were expressed as percent change from the phenylephrine-contracted tissues. Because we noted that L-NAME and ODQ enhanced phenylephrine-induced contraction, the rings with intact endothelium exposed to these compounds were precontracted with 0.03 µM phenylephrine to induce a magnitude of contraction similar to that found in the intact rings not exposed to the inhibitors.
Reverse Transcriptase-Polymerase Chain Reaction. Reverse transcriptase-polymerase chain reaction was performed as described previously (Tirapelli et al., 2005
). Polymerase chain reaction primers were designed on the basis of published rat cDNA sequences for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and ETA/ETB receptors and are as follows (5'-3'): ETA, antisense primer CTGTGCTGCTCGCCCTTGTA, sense primer GAAGTCGTCCGTGGGCATCA (216-bp fragment); ETB, antisense primer CACGATGAGGACAATGAGAT, sense primer TTACAAGACAGCCAAAGACT (565-bp fragment); and GAPDH, antisense primer CACCACCCTGTTGCTGTA, sense primer TATGATGACATCAAGAAGGTGG (219-bp fragment). The band intensities were measured using a software package (Kodak Digital Science; Eastman Kodak, New Haven, CT), and the signals are reported relative to the intensity of GAPDH amplification in each coamplified sample.
|
Immunohistochemistry. Longitudinal sections (5 µm) of the rat carotid were incubated with 3% H2O2 and a Pierce solution to block endogenous peroxidase and biotin, respectively. Sections were subsequently incubated with primary polyclonal antibodies against rat ETA and ETB receptors (1:10 dilution; Alomone Labs) and with a biotin-conjugated secondary anti-rabbit antibody (1:1000; Vector Laboratories Inc., Burlingame, CA) and streptavidin-conjugated peroxidase (Vectastain ABC kit; Vector Laboratories Inc.). Color was developed by the addition of DAB (Sigma Chemical, St. Louis, MO). To evaluate the background reaction, procedures were also performed in sections incubated only with the secondary antibody (indirect technique) or in the absence of antibodies (direct technique). The number with positive immunostaining for ETA and ETB receptors was measured by using a camera (DXC-107A; Sony Corporation of America, New York, NY) and the program, Image-Pro Plus (Media Cybernetics, Inc., Silver Spring, MD). Positive staining for each receptor was determined per unit area (positive staining per square micrometer).
Drugs. The following drugs were used: phenylephrine hydrochloride, acetylcholine hydrochloride, ODQ, glibenclamide, 4-AP, and ET-1 (Sigma); L-NAME and TEA (Sigma/RBI, Natick, MA); indomethacin (Calbiochem, San Diego, CA); apamin, IRL1620, BQ-788, and BQ-123 (American Peptide Co., Inc., Sunnyvale, CA); and charybdotoxin (Alomone Labs). Glibenclamide and ODQ were prepared as stock solutions in ethanol and dimethyl sulfoxide, respectively. Indomethacin was dissolved in Tris buffer, pH 8.4,. The other drugs were dissolved in distilled water. The bath concentration of ethanol or dimethyl sulfoxide did not exceed 0.5% and was shown to have no effects per se on the basal tonus of the preparations or on the agonist-mediated contraction or relaxation.
Data Analysis. Contractions were expressed as changes in the displacement (grams) from baseline since no differences on tissue mass among the groups were observed. Relaxation was expressed as percent change from the phenylephrine-contracted levels. Agonist concentration-response curves were fitted using a nonlinear interactive fitting program (Graph Pad Prism 2.01; GraphPad Software Inc., San Diego, CA). Agonist potencies and maximal responses were expressed as pD2 (negative logarithm of the molar concentration of agonist producing 50% of the maximal response) and Emax (maximum effect elicited by the agonist), respectively. Statistically significant differences were calculated by one-way analysis of variance (ANOVA) or Student's t test. p < 0.05 was considered as statistically significant.
| Results |
|---|
|
|
|---|
Blood ethanol levels in the ethanol-treated rats averaged 1.87 ± 0.20, 1.73 ± 0.22, and 1.72 ± 0.18 mg/ml in weeks 2, 6, and 10, respectively (n = 8-9) with no differences among the three different periods of treatment (p < 0.05; ANOVA). No ethanol was detectable in the blood of control and isocaloric animals.
In the 2-week treated rats, serum glucose levels in the control (n = 10), isocaloric (n = 6), and ethanol (n = 9) groups averaged 100.81 ± 9.15, 102.30 ± 6.25, and 99.95 ± 6.05 mg/dl, respectively. Likewise, no differences were found in serum glucose levels after 6 weeks of treatment (control: 100.50 ± 6.70 mg/dl, n = 10; isocaloric: 101.35 ± 11.79 mg/dl, n = 8; and ethanol: 103.22 ± 6.60 mg/dl, n = 9). The treatment for 10 weeks did not modify the serum glucose levels in control (103.60 ± 7.42 mg/dl, n = 8), isocaloric (110.85 ± 6.82 mg/dl, n = 6), or ethanol-treated rats (105.42 ± 7.00 mg/dl, n = 6) (p < 0.05; ANOVA).
|
|
Phenylephrine-induced contraction in rat carotid rings was not altered at any time after treatment with ethanol in either endothelium-intact or -denuded rings (data not shown). Because the period of treatment did not influence the effect induced by ethanol on ET-1-induced contraction of endothelium-intact rings, the following experiments designed to investigate the mechanisms underlying this response were obtained in carotid rings from 2-week treated rats and their respective age-matched control and isocaloric animals.
Effects of Antagonists on ET-1-Induced Contraction. The Emax and pD2 values for ET-1 concentration-response curves observed in the absence and presence of BQ-123 and BQ-788 are shown in Table 2. The incubation of carotid rings from control, isocaloric, and ethanol-treated rats with BQ-123 produced concentration-dependent rightward displacements of the ET-1 response curves with reduction of the maximum response. However, in the presence of BQ-123, the Emax values for ET-1 obtained in the rings from ethanol-treated rats were significantly higher with respect to the values obtained for arteries from control and isocaloric rats when exposed to the same concentration of the ETA antagonist.
|
Effect of Ethanol Consumption on IRL1620-Induced Contraction. The Emax of IRL-1620 was significantly higher in endothelium-intact but not in -denuded rings from ethanol-treated rats compared with control or isocaloric animals. No significant differences among pD2 values were found in endothelium-intact or -denuded rings (Fig. 2; Table 3).
|
Effect of Ethanol Consumption on ET-1, IRL1620, and Acetylcholine-Induced Relaxation. Figure 3 shows that ethanol consumption reduced ET-1-induced relaxation (Emax: 27.87 ± 3.86%; n = 13) compared with control (Emax: 47.83 ± 3.91%; n = 9) or isocaloric arteries (Emax: 49.35 ± 5.71%; n = 9) (p < 0.05; ANOVA). The mean pD2 values of ET-1 in rings derived from ethanol-treated rats (12.66 ± 0.15) were not significantly different from those found in the arteries from control (13.10 ± 0.16) or isocaloric rats (13.01 ± 0.10). Likewise, the relaxation induced by IRL1620 in endothelium-intact rings from ethanol-treated rats (Emax: 21.61 ± 2.47%; n = 13) was significantly reduced compared with control (Emax: 46.39 ± 2.71%; n = 10) or isocaloric arteries (Emax: 48.28 ± 3.97%; n = 7) (p < 0.05; ANOVA). The mean pD2 values of IRL1620 in rings from ethanol-treated rats (8.83 ± 0.21) were not significantly different from those found in arteries from control (8.92 ± 0.20) or isocaloric rats (9.01 ± 0.12). On the other hand, acetylcholine-induced relaxation in the rat carotid did not significantly differ among control (Emax: 102.30 ± 9.30%; pD2: 7.26 ± 0.11, n = 8), isocaloric (Emax: 109.56 ± 3.26%; pD2: 7.27 ± 0.12, n = 6), or ethanol-treated rats (Emax: 113.60 ± 3.49%; pD2: 7.18 ± 0.10, n = 6).
|
|
When added alone, L-NAME, ODQ, indomethacin, or TEA reduced IRL1620-induced relaxation of control arteries to a similar extent. On the other hand, these compounds did not affect IRL1620-induced relaxation of ethanol-treated arteries. The combination of L-NAME and indomethacin showed further suppression than that observed with either L-NAME or indomethacin alone in control arteries and reduced IRL1620-induced relaxation of ethanol-treated arteries. The combination of TEA, L-NAME, and indomethacin strongly reduced IRL1620-induced relaxation of control and ethanol-treated arteries. The relaxant response induced by IRL1620 on control arteries was reduced by 4-AP, whereas apamin, glibenclamide, or charybdotoxin had no effect in this response. On the other hand, neither of these compounds altered IRL1620-induced relaxation of ethanol-treated arteries. The mean pD2 of IRL1620 concentration-dependent vasodilatory responses as well as its Emax values, in the absence or presence of the above treatments, are given in Table 4.
ETA and ETB Receptor mRNA Expression in the Rat Carotid Artery. The results obtained by reverse transcription-polymerase chain reaction show that there is no difference in the expression of mRNA for both ETA (control: 1.66 ± 0.10, n = 5; isocaloric: 1.73 ± 0.07, n = 4; ethanol: 1.66 ± 0.14, n = 6) and ETB (control: 1.59 ± 0.13, n = 5; isocaloric: 1.60 ± 0.14, n = 4; ethanol: 1.61 ± 0.20, n = 6) receptors among the three experimental groups. The band signals are reported relative to the intensity of GAPDH amplification in each coamplified sample.
Protein Levels of ETA and ETB Receptors in the Rat Carotid Artery. Western immunoblotting assays showed that the treatment with ethanol reduced rat carotid ETB receptors protein levels compared with control or isocaloric tissues (Fig. 4). On the other hand, the protein levels of ETA receptors in arteries from ethanol-treated rats were not significantly different in vessels derived from the same three above-mentioned groups.
|
|
| Discussion |
|---|
|
|
|---|
1-adrenoreceptor agonist, did not differ among the three groups. Therefore, the enhanced reactivity of the carotid artery from ethanol-treated rats to ET-1 cannot be explained by a nonspecific impairment of the modulatory action of the endothelium but rather by a selective alteration of the response to ET-1.
Elevated glucose levels have been reported to alter vascular responsiveness (Tesfamariam et al., 1991
; Lloréns et al., 2004
). In the present work, the level of glucose did not differ among the isocaloric groups and their respective control and ethanol age-matched rats. In addition, sucrose feeding did not alter the vascular reactivity to ET-1, suggesting that the caloric content of the ethanol diet did not play a significant role in the present findings.
Some reports suggested that the period of exposure to ethanol is the major factor in the development of cardiovascular abnormalities (Abdel-Rahman and Wooles, 1987
; Strickland and Wooles, 1988
). In the present work, no relation between the period of treatment and the increment on ET-1-induced contraction was observed. However, our data do not rule out the possibility that ethanol displays a time-dependent effect at periods of treatment shorter or longer than those used in the present study.
Previously, we demonstrated the existence of both ETA and ETB vasoconstrictor receptors located on smooth muscle of rat carotid arteries and endothelial ETB receptors responsible for ET-1-induced vasorelaxation via the NO-cGMP pathway, vasodilator cyclooxygenase product(s), and the activation of voltage-dependent K+ (KV) channels (Tirapelli et al., 2005
). We observed that in the presence of BQ-123, but not BQ-788, the Emax values for ET-1 obtained in the rings from ethanol-treated rats were significantly higher with respect to values obtained for arteries from control and isocaloric rats when exposed to the same concentration of the antagonist. Accordingly, the hyperreactivity to ET-1 could be related to a greater participation of ETA or ETB receptors located on the vascular smooth muscle or a reduced relaxation mediated by endothelial ETB receptors. Ethanol consumption enhanced the contraction induced by IRL1620, a selective agonist for ETB receptors (Takai et al., 1992
), in endothelium-intact but not -denuded arteries, indicating that the contraction mediated by ETB receptors located on the smooth muscle was not altered by the treatment. Removal of the endothelium significantly enhanced IRL1620-induced contraction, further suggesting that the endothelium counteracts the contraction induced by ETB receptors. This observation corroborates our initial finding, namely that the hyperreactivity to ET-1 is endothelium-dependent, and also indicates that ethanol consumption impairs the modulatory activity of the endothelium by a mechanism that is selective to the endothelinergic pathway. Thus, it seems that the selective enhancement of the ET-1-induced contraction shown by isolated rat carotid from ethanol-treated rats is related to an altered function of ET receptors located on endothelial cells. Ethanol consumption reduced both ET-1 and IRL1620-induced vasodilatory responses, further supporting the concept of impaired endothelial ETB-dependent responses. Furthermore, ethanol consumption did not alter acetylcholine-induced endothelium-dependent relaxation, further confirming the theory that the treatment selectively affects the endothelinergic pathway.
Incubation of carotid arteries from ethanol-treated rats with L-NAME, indomethacin, TEA, and 4-AP did not significantly modify the maximal relaxation induced by IRL1620, suggesting that, in these arteries, the role of NO, vasodilator prostanoid(s), and KV channels in response to ETB activation was attenuated by the treatment. However, the association of L-NAME and indomethacin and the association of L-NAME, indomethacin, and TEA reduced ETB-mediated relaxation in the rings from ethanol-treated rats. This finding suggests that ethanol consumption attenuates but does not abolish the intracellular pathways involved in ETB-mediated relaxation.
The mRNA expression of both ETA and ETB receptors was not altered by ethanol consumption. By using Western immunoblotting we demonstrated that the protein levels of ETB, but not ETA, receptors were reduced by the treatment. Moreover, immunohistochemical assays showed reduced immunostaining for endothelial ETB receptors after treatment, whereas ETA and ETB receptor levels in the vascular smooth muscle was not altered. These results show that ethanol consumption down-regulates endothelial ETB receptors at the post-transcriptional level.
An increased vascular response to ET-1 has been reported in different pathophysiological conditions such as cerebral ischemia (Salom et al., 2000
), subarachnoid hemorrhage (Alabadi et al., 1997
), and hypertension (Cardillo et al., 1999
). The vascular hyperreactivity to ET-1 described in this study, together with the increased plasma levels of this peptide in ethanol-treated rats (Nanji et al., 1994
), could play a role in the pathogenesis of cerebral ischemia associated with ethanol consumption.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: ET-1, endothelin 1; BQ-123, cyclo(L-Leu-D-Trp-D-Asp-L-Pro-D-Val); BQ-788, N-cis-2,6-dimethyl-piperidinocarbonyl-L-
-methylleucyl-D-1-methoxycarbonyltryptophanyl-D-norleucine; IRL1620, succinyl-(Glu9,Ala11,15)-ET-1(8-210); L-NAME, NG-nitro-L-arginine methyl ester; NO, nitric oxide; ODQ, 1H-[1,2,4]-oxadiazolo[4,3-a]quinoxalin-1-one; TEA, tetraethylammonium chloride; 4-AP, 4-aminopyridine; GADPH, glyceraldehyde-3-phosphate dehydrogenase; bp, base pairs; ANOVA, analysis of variance.
Address correspondence to: Dr. Ana Maria de Oliveira, Universidade de Sao Paulo, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Avenida do Café s/n, CEP 14040-903, Ribeirão Preto, Sao Paulo, Brazil. E-mail: amolive{at}usp.br
| References |
|---|
|
|
|---|
Abdel-Rahman AA, Dar MS, and Wooles WR (1985) Effect of chronic ethanol administration on arterial baroreceptor function and pressor and depressor responsiveness in rats. J Pharmacol Exp Ther 232: 194-201.
Abdel-Rahman AA and Wooles WR (1987) Ethanol-induced hypertension involves impairment of baroreceptors. Hypertension 10: 67-73.
Alabadi JA, Torregrosa G, Miranda FJ, Salom JB, Centeno JM, and Alborch E (1997) Impairment of the modulatory role of nitric oxide on the endothelin-1-elicited contraction of cerebral arteries: a pathogenetic factor in cerebral vasospasm after subarachnoid hemorrhage? Neurosurgery 41: 245-253.[CrossRef][Medline]
Altura BM, Altura BT, and Gebrewold A (1983) Alcohol-induced spasms of cerebral blood vessels: relation to cerebrovascular accidents and sudden death. Science (Wash DC) 220: 331-333.
Brown RA, Ilg KJ, Chen AF, and Ren J (2002) Dietary Mg2+ supplementation restores impaired vasoactive responses in isolated rat aorta induced by chronic ethanol consumption. Eur J Pharmacol 442: 241-250.[CrossRef][Medline]
Cardillo C, Kilcoyne CM, Waclawiw M, Cannon RO III, and Panza JA (1999) Role of endothelin in the increased vascular tone of patients with essential hypertension. Hypertension 33: 753-758.
Chan TC, Wall RA, and Sutter MC (1985) Chronic ethanol consumption, stress and hypertension. Hypertension 7: 519-524.
Eugene JR, Abdallah M, Miglietta M, Vernenkar VV, Pascual R, Briones R, Barnes T, and Hager J (1999) Carotid occlusive disease: primary care of patients with or without symptoms. Geriatrics 54: 24-33.[Medline]
Gill JS, Shipley MJ, Tsementzis SA, Hornby RS, Gilland SK, Hitchcock ER, and Beevers DG (1991) Alcohol consumption: a risk factor for hemorrhagic and nonhemorrhagic stroke. Am J Med 90: 489-497.[Medline]
Hatton DC, Bukoski RD, Eedgar S, and McCarron DA (1992) Chronic alcohol consumption lowers blood pressure but enhances vascular contractility in Wistar rats. J Hypertens 10: 529-537.[Medline]
Ihara M, Noguchi K, Saeki T, Fukuroda T, Tsuchida S, Kimura S, Fukami T, Ishikawa K, Nishikibe M, and Yano M (1991) Biological profiles of highly potent novel endothelin antagonists selective for the ETA receptor. Life Sci 50: 247-255.
Ishikawa K, Ihara M, Noguchi K, Mase T, Mino N, Saeki T, Fukuroda T, Fukami T, Ozaki S, Nagase T, et al. (1994) Biochemical and pharmacological profile of a potent and selective endothelin-B-receptor antagonist, BQ-788. Proc Natl Acad Sci USA 91: 4892-4896.
Kähönen M, Karjala K, Hutri-Kähönen N, Wu X, Jaatinen P, Riihioja P, Hervonen A, and Pörsti I (1999) Influence of chronic ethanol consumption on arterial tone in young and aged rats. Am J Physiol 276: H464-H471.[Medline]
Kitohara Y, Kato I, Iwamoto H, Nakayama K, and Fujishima M (1995) The impact of alcohol and hypertension on stroke incidence in a general Japanese population. Stroke 26: 368-372.
Lloréns S, Miranda FJ, Alabadi JA, Marrachelli VG, and Alborch E (2004) Different role of endothelin ETA and ETB receptors and endothelial modulators in diabetes-induced hyperreactivity of the rabbit carotid artery to endothelin-1. Eur J Pharmacol 486: 43-51.[CrossRef][Medline]
Melgaard B, Henriksen L, Ahlgren P, Danielsen UT, Sorensen H, and Paulson OB (1990) Regional cerebral blood flow in chronic alcoholics measured by single photon emission computerized tomography. Acta Neurol Scand 82: 87-93.[Medline]
Nanji AA, Khwaja S, Khettry U, and Sadrzadeh SMH (1994) Plasma endothelin levels in chronic ethanol fed rats: relationship to pathologic liver injury. Life Sci 54: 423-428.[CrossRef][Medline]
Nelson MT and Quayle JM (1995) Physiological roles and properties of potassium channels in arterial smooth muscle. Am J Physiol 268: C799-C822.[Medline]
Oishi M, Mochizuki Y, and Shikata E (1999) Corpus callosum atrophy and cerebral blood flow in chronic alcoholics. J Neurol Sci 162: 51-55.[CrossRef][Medline]
Pinardi G, Brieva C, Vinet R, and Penna M (1992) Effects of chronic ethanol consumption on
-adrenergic-induced contractions in rat thoracic aorta. Gen Pharmacol 23: 245-248.[Medline]
Resstel LB, Tirapelli CR, Lanchote VL, Uyemura SA, de Oliveira AM, and Correa FMA (2006) Chronic ethanol consumption alters cardiovascular functions in conscious rats. Life Sci 78: 2179-2187.[CrossRef][Medline]
Salom JB, Centeno JM, Torregrosa G, Ortí M, Barberá MD, and Alborch E (2000) Vasoconstriction to endothelin-1 in the goat middle cerebral artery after transient global cerebral ischemia. J Stroke Cerebrovasc Dis 9: 16-21.[Medline]
Strickland JA and Wooles WR (1988) Effect of acute and chronic ethanol on the agonist responses of vascular smooth muscle. Eur J Pharmacol 152: 83-91.[CrossRef][Medline]
Takai M, Umemura K, Yamasaki K, Watanabe T, Fujitani Y, Oda K, Urade Y, Inui T, Yamamura T, and Okada T (1992) A potent and specific agonist, Suc-[Glu9 Ala11,15]-endothelin-1 (8-21), IRL 1620, for ETB receptor. Biochem Biophys Res Commun 184: 953-959.[CrossRef][Medline]
Tesfamariam B, Brown ML, and Cohen RA (1991) Elevated glucose impairs endothelium-dependent relaxation by activating protein kinase C. J Clin Investig 87: 1643-1648.[Medline]
Tirapelli CR, Al-Khoury J, Bkaily G, D'Orleans-Juste P, Lanchote VL, Uyemura SA, and De Oliveira AM (2006) Chronic ethanol consumption enhances phenylephrine-induced contraction in the isolated rat aorta. J Pharmacol Exp Ther 316: 233-241.
Tirapelli CR, Casolari DA, Yogi A, Montezano AC, Tostes RC, Legros E, D'Orléans-Juste P, and De Oliveira AM (2005) Functional characterization and expression of endothelin receptors in rat carotid artery: ETB-induced relaxation involves the release of nitric oxide, a vasodilator prostanoid and the opening of K+ channels. Br J Pharmacol 146: 903-912.[CrossRef][Medline]
Tostes RC and Muscara MN (2005) Endothelin receptor antagonists: another potential alternative for cardiovascular diseases. Curr Drug Targets Cardiovasc Haematol Disord 5: 287-301.[CrossRef][Medline]
Utkan T, Yildiz F, Ilbay G, Ozdemirci S, Erden BF, Gacar N, and Ulak G (2001) Blood pressure and vascular reactivity to endothelin-1, phenylephrine, serotonin, KCl and acetylcholine following chronic alcohol consumption in vitro. Fundam Clin Pharmacol 15: 157-165.[CrossRef][Medline]
Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, and Masaki T (1988) A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature (Lond) 332: 411-415.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. Matsumoto, K. Ishida, N. Nakayama, T. Kobayashi, and K. Kamata Involvement of NO and MEK/ERK pathway in enhancement of endothelin-1-induced mesenteric artery contraction in later-stage type 2 diabetic Goto-Kakizaki rat Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1388 - H1397. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||