|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOXICOLOGY
Department of Physiology and Pathophysiology, Faculty of Medicine, University of Witten/Herdecke, Witten, Germany (N.A.W., M.A., F.T.); and Institut National de la Santé et de la Recherche Médicale U.538, Centre Hospitalo-Universitaire Saint Antoine, Paris, France (P.J.V.)
Received for publication
February 13, 2006
Accepted
May 9, 2006.
| Abstract |
|---|
|
|
|---|
7 kDa), freely filtered at the glomerulus. For Cd2+ to gain access to the proximal tubule cells, these complexes are thought to be internalized via receptors for small protein ligands, such as megalin and cubilin, followed by release of Cd2+ from metallothionein-1 in endosomal/lysosomal compartments. To investigate the role of megalin in renal cadmium-metallothionein-1 reabsorption, megalin expression and dependence of cadmium-metallothionein-1 internalization and cytotoxicity on megalin were studied in a renal proximal tubular cell model (WKPT-0293 Cl.2 cells). Expression of megalin was detected by reverse transcriptase-polymerase chain reaction and visualized by immunofluorescence both at the cell surface (live staining) and intracellularly (permeabilized cells). Internalization of Alexa Fluor 488-coupled metallothionein-1 was concentration-dependent, saturating at approximately 15 µM. At 14.3 µM, metallothionein-1 uptake could be significantly attenuated by 30.9 ± 6.6% (n = 4) by 1 µM of the receptor-associated protein (RAP) used as a competitive inhibitor of cadmium-metallothionein-1 binding to megalin and cubilin. Consistently, cytotoxicity of a 24-h treatment with 7.14 µM cadmium-metallothionein-1 was significantly reduced by 41.0 ± 7.6%, 61.6 ± 3.4%, and 26.2 ± 1.8% (n = 4-5 each) by the presence of 1 µM RAP, 400 µg/ml anti-megalin antibody, or 5 µM of the cubilin-specific ligand, apo-transferrin, respectively. Cubilin expression in proximal tubule cells was also confirmed at the mRNA and protein level. The data indicate that renal proximal tubular cadmium-metallothionein-1 uptake and cell death are mediated at least in part by megalin.
Because of its molecular mass of
7 kDa, any cadmium-metallothionein in the circulation is ultrafiltered by the kidney glomeruli and passes the renal tubules, where it is reabsorbed by the S1 segment of the proximal tubule. Therefore, this segment of the proximal tubule represents the primary target of Cd2+-induced nephrotoxicity (Friberg et al., 1986
; Thévenod, 2003
; Zalups and Ahmad, 2003
). Up to 7% of populations exposed to Cd2+ develop renal dysfunction (Friberg et al., 1986
), which may be associated with a general transport defect of the proximal tubule that mimics the de Toni-Debré-Fanconi Syndrome (Bernard et al., 1979
) with proteinuria, amino aciduria, glucosuria, and phosphaturia (for review, see Wedeen and De Broe, 1998
). Moreover, tubular apoptosis has also been described in vivo and in vitro (Liu et al., 1998
; Thévenod and Friedmann, 1999
).
The uptake pathways for cadmium-metallothionein in proximal tubule cells and the cellular processes underlying Cd2+ nephrotoxicity are poorly understood. It has been suggested that once taken up by endocytosis, Cd2+ is freed from metallothionein and transported out of the endo-/lysosomes, where free Cd2+ triggers apoptosis. However, in vivo as well as in vitro studies have yielded conflicting results as to the nephrotoxic and proapoptotic potency of cadmium-metallothionein (Hamada et al., 1996
; Liu et al., 1998
; Ishido et al., 1999
; Klaassen et al., 1999
). Acute cadmium-metallothionein injection was found to induce apoptosis of rat kidney proximal tubule in some studies (Ishido et al., 1998
), but not in others (Liu et al., 1998
). Likewise, cadmium-metallothionein promoted apoptosis of human embryonic kidney 293 cells (Hamada et al., 1996
) but had no effect on LLC-PK1 cells (Ishido et al., 1999
). We have shown previously that cadmium-metallothionein-1 uptake induces apoptosis of rat proximal tubule cells (Erfurt et al., 2003
). The inhibitor of acidic compartments, chloroquine, and the PI3-kinase blocker LY294002 prevented uptake of cadmium-metallothionein-1 and apoptosis (Erfurt et al., 2003
). Moreover, cadmium-metallothionein-1 was found to colocalize with the endo-/lysosomal markers rab5A and LAMP1, which indicates that cadmium-metallothionein-1 must traffic through the endo-/lysosomal pathway prior to Cd2+ release into the cytosol and development of apoptosis (Erfurt et al., 2003
). Recently, we have demonstrated that the divalent metal transporter 1 (DMT1) (Gunshin et al., 1997
) is expressed in the late endo-/lysosomal compartment, where it may contribute to transport of free metal ions, such as Fe2+ or Cd2+, out of these acidic compartments (Abouhamed et al., 2006
). Yet, the initial processes mediating cadmium-metallothionein-1 uptake at the brush-border membrane of proximal tubule cells remain unclear.
Two multiligand endocytic receptors, megalin and cubilin, are highly expressed in the early parts of the endocytic pathway of the renal proximal tubule, where they are responsible for tubular clearance of filtered proteins. The two receptors are coexpressed along the endocytic and recycling pathway and act in concert in the uptake of ligands (Christensen and Birn, 2001
). Following binding to these receptors at the apical membrane, ligands are internalized into coated vesicles and delivered to early and late endosomes. Whereas the receptors are recycled to the apical membrane, the ligands are transferred to lysosomes for protein degradation. Previous studies have suggested that megalin partly mediates the uptake of heavy metal-metallothionein complexes; in rats, proximal tubule uptake of cadmium-metallothionein and
2-microglobulin is mutually inhibitory (Bernard et al., 1987
), which, together with the observation that megalin is a receptor for
2-microglobulin in renal proximal tubule cells (Orlando et al., 1998
), suggested that megalin is implicated in metallothionein uptake. This was corroborated by studies demonstrating binding of metallothionein to megalin (Klassen et al., 2004
).
Thus, the present study aimed to determine the role of megalin for metallothionein-1 internalization and for cytotoxicity of cadmium-metallothionein-1 in cultured rat proximal tubule cells.
| Materials and Methods |
|---|
|
|
|---|
Antibodies
Polyclonal sheep anti-rat megalin antiserum and polyclonal rabbit anti-rat cubilin antiserum were obtained as described previously (Moestrup et al., 1993
; Le Panse et al., 1997
). Anti-rat megalin antiserum was diluted 1:4000 for permeabilized cells and 1:2000 (22°C) or 1:500 (4°C) for surface labeling. For surface labeling of cubilin, anti-rat cubilin antiserum was diluted 1:50 (for both 22 and 4°C) and for immunoblotting, 1:1000. The anti-angiotensin receptor subtype 1 antibody (Santa Cruz Biotechnology Inc., Heidelberg, Germany), used as a positive control, was diluted 1:50. Alexa Fluor 488 (Molecular Probes Europe BV) and Cy3-conjugated antibodies (Jackson ImmunoResearch Laboratories Inc., Cambridgeshire, UK) were diluted 1:500 and 1:600, respectively. The horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin was diluted 1:10,000 (GE Healthcare, Little Chalfont, Buckinghamshire, UK).
Cell Culture
An immortalized cell line from the S1 segment of rat proximal tubule (WKPT-0293 Cl.2) was cultured as described previously (Thévenod et al., 2000
; Lee et al., 2005
). Cells were passaged (passage number <60) twice a week upon reaching confluence.
Megalin and Cubilin Expression in WKPT-0293 Cl.2 Cells
Reverse Transcriptase-Polymerase Chain Reaction. Total RNA was extracted from trypsinized WKPT-0293 Cl.2 cells using the RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) with On-Column DNase digestion as per the manufacturer's instructions. First strand cDNA was synthesized with the Omniscript RT kit (QIAGEN), using 0.5 µg of RNA per reaction and oligo(dT) primer.
Megalin was detected in WKPT-0293 Cl.2-cDNA by nested PCR using the HotStarTaq Master Mix kit as per the manufacturer's instructions, with 8 vol% RT reaction in the first nest, and 10 vol% first nest reaction in the second nest. After the initial activation step at 95°C for 15 min, PCR was performed for 30 cycles of the following amplification parameters: 94°C for 45 s, 60°C for 45 s, and 72°C for 1 min, followed by a final extension period of 10 min at 72°C, for the first nest. For the second nest, cycling conditions were the same except for annealing at 56°C. The following primers (obtained from Operon Biotechnologies, Huntsville, AL) were used.
The outer primer pair (first nest) was designed with the FastPCR program version 3.6 (University of Helsinki, Institute of Biotechnology, Helsinki, Finland) based on the GenBank sequence of rat megalin (accession no. L34049
[GenBank]
): 347f, 5' TGCTGAGGGGACCTGCATCC 3'; and 803r, 5' GAACTGGTGACCTCCGCAGG 3'. The inner primer pair (second nest) was selected according to van Praet et al. (2003
): 377f, 5' GGTGTGTGACGAGGATAAGG 3'; and 777r, 5' AGTTGCAATTGCGCTCATCG 3'.
Selected primer pairs were spanning several exons allowing for discrimination between amplificates from cDNA and genomic DNA. Control reactions for each primer pair were also performed with the transcription control reaction without reverse transcriptase, and with water instead of cDNA template. PCR products were extracted from agarose gels using the QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer's protocol. Sequencing was performed by GATC Biotech (Konstanz, Germany), using ABI technology.
For detection of cubilin in WKPT-0293 Cl.2-cDNA, PCR was carried out with HotStar master mix with 2 vol% RT reaction using the following primers based on the GenBank sequence of rat cubilin (accession no. NM_053332 [GenBank] .2): 1535f, 5' TGCATGTCACCTTCACGTTT 3'; and 1740r, 5' TGTAAAGCCTCTCCCACTCC 3'. Thermal cycling was as follows: one cycle of initial HotStar polymerase activation at 95°C for 15 min, then 35 cycles at 94°C for 30 s, 61°C for 30 s, and 72°C for 45 s, followed by a final extension period of 7 min at 72°C.
Immunoblotting. To obtain homogenate from WKPT-0293 Cl.2 cells, confluent monolayers were scraped with a rubber policeman, washed in homogenization buffer as described above, and sonicated on ice for 3 x 5 s at 10 A. Aliquots of homogenate containing 50 µg of protein were mixed with nonreducing Laemmli buffer and incubated for 30 min at 37°C before being subjected to 5% SDS-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes overnight at 4°C. Blots were blocked with 3% nonfat dry milk and incubated overnight at 4°C with primary anti-rat cubilin antiserum (1:1000). Following incubation with horseradish peroxidase-conjugated secondary antibody (1:10,000) for 1 h at 4°C, blots were developed using Western Lighting Plus chemiluminescence reagents (Perkin Elmer Life Sciences, Boston, MA), and signals were visualized on X-ray film.
Immunofluorescence Labeling. In preliminary experiments, we noticed that fixation of cultured WKPT-0293 Cl.2 cells by a standard procedure (2-4% paraformaldehyde for 15-30 min) caused cellular permeabilization. Therefore, the surface labeling method was adapted from Gibson et al. (2005
). In principle, live cells grown on coverslips were incubated with primary and secondary antibodies before fixation with paraformaldehyde. Cells grown on coverslips were blocked with 1% bovine serum albumin in Ca2+/Mg2+-containing phosphate-buffered saline (PBS) for 60 min and then incubated with primary antibody diluted in blocking buffer for 30 min (22°C) or 90 min (4°C). They were then washed three times with PBS + Ca2+/Mg2+ and incubated with Alexa Fluor 488- or Cy3-conjugated secondary antibody, diluted also in blocking buffer, for 30 (22°C) or 90 (4°C) min. After three washes with PBS + Ca2+/Mg2+, the cells were fixed with 2% paraformaldehyde in PBS for 30 min at 22°C. Coverslips were then washed three times in PBS and once briefly in distilled water before mounting them with 5 µl of DAKO fluorescence mounting medium (Dako Cytomation, Carpinteria, CA) each. All incubations prior to fixation were carried out at either 22°C, or at 4°C to reduce internalization of primary antibodies, and yielded comparable results. The cells were viewed using filters for Cy3 (red) and FITC (green) with excitation/emission wavelengths of 545/610 and 480/535 nm, respectively, using a mercury short arc photo optic lamp HBO (103 W/2; OSRAM, Augsburg, Germany) as the light source, connected to a Zeiss Axiovert 200M microscope (Carl Zeiss, Jena, Germany) equipped with Fluar 20x, 0.75 UV and Fluar 40x, 1.3 oil immersion objectives. Images were captured using a digital Cool-SPAN ES CCD camera (Roper Scientific, Inc., Tucson, AZ) and acquired at fixed exposure times (1000-1200 ms), processed, and analyzed semiquantitatively with MetaMorph software (Universal Imaging Corporation, Downingtown, PA).
For immunofluorescence labeling of permeabilized WKPT-0293 Cl.2 cells, cells were first fixed with 4% paraformaldehyde in PBS for 30 min, washed three times, permeabilized with 1% sodium dodecyl sulfate/PBS for 15 min, again washed three times, blocked with 1% bovine serum albumin in PBS for 60 min, washed three times in PBS, incubated with primary antibody overnight at 4°C and with secondary antibody for 1 h at 22°C (both antibodies in PBS containing 1% bovine serum albumin) washing three times in between. The cells were then mounted and imaged as before.
Fluorescence Measurement of Alexa Fluor 488-Conjugated Metallothionein-1 Uptake in WKPT-0293 Cl.2 Cells and Semiquantitative Analysis of Fluorescence Intensity
To obtain Alexa Fluor 488-conjugated metallothionein-1, we essentially followed the protocol described by Klassen et al. (2004
). In brief, Alexa Fluor 488 carboxylic acid succinimidyl ester was coupled to rabbit liver metallothionein-1 according to the manufacturer's instructions (Molecular Probes Europe BV). The conjugate was separated from unreacted labeling reagent by microdialysis using Slide-A-Lyzer dialysis cassettes (Pierce) with a molecular mass cut-off of 3.5 kDa. Cells (5 x 104) were grown for 48 h in 35-mm dishes on glass coverslips. The cell culture medium was replaced by serum-free medium, and cells were incubated further with various concentrations of Alexa Fluor 488-conjugated metallothionein-1 for different time periods. All subsequent steps were performed at 22°C. Cells were rinsed three times for 7 min in PBS, fixed with 4% paraformaldehyde/PBS for 30 min, washed three times in PBS for 5 min, counterstained with H-33342 (1 µg/ml), washed four times in PBS for 5 min, washed 5 min in H2O, and coverslips were mounted onto glass slides with DAKO fluorescence mounting medium. The cells were viewed using filters for FITC (green) and 4,6-diamidino-2-phenylindole (blue) with excitation/emission wavelengths of 480/535 and 360/460 nm, respectively, processed, and analyzed as described above. In some experiments, Alexa Fluor 488-conjugated metallothionein-1 uptake into WKPT-0293 Cl.2 cells was determined in the presence or absence of 1 µM RAP, and in those experiments, 1 x 104 cells were grown for 48 h in 35-mm dishes on glass coverslips. In the control experiments without RAP, an equal volume of the buffer, in which the protein had been dissolved, was added to the serum-free medium.
For quantitative determination of Alexa Fluor 488-conjugated metallothionein-1 uptake into WKPT-0293 Cl.2 cells, 300 to 500 cells in five to eight microscopic fields were analyzed for each experiment with the MetaMorph software. FITC images were used for analysis after autothreshold background subtraction. Mean fluorescence intensity per image was determined and divided by the cell number (by counting the nuclei in the respective 4,6-diamidino-2-phenylindole images) to obtain the mean fluorescence intensity/cell. The values obtained were corrected for endogenous cellular autofluorescence by subtracting the mean fluorescence intensity of control cells.
3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide Cell Viability Assay and Competitive Inhibition Experiments of Cadmium-Metallothionein-1 Binding to Megalin
WKPT-0293 Cl.2 cells were seeded at 3000 cells per well in 24-well plates. Forty-eight hours postseeding, the wells showing the most even growth were selected for further processing. The medium was aspirated and replaced with 200 µl of serum-free culture medium with or without a saturating concentration of the megalin ligand RAP (1 µM) (Orlando and Farquhar, 1994
; Zhai et al., 2000
) or with 400 µg/ml IgG from anti-megalin (Moestrup et al., 1993
; Zhai et al., 2000
) or sheep control serum, protein-G-Sepharose-purified as described below. After a 15-min (RAP) or 30-min (anti-megalin; apotransferrin) preincubation at 37°C, 7.14 µM metallothionein-1 or cadmium-metallothionein-1 (50 µM Cd2+, 7.14 µM metallothionein-1) were added to the medium, and the cells were incubated for another 24 h. Cadmium-reconstituted metallothionein-1 was prepared from metallothionein-1 exactly as described previously (Erfurt et al., 2003
). Cell viability was then assayed using the MTT test as described previously (Lee et al., 2005
). In brief, the cells were incubated for 3 h in serum-free medium without phenol red containing 1 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT). The medium was then aspirated, and the formazan product dissolved in isopropanol and measured at 560 and 690 nm. Data are expressed as relative absorbance to the RAP-free or control IgG containing metallothionein-1 controls.
Protein G-Sepharose Purification of IgG from Anti-Megalin or Sheep Serum
For competition experiments, anti-megalin serum or sheep control serumwas purified on protein G Sepharose (Zymed Laboratories, San Francisco, CA) columns as described by Invitrogen (Carlsbad, CA). In brief, serum was first delipidated by adding 1.5 volumes of 1,1,2-trichlorotrifluoro-ethane, shaking for 30 min at room temperature, and subsequent centrifugation for 10 min at 5000 rpm in a standard microcentrifuge. The aqueous layer was then loaded onto a protein G Sepharose column equilibrated with 10 bed volumes of binding buffer (10 mM sodium phosphate, pH 7.0). The column was then washed with binding buffer, until A280 returned to baseline. Bound antibodies were then eluted with 0.1 M glycine-HCl, pH 2.7, into tubes containing 1/10 of the fraction volume of 2 M Tris, pH 8.0. Positive fractions identified by their A280 values were then pooled, the elution buffer was exchanged for binding buffer containing 0.05% sodium azide using Microcon 50 filters (Millipore, Schwalbach, Germany) as per the manufacturer's instructions, and the purified antibodies were stored at 4°C. The protein content of the antibody solutions was determined using the Bradford protein assay as described previously (Lee et al., 2005
), using bovine serum albumin as a standard.
Statistical Analyses
Representative data or means ± S.E.M. are shown. Statistical analysis using unpaired Student's t test was carried out with Sigma Plot 8.0 (SPSS Inc., Chicago, IL). For more than two groups, one-way ANOVA was used assuming equality of variance with Levene's test and Tukey post hoc test for pair-wise comparison with SPSS 11.0. Results with P
0.05 were considered to be statistically significant.
| Results |
|---|
|
|
|---|
|
Immunofluorescence Labeling of Rat Megalin. As shown in Fig. 2A after addition of polyclonal sheep anti-rat megalin antiserum (1:2000; 22°C), punctate surface labeling of megalin was observed, indicating that WKPT-0293 Cl.2 cells express megalin at their surface. In contrast, in the absence of primary antibody, only background fluorescence was observed (Fig. 2B). Furthermore, we found partial colocalization of megalin with the angiotensin receptor subtype 1, which is expressed on the apical cell side of WKPT-0293 Cl.2 cells (Kolb et al., 2004
). The focus of fluorescence of both the angiotensin receptor subtype 1 and megalin was near the apical cell border, whereas there was little fluorescence at the base of the cells (data not shown). Interestingly, in permeabilized cells, megalin staining was enhanced compared with nonpermeabilized cells, suggesting that megalin is also expressed intracellularly (data not shown). To avoid internalization of primary antibodies, surface labeling of live cells with anti-rat megalin antiserum was also performed at 4°C (1:500), yielding similar results (data not shown). Taken together, both RT-PCR and immunofluorescence experiments indicate that WKPT-0293 Cl.2 cells express megalin that is predominantly located at the apical cell side.
|
Kinetics and Concentration Dependence of Metallothionein-1 Uptake into WKPT-0293 Cl.2 Cells. To monitor metallothionein-1 uptake into proximal tubule cells, rabbit metallothionein-1 was coupled to Alexa Fluor 488, and the concentration dependence (Fig. 3A) and kinetics (Fig. 3B) of Alexa Fluor 488-conjugated metallothionein-1 were monitored by fluorescence microscopy. When exposed to different concentrations of metallothionein-1 for 24 h, uptake increased as a function of the metallothionein-1 concentration and approached saturation at approximately 15 µM (Fig. 3A). This concentration (14.3 µM) was selected to determine the time course of metallothionein-1 uptake. Figure 3B shows a linear increase of metallothionein-1 uptake over time up to 48 h. These data extend a previous study with WKPT-0293 Cl.2 cells, in which uptake of metallothionein-1 had been determined with a polyclonal antibody against metallothionein-1 and metallothionein-2 (Erfurt et al., 2003
).
|
Effect of RAP on Alexa Fluor 488 Metallothionein-1 Uptake into WKPT-0293 Cl.2 Cells. When proximal tubule cells where preincubated with 1 µM RAP for 15 min and exposed to 14.3 µM Alexa Fluor 488-conjugated metallothionein-1 for 24 h in the continuous presence of 1 µM RAP, uptake of metallothionein-1 was significantly attenuated by 30.9 ± 6.6%, compared with controls (P < 0.01; n = 4) (Fig. 4). These data suggest that uptake of Alexa Fluor 488-conjugated metallothionein-1 is at least in part mediated by the endocytic receptor megalin expressed on WKPT-0293 Cl.2 cells. Thus, the WKPT-0293 Cl.2 cell line appeared suitable to study the role of megalin in cadmium-metallothionein-1-induced cell death.
|
|
Effect of Anti-Megalin IgG on Cadmium-Metallothionein-1-Induced Cell Death of WKPT-0293 Cl.2 Cells. To confirm the contribution of megalin receptor-mediated endocytosis of cadmium-metallothionein-1 to cytotoxicity of WKPT-0293 Cl.2 cells, a functional sheep anti-rat megalin antiserum that interferes with ligand binding to megalin was tested. In preliminary experiments, cells were preincubated for 30 min with anti-rat megalin antiserum (dilution 1:100) or with the respective protein concentration of sheep serum used as a negative control and then coincubated for 24 h with 7.14 µM cadmium-metallothionein-1 before measuring cell viability with the MTT assay. These experiments indicated that sheep serum increased viability of cells incubated with 7.14 µM cadmium-metallothionein-1 to the same extent as sheep anti-rat megalin antiserum, suggesting that protein components present in both sera interfere with cadmium-metallothionein-1 binding to megalin. As a consequence, both control sheep IgG and specific anti-rat megalin IgG were affinity-purified using protein G-Sepharose, and 400 µg/ml of the respective purified IgG (Moestrup et al., 1993
; Zhai et al., 2000
) was applied to cells that were exposed to 7.14 µM cadmium-metallothionein-1 30 min later. After 24 h of coincubation with 7.14 µM cadmium-metallothionein-1 and sheep IgG, cell viability of proximal tubule cells was 35.6 ± 3.9% of metallothionein-1 controls (n = 5). Anti-rat megalin IgG significantly increased cell viability to 74.8 ± 3.6% (P < 0.01; n = 5) (Fig. 6); that is, cytotoxicity was significantly reduced by 61.6 ± 3.4% (Fig. 6). This indicates that anti-rat megalin IgG interferes with internalization of cadmium-metallothionein-1 that is mediated by the megalin receptor. Surprisingly, compared with cadmium-metallothionein-1 alone, coincubation of cadmium-metallothionein-1 with sheep IgG decreased cell viability from 58.4 ± 3.1% versus 35.6 ± 3.9%, suggesting that sheep IgG may enhance cadmium-metallothionein-1 uptake and toxicity. However, the reason for this enhancement of cell death may be nonspecific toxic effects and unrelated to megalin dependent cadmium-metallothionein-1 internalization. Nonspecific effects of sheep IgG have also been described on albumin uptake in opossum kidney cells, which were, however, in the opposite direction to the effects observed in our study (Zhai et al., 2000
).
|
Evidence for Cubilin Expression and Involvement in Cadmium-Metallothionein-1-Induced Cell Death of WKPT-0293 Cl.2 Cells. Megalin and cubilin are coexpressed on the apical membrane and along the endocytic and recycling pathways of kidney proximal tubule cells and apparently interact in the uptake of ligands, such as RAP (Hammad et al., 1999
; Christensen and Birn, 2001
). Hence, internalization of cadmium-metallothionein-1 and subsequent cell death could also be mediated by cubilin. Thus, we first assayed for expression of cubilin in WKPT-0293 Cl.2 cells by RT-PCR using a rat cubilin-specific primer pair. After 35 cycles of PCR, one band of the expected size of 206 bp was detected, as predicted from the corresponding GenBank sequence (Fig. 7A). No bands were detected in reactions with the RT control reaction without reverse transcriptase or with H2O. Protein expression of cubilin was demonstrated by live immunofluorescence imaging (Fig. 7B) and immunoblotting (Fig. 7C). As shown in Fig. 7B, after addition of polyclonal rabbit anti-rat cubilin antiserum (1:50), punctate surface labeling of cubilin was observed indicating that WKPT-0293 Cl.2 cells express cubilin at their surface. In contrast, in the absence of primary antibody, only background fluorescence was observed (data not shown). Similar results were also obtained by incubating at 4°C (data not shown). Moreover, immunoblotting WKPT-0293 Cl.2 cell lysates yielded a single band of approximately 460 kDa (Fig. 7C), thus confirming cubilin protein expression by an independent technique. Transferrin is known to bind exclusively to cubilin (Kozyraki et al., 2001
). Hence, to test for cubilin involvement in cadmium-metallothionein-1-induced cell death of proximal tubule cells, we have coincubated WKPT-0293 Cl.2 cells with an approximately equimolar concentration of apo-transferrin and cadmium-metallothionein-1 or metallothionein-1 for 24 h and studied its effect on cell viability with the MTT assay. Interestingly, apo-transferrin (5 µM) significantly increased cell viability from 43.6 ± 2.5% (of metallothionein-1 controls) with 7.14 µM cadmium-metallothionein-1 alone to 58.3 ± 2.6% when cadmium-metallothionein-1 was coincubated with apo-transferrin (n = 4; P < 0.01) (Fig. 7D), i.e., cytotoxicity was significantly reduced by 26.2 ± 1.8%. This indicates that cadmium-metallothionein-1 uptake and cytotoxicity are partly mediated by an interaction of cadmium-metallothionein-1 with cubilin and that the inhibitory effect of RAP on Alexa Fluor 488-conjugated metallothionein-1 uptake (Fig. 4) and cadmium-metallothionein-1-mediated cell death of WKPT-0293 Cl.2 cells (Fig. 5) may be due at least in part by an interaction of RAP with cubilin.
|
| Discussion |
|---|
|
|
|---|
Megalin, an apical membrane protein in proximal tubule cells, is a receptor involved in the reabsorption of filtered proteins (Christensen and Birn, 2001
), and it has been shown previously in vivo that s.c. injection of cadmium-metallothionein-1 resulted in internalization of apical megalin into vesicular structures (Sabolic et al., 2002
), whereas in vitro studies have demonstrated direct binding of metallothionein-1 to megalin (Klassen et al., 2004
). The results of the present study support the hypothesis that megalin mediates cadmium-metallothionein-1 internalization. First, we demonstrated by RT-PCR that the WKPT-0293 Cl.2 cell line indeed expresses megalin (Fig. 1). This confirms previous studies with immortalized cell lines derived from the S1 segment of rat proximal tubule (Kanalas and Hopfer, 1997
). Moreover, we observed by immunofluorescence microscopy that megalin is expressed both at the surface of proximal tubule cells (Fig. 2) and intracellularly (data not shown). RAP, a ligand for megalin (Moestrup et al., 1996
), reduced both Alexa Fluor 488-conjugated metallothionein-1 uptake (Fig. 4) and cadmium-metallothionein-1-mediated cell death (Fig. 5). Moreover, a functional IgG antibody against rat megalin increased cell viability in the presence of cadmium-metallothionein-1 (Fig. 6). Hence, this study demonstrates for the first time that cell death induced by internalization of cadmium-metallothionein-1 is caused by megalin-dependent endocytosis of the cadmium-metallothionein-1 complex. Several mechanisms could underlie the decrease of cytotoxicity mediated by cadmium-metallothionein-1 when coincubated with RAP or anti-megalin antibody. The ligands applied may compete with cadmium-metallothionein-1 for binding, and/or they may induce internalization of megalin receptors, thus limiting the availability of megalin receptors on the cell surface for cadmium-metallothionein-1. Irrespective of the mechanism underlying the decrease of cytotoxicity observed the conclusion from the data presented is that cadmium-metallothionein-1 internalization and cytotoxicity of proximal tubule cells are megalin-dependent.
The experiments with RAP, however, do not exclude the possibility that internalization of cadmium-metallothionein-1 also involves cubilin-mediated endocytosis of the protein-metal complex. RAP is also a ligand for cubilin (Hammad et al., 1999
), another multiligand endocytic receptor closely associated with megalin in the apical membrane of proximal tubule cells (Hammad et al., 1999
). Although some ligands, such as albumin, bind to both receptors (Zhai et al., 2000
), others, such as
2-microglobulin, bind exclusively to megalin (Orlando et al., 1998
). Transferrin, on the other hand, exclusively binds to cubilin (Kozyraki et al., 2001
). Klassen et al. (2004
) have demonstrated that cubilin antisera prevent uptake of fluorescently labeled metallothionein into megalin and cubilin expressing rat yolk sac BN-16 cells and therefore could not rule out a role of cubilin in metallothionein uptake. Yet, in the same study, surface plasmon resonance experiments showed no binding of metallothionein peptides to cubilin, and cubilin antisera only marginally reduced binding of fluorescently labeled metallothionein to rat renal cortex brush-border membrane vesicles arguing against an involvement of cubilin (Klassen et al., 2004
). In the present study, we first showed that WKPT-0293 Cl.2 cells also express cubilin at the mRNA (Fig. 7A) and protein level (Fig. 7C) and that cubilin is located at the surface of proximal tubule cells (Fig. 7B). To test for cubilin involvement in cadmium-metallothionein-1-induced cell death of proximal tubule cells, we coincubated WKPT-0293 Cl.2 cells with equimolar concentrations of apo-transferrin and cadmium-metallothionein-1. The data indicate that apo-transferrin partially reduces cadmium-metallothionein-1-induced cytotoxicity although to a smaller extent than RAP or anti-megalin antibody (Fig. 7D). This may support the observation made by others that some protein ligands are internalized via both receptors (for review, see Christensen and Birn, 2001
). Yet, it does not contradict the conclusion that cadmium-metallothionein-1 uptake and cytotoxicity are megalin-dependent because it has previously been shown that megalin deficiency causes failure in internalization of cubilin-ligand complexes, indicating that cubilin-mediated internalization is itself megalin-dependent (Kozyraki et al., 2001
).
Approximately 50% of Alexa Fluor 488-conjugated metallothionein-1 uptake (Fig. 4) and cadmium-metallothionein-1-mediated cell death (Figs. 5 and 6) were not blocked by RAP or anti-megalin IgG. It is therefore possible that, additionally, either megalin- and cubilin-independent, clathrin-mediated endocytosis or fluid-phase endocytosis pathways are involved in internalization of cadmium-metallothionein-1 by WKPT-0293 Cl.2 cells.
The cell death induced by cadmium-metallothionein-1 at 24 h (Figs. 5 and 6) is higher than described previously (Erfurt et al., 2003
). This can be accounted for by the facts that serum-free medium and 10 times higher cadmium-metallothionein-1 concentrations were used in the present study. Once cadmium-metallothionein-1 has been endocytosed, we assume that it is transported through endosomal pathways to lysosomes, where the metallothionein-1 moiety is degraded by acidic proteases (Thévenod, 2003
). Although no proof for this mechanism is available so far, recent data from our laboratory have demonstrated that DMT1 is expressed in late endosomes and lysosomes of both rat kidney cortical proximal tubule cells and the WKPT-0293 Cl.2 cell line (Abouhamed et al., 2006
). DMT1 is known to function as an H+-coupled transporter of a range of divalent transition metal ions, including Cd2+ and lead (Gunshin et al., 1997
; Bressler et al., 2004
). This indication suggests that a crucial step in the cascade of events leading to cellular toxicity induced by cadmium-metallothionein-1 should be the release of free Cd2+ from acidic late endosomes/lysosomes into the cytosol (Thévenod, 2003
). Increased cytosolic Cd2+ then would lead to mitochondrial damage and cell death by apoptosis (Lee et al., 2005
). Ongoing experiments in the laboratory are aimed at providing direct evidence for a key role of late endosomal/lysosomal DMT1 in mediating cadmium-metallothionein-1-induced cell death in proximal tubule cells.
In summary, we provide evidence that internalization of cadmium-metallothionein-1 by cultured cells derived from the S1 segment of proximal tubule cells is partly mediated by megalin-dependent endocytosis and that inhibition of this megalin-dependent process by RAP, anti-megalin IgG, or the cubilin ligand apo-transferrin significantly attenuates cadmium-metallothionein-1-induced death of proximal tubule cells.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: LY294002, 2-(4-morpholinyl)-8-phenyl-1(4H)-benzopyran-4-one hydrochloride; DMT1, divalent metal transporter 1; RAP, receptor-associated protein; RT, reverse transcriptase; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate; H-33342, 2'-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-2,5'-bi-1H-benzimidazole, 3HCl; MTT, (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; ANOVA, analysis of variance.
1 Both authors contributed equally to this work. ![]()
Address correspondence to: Dr. Frank Thévenod, Department of Physiology and Pathophysiology, University of Witten/Herdecke, Faculty of Medicine, Stockumer Strasse 12, D-58448 Witten, Germany. E-mail: frank.thevenod{at}uni-wh.de
| References |
|---|
|
|
|---|
Abouhamed M, Gburek J, Liu W, Torchalski B, Wilhelm A, Wolff NA, Christensen EI, Thévenod F, and Smith CP (2006) Divalent metal transporter 1 in the kidney proximal tubule is expressed in late endosomes/lysosomal membranes: implications for renal handling of protein-metal complexes. Am J Physiol 290: F1525-F1533.
Bernard A, Buchet JP, Roels H, Masson P, and Lauwerys R (1979) Renal excretion of proteins and enzymes in workers exposed to cadmium. Eur J Clin Investig 9: 11-22.[Medline]
Bernard AM, Ouled Amor A, and Lauwerys RR (1987) The effects of low doses of cadmium-metallothionein on the renal uptake of beta 2-microglobulin in rats. Toxicol Appl Pharmacol 87: 440-445.[CrossRef][Medline]
Bressler JP, Olivi L, Cheong JH, Kim Y, and Bannona D (2004) Divalent metal transporter 1 in lead and cadmium transport. Ann NY Acad Sci 1012: 142-152.[CrossRef][Medline]
Bridges CC and Zalups RK (2005) Molecular and ionic mimicry and the transport of toxic metals. Toxicol Appl Pharmacol 204: 274-308.[CrossRef][Medline]
Cherian MG and Vostal JJ (1977) Biliary excretion of cadmium in rat. I. Dose-dependent biliary excretion and the form of cadmium in the bile. J Toxicol Environ Health 2: 945-954.[Medline]
Christensen EI and Birn H (2001) Megalin and cubilin: synergistic endocytic receptors in renal proximal tubule. Am J Physiol 280: F562-F573.
Coyle P, Philcox JC, Carey LC, and Rofe AM (2002) Metallothionein: the multipurpose protein. Cell Mol Life Sci 59: 627-647.[CrossRef][Medline]
Dorian C, Gattone VH 2nd, and Klaassen CD (1995) Discrepancy between the nephrotoxic potencies of cadmium-metallothionein and cadmium chloride and the renal concentration of cadmium in the proximal convoluted tubules. Toxicol Appl Pharmacol 130: 161-168.[CrossRef][Medline]
Dudley RE, Gammal LM, and Klaassen CD (1985) Cadmium-induced hepatic and renal injury in chronically exposed rats: likely role of hepatic cadmium-metallothionein in nephrotoxicity. Toxicol Appl Pharmacol 77: 414-426.[CrossRef][Medline]
Erfurt C, Roussa E, and Thévenod F (2003) Apoptosis by Cd2+ or CdMT in proximal tubule cells: different uptake routes and permissive role of endo/lysosomal CdMT uptake. Am J Physiol 285: C1367-C1376.
Felley-Bosco E and Diezi J (1989) Fate of cadmium in rat renal tubules: a micropuncture study. Toxicol Appl Pharmacol 98: 243-251.[CrossRef][Medline]
Friberg L, Elinder CG, Kjellstrom T, and Nordberg GF (1986) Cadmium and Health: A Toxicological and Epidemiological Approach, CRC Press, Inc., Boca Raton, FL.
Gibson A, Lewis AP, Affleck K, Aitken AJ, Meldrum E, and Thompson N (2005) hCLCA1 and mCLCA3 are secreted non-integral membrane proteins and therefore are not ion channels. J Biol Chem 280: 27205-27212.
Goumakos W, Laussac JP, and Sarkar B (1991) Binding of cadmium(II) and zinc(II) to human and dog serum albumins: an equilibrium dialysis and 113Cd-NMR study. Biochem Cell Biol 69: 809-820.[Medline]
Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, and Hediger MA (1997) Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature (Lond) 388: 482-488.[CrossRef][Medline]
Hamada T, Sasaguri T, Tanimoto A, Arima N, Shimajiri S, Abe T, and Sasaguri Y (1996) Apoptosis of human kidney 293 cells is promoted by polymerized cadmium-metallothionein. Biochem Biophys Res Commun 219: 829-834.[CrossRef][Medline]
Hammad SM, Stefansson S, Twal WO, Drake CJ, Fleming P, Remaley A, Brewer HB Jr, and Argraves WS (1999) Cubilin, the endocytic receptor for intrinsic factor-vitamin B(12) complex, mediates high-density lipoprotein holoparticle endocytosis. Proc Natl Acad Sci USA 96: 10158-10163.
Ishido M, Homma-Takeda S, Tohyama C, and Suzuki T (1998) Apoptosis in rat renal proximal tubular cells induced by cadmium. J Toxicol Environ Health A 55: 1-12.[CrossRef][Medline]
Ishido M, Tohyama C, and Suzuki T (1999) Cadmium-bound metallothionein induces apoptosis in rat kidneys, but not in cultured kidney LLC-PK1 cells. Life Sci 64: 797-804.[CrossRef][Medline]
Kanalas JJ and Hopfer U (1997) Effect of TGF-beta 1 and TNF-alpha on the plasminogen system of rat proximal tubular epithelial cells. J Am Soc Nephrol 8: 184-192.[Abstract]
Klaassen CD, Liu J, and Choudhuri S (1999) Metallothionein: an intracellular protein to protect against cadmium toxicity. Annu Rev Pharmacol Toxicol 39: 267-294.[CrossRef][Medline]
Klassen RB, Crenshaw K, Kozyraki R, Verroust PJ, Tio L, Atrian S, Allen PL, and Hammond TG (2004) Megalin mediates renal uptake of heavy metal metallothionein complexes. Am J Physiol 287: F393-F403.
Kolb RJ, Woost PG, and Hopfer U (2004) Membrane trafficking of angiotensin receptor type-1 and mechanochemical signal transduction in proximal tubule cells. Hypertension 44: 352-359.
Kozyraki R, Fyfe J, Verroust PJ, Jacobsen C, Dautry-Varsat A, Gburek J, Willnow TE, Christensen EI, and Moestrup SK (2001) Megalin-dependent cubilin-mediated endocytosis is a major pathway for the apical uptake of transferrin in polarized epithelia. Proc Natl Acad Sci USA 98: 12491-12496.
Lee WK, Bork U, Gholamrezaei F, and Thévenod F (2005) Cd2+-induced cytochrome c release in apoptotic proximal tubule cells: role of mitochondrial permeability transition pore and Ca2+ uniporter. Am J Physiol 288: F27-F39.
Le Panse S, Ayani E, Nielsen S, Ronco P, Verroust P, and Christensen EI (1997) Internalization and recycling of glycoprotein 280 in epithelial cells of yolk sac. Eur J Cell Biol 72: 257-267.[Medline]
Liu J, Habeebu SS, Liu Y, and Klaassen CD (1998) Acute CdMT injection is not a good model to study chronic Cd nephropathy: comparison of chronic CdCl2 and CdMT exposure with acute CdMT injection in rats. Toxicol Appl Pharmacol 153: 48-58.[CrossRef][Medline]
Moestrup SK, Birn H, Fischer PB, Petersen CM, Verroust PJ, Sim RB, Christensen EI, and Nexo E (1996) Megalin-mediated endocytosis of transcobalamin-vitamin-B12 complexes suggests a role of the receptor in vitamin-B12 homeostasis. Proc Natl Acad Sci USA 93: 8612-8617.
Moestrup SK, Nielsen S, Andreasen P, Jorgensen KE, Nykjaer A, Roigaard H, Gliemann J, and Christensen EI (1993) Epithelial glycoprotein-330 mediates endocytosis of plasminogen activator-plasminogen activator inhibitor type-1 complexes. J Biol Chem 268: 16564-16570.
Orlando RA and Farquhar MG (1994) Functional domains of the receptor-associated protein (RAP). Proc Natl Acad Sci USA 91: 3161-3165.
Orlando RA, Rader K, Authier F, Yamazaki H, Posner BI, Bergeron JJ, and Farquhar MG (1998) Megalin is an endocytic receptor for insulin. J Am Soc Nephrol 9: 1759-1766.[Abstract]
Sabolic I, Ljubojevic M, Herak-Kramberger CM, and Brown D (2002) Cd-MT causes endocytosis of brush-border transporters in rat renal proximal tubules. Am J Physiol 283: F1389-F1402.
Thévenod F (2003) Nephrotoxicity and the proximal tubule: insights from cadmium. Nephron Physiol 93: p87-93.[CrossRef][Medline]
Thévenod F and Friedmann JM (1999) Cadmium-mediated oxidative stress in kidney proximal tubule cells induces degradation of Na+/K(+)-ATPase through proteasomal and endo-/lysosomal proteolytic pathways. FASEB J 13: 1751-1761.
Thévenod F, Friedmann JM, Katsen AD, and Hauser IA (2000) Up-regulation of multidrug resistance P-glycoprotein via nuclear factor-kappaB activation protects kidney proximal tubule cells from cadmium- and reactive oxygen species-induced apoptosis. J Biol Chem 275: 1887-1896.
Van Praet O, Argraves WS, and Morales CR (2003) Co-expression and interaction of cubilin and megalin in the adult male rat reproductive system. Mol Reprod Dev 64: 129-135.[CrossRef][Medline]
Wedeen RP and De Broe ME (1998) Nephrotoxic environmental agents, in Oxford Textbook of Clinical Nephrology (Davison AM ed) pp 1175-1189, Oxford University Press, Oxford, UK.
Zalups RK and Ahmad S (2003) Molecular handling of cadmium in transporting epithelia. Toxicol Appl Pharmacol 186: 163-188.[CrossRef][Medline]
Zhai XY, Nielsen R, Birn H, Drumm K, Mildenberger S, Freudinger R, Moestrup SK, Verroust PJ, Christensen EI, and Gekle M (2000) Cubilin- and megalin-mediated uptake of albumin in cultured proximal tubule cells of opossum kidney. Kidney Int 58: 1523-1533.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
R. S. Chung, M. Penkowa, J. Dittmann, C. E. King, C. Bartlett, J. W. Asmussen, J. Hidalgo, J. Carrasco, Y. K. J. Leung, A. K. Walker, et al. Redefining the Role of Metallothionein within the Injured Brain: EXTRACELLULAR METALLOTHIONEINS PLAY AN IMPORTANT ROLE IN THE ASTROCYTE-NEURON RESPONSE TO INJURY J. Biol. Chem., May 30, 2008; 283(22): 15349 - 15358. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brandes, O. Oehlke, A. Schumann, S. Heidrich, F. Thevenod, and E. Roussa Adaptive redistribution of NBCe1-A and NBCe1-B in rat kidney proximal tubule and striated ducts of salivary glands during acid-base disturbances Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2007; 293(6): R2400 - R2411. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Jacquillet, O. Barbier, I. Rubera, M. Tauc, A. Borderie, M. C. Namorado, D. Martin, G. Sierra, J. L. Reyes, P. Poujeol, et al. Cadmium causes delayed effects on renal function in the offspring of cadmium-contaminated pregnant female rats Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1450 - F1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-K. Lee, B. Torchalski, and F. Thevenod Cadmium-induced ceramide formation triggers calpain-dependent apoptosis in cultured kidney proximal tubule cells Am J Physiol Cell Physiol, September 1, 2007; 293(3): C839 - C847. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ciarimboli Unraveling the ceramide-calpain-caspase connection in cadmium-induced apoptosis: a novel role for ceramides as activators of calpains. Focus on "Cadmium-induced ceramide formation triggers calpain-dependent apoptosis in cultured kidney proximal tubule cells" Am J Physiol Cell Physiol, September 1, 2007; 293(3): C837 - C838. [Full Text] [PDF] |
||||
![]() |
M. Abouhamed, N. A. Wolff, W.-K. Lee, C. P. Smith, and F. Thevenod Knockdown of endosomal/lysosomal divalent metal transporter 1 by RNA interference prevents cadmium-metallothionein-1 cytotoxicity in renal proximal tubule cells Am J Physiol Renal Physiol, September 1, 2007; 293(3): F705 - F712. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abbate, C. Zoja, and G. Remuzzi How Does Proteinuria Cause Progressive Renal Damage? J. Am. Soc. Nephrol., November 1, 2006; 17(11): 2974 - 2984. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||