![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL
Department of Pediatrics, Baylor College of Medicine, Houston, Texas (X.I.C., Y.W.L., W.J., B.M.); and Department of Pathology, Methodist Hospital, Houston, Texas (R.B.)
Received December 26, 2005; accepted February 17, 2006.
| Abstract |
|---|
|
|
|---|
Cytochrome P450 (P450) enzymes are a superfamily of hemoproteins that metabolize a large number of endogenous and exogenous compounds through mechanisms that include oxidation, reduction, and peroxidation (Guengerich, 1990
). Among these, the CYP1A enzymes are of particular interest to oxygen toxicity, as indicated by differential susceptibilities of aryl hydrocarbon (Ah)-responsive mice and Ah-nonresponsive mice to oxygen-induced lung injury (Gonder et al., 1985
). Exposure of adult rats to hyperoxia for 48 h leads to induction of CYP1A enzymes in liver and lung (Okamoto et al., 1993
; Moorthy et al., 1997
; Couroucli et al., 2002
), Interestingly, the induction of CYP1A enzymes in liver and lung declines after continuation of hyperoxia for 60 h, the time period that coincides with overt respiratory distress in these animals, suggesting that the decline of CYP1A enzyme induction contributes to hyperoxic lung injury (Moorthy et al., 1997
, 2000
; Couroucli et al., 2002
). Mansour et al. (1988a
,b
) observed protection against hyperoxia-induced lung injury by pretreatment of adult rats or mice with the CYP1A1 inducer 3-methylcholanthrene. We recently showed that the CYP1A inducer
-naphthoflavone protects adult rats against hyperoxic lung damage (Sinha et al., 2005
). Adult mice deficient in the gene for the Ah receptor (AHR) (Jiang et al., 2004
) or the liver-specific CYP1A2 (Moorthy et al., 2005
) are more susceptible to hyperoxic lung injury than wild-type mice, supporting the hypothesis that the CYP1A enzymes play a beneficial role against lung injury in adult animals. Because CYP1A2 is specifically expressed in the liver, it is possible that hepatic CYP1A enzymes also play important role(s) in the effects of hyperoxia (Moorthy et al., 2005
). In contrast, oxygen-induced lung damage in neonatal rats is potentiated by pretreatment with the CYP1A inducer 3-methylcholanthrene (Thibeault et al., 1991
). The paradoxical effects of CYP1A inducers on hyperoxic lung injury in adult and newborn rats strongly suggest that the developmental status of the animal significantly influences the susceptibility of the organism to modulation by CYP1A inducers.
Retinoic acid (RA) and its synthetic analogs are potent regulators of a diverse group of biological processes, including growth, differentiation, cell proliferation, and morphogenesis (Gudas et al., 1994
). The biological effects of RA and its synthetic analogs are mediated by RA receptors (RARs) and RXRs (Chambon, 1996
). The RARs and RXRs are RA-inducible transcriptional regulatory proteins that regulate gene expression via specific cis-acting DNA sequences (retinoic acid response elements) located in the promoters of target genes. RA may modulate CYP1A1 gene expression through retinoid receptors or through the AHR (Soprano et al., 2001
).
Recent work has suggested that RA plays a key role in induction of formation of septa during lung alveolarization (Massaro and Massaro, 2000
). Furthermore, it has been recently reported that early lung bud formation and subsequent branching and morphogenesis are characterized by distinct stages of RA signaling. If alveolarization is compromised at this stage by exposure to hyperoxia or other insults, the changes persist into adulthood. These observations are of clinical significance because a similar type of altered lung development (retarded alveolarization) is seen in infants who develop BPD (Margraf et al., 1991
). Recently, Veness-Meehan et al. (2002
) and Ozer et al. (2005
) have reported that RA treatment during hyperoxia has beneficial effects on lung alveolarization, but the mechanisms are not understood. Randomized double-blinded clinical trails have suggested that vitamin A supplementation in extremely low-birth weight infants might decrease the risk for chronic lung disease (Tyson et al., 1999
).
Because CYP1A enzymes in the newborn animals seem to play important roles in lung injury, and because RA may modulate CYP1A expression, in this investigation we tested the hypothesis that pretreatment of newborn rats with RA before exposure to hyperoxia would protect animals from oxygen-induced abnormal lung maturation during adulthood and that modulation of pulmonary as well as hepatic CYP1A enzymes contribute to the beneficial effects of RA.
| Materials and Methods |
|---|
|
|
|---|
Hyperoxia Exposure. The newborn animals were either maintained in room air or exposed to >95% O2 for 7 days using pure O2 at 5 l/min, as we have described previously (Couroucli et al., 2002
). The dams were rotated between hyperoxic and room air chambers once every 24 h to prevent toxicity to the mothers.
Perfusion and Tissue Harvesting. At the termination of their respective exposures, eight rats from each group were anesthetized with sodium pentobarbital (200 mg/kg) i.p. and euthanized by exsanguination while under deep pentobarbital anesthesia. The lungs were perfused with phosphate-buffered saline, and microsomes were prepared for subsequent analyses of CYP1A1-dependent activities and immunoreactive protein contents in individual animals. The livers were also obtained for CYP1A1/1A2 analyses. For histological studies, the left lungs were inflated through the intratracheal catheter and were fixed at constant pressure (20 cm of H2O) with zinc formalin, after which the lungs were embedded in paraffin for subsequent histological analyses for assessing lung injury (Couroucli et al., 2002
). The right lungs were used for subsequent RNA isolation and analyses.
Chemicals. Calcium chloride, Tris, sucrose, NADPH, bovine serum albumin, ethoxyresorufin, glutathione reductase, glucose 6-phosphate, and glucose 6-phosphate dehydrogenase were purchased from Sigma Chemical Co. (St. Louis, MO). Buffer components for electrophoresis and Western blotting were obtained from Bio-Rad Laboratories (Hercules, CA). The primary monoclonal antibody to CYP1A1, which cross-reacts with CYP1A2 (Thomas et al., 1984
), was a generous gift from Dr. P. E. Thomas (Rutgers University, Piscataway, NJ). Goat anti-mouse IgG conjugated with horseradish peroxidase was from Bio-Rad Laboratories.
Preparation of Microsomes and Enzyme Assays. Lungs and livers were perfused with ice-cold phosphate-buffered saline, pH 7.4. Lung microsomes were prepared by differential centrifugation, as reported previously (Couroucli et al., 2002
), from individual animals. Liver microsomes were isolated by the calcium chloride precipitation method (Moorthy et al., 1997
). Protein concentrations were estimated by the Bradford dye-binding method (Bradford, 1976
). Ethoxyresorufin O-deethylase (EROD) (CYP1A1) activities in lung and liver microsomes and methoxyresorufin O-demethylase (MROD) (CYP1A2) activities in liver microsomes were assayed as we have described previously (Pohl and Fouts, 1980
; Moorthy et al., 1997
).
Western Blotting. Liver microsomes (20 µg of protein) prepared from individual animals were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis in 7.5% acrylamide gels. The separated proteins on the gels were transferred to polyvinylidene difluoride membranes, followed by Western blotting (Moorthy et al., 1997
, 2000
; Couroucli et al., 2002
).
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Assays. Total RNA (20 µg) from livers of air-breathing and hyperoxic animals was reverse-transcribed (Wang and Strobel, 1998
; Couroucli et al., 2002
), and the resulting cDNA was used as template for PCR analysis. Primers specific for CYP1A1 (5' GGCCAGACCTCTCTACAGTTC-3' and 5' GCCAAGCATATGGCACAG-3') and cyclophilin (CYC) (5' CGAGCTTTTTGCAGCCAAAG 3' and 5' AGCCACTCAGTCTTGGCAGT 3') as internal control were used in PCR reactions to amplify the corresponding cDNAs made in the reverse transcriptase step (Wang and Strobel, 1998
; Couroucli e al., 2002
).
Southern Blot Analysis of PCR Products. The PCR products, generated by PCR amplification of cDNA for 35 cycles, were separated on 1% agarose gel, transferred to nylon membranes by capillary blotting, and probed with random prime-labeled cDNA probes for CYP1A1 or CYC, which were prepared by PCR amplification, followed by purification and extraction of the PCR products from agarose gels (Wang and Strobel, 1998
). The membranes were exposed to a PhosphorImager (Cyclone Packard, Meriden, CT), and pixel densities of the PCR products were measured (Couroucli et al., 2002
).
Lung Weight/Body Weight Ratios. LW/BW ratios were calculated as an index of lung injury in animals whose lungs were not perfused for isolation of microsomes.
Lung Histology. Routine histology was performed on lung tissues from individual animals as described previously (Couroucli et al., 2002
; Jiang et al., 2004
; Sinha et al., 2005
).
Statistical Analyses. Data are expressed as means ± S.E. Two-way analyses of variance (ANOVA), followed by modified t tests, were used to assess significant differences arising from exposure to hyperoxia and RA for different time points. P values <0.05 were considered significant.
| Results |
|---|
|
|
|---|
|
When the lungs were examined histologically, the air-breathing animals treated with the vehicle CO or RA on PND 8 or 15 showed normal lung structure, and there was no evidence of tissue injury (Fig. 2, A and B, a and c). After 7 days of hyperoxia (Fig. 2A, b), the lungs showed pulmonary edema and perivascular inflammation. Animals given a combination of hyperoxia and RA showed less lung injury (Fig. 2A, d) than those exposed to hyperoxia alone. Seven days after return to room air, animals given CO + hyperoxia (Fig. 2B, b) still showed acute lung damage, although it was not as pronounced as that seen when animals were sacrificed 7 days after hyperoxia. Even at this time point, the RA + hyperoxia group showed less lung damage (Fig. 2B, d).
|
Because lung development in the rat continues through adulthood, we examined the lungs of rats 15 (PND 22) or 30 (PND 38) days after return of the hyperoxic animals to room air. On PND 22, the air-breathing animals treated that been treated with the vehicle CO or RA during the neonatal period showed more alveolar septation compared with those examined at PND 8 or 15 (Fig. 3A, a and c). By PND 38, the lung architecture of these animals appeared normal (Fig. 3B, a and c). On the other hand, the oxygen-exposed animals on PND 22 (Fig. 3A, b) or PND 38 (Fig. 3B, b) showed marked enlargement of alveolar spaces, widened distal airspace, and less septation. In addition, free alveolar macrophages were present in the lungs of these animals. Animals exposed to a combination of RA and hyperoxia showed improved septation of the alveoli compared with those exposed to oxygen only on PND 22 (Fig. 3A, d) as well as PND 38 (Fig. 3B, d). RA improved distal lung structure, as reflected by smaller and more numerous alveoli (Fig. 3A, and B, d). However, some perivascular inflammation was observed in the RA + hyperoxia samples (Fig. 3, A and B, d).
|
To study the possible relationship between lung damage and CYP1A expression, we determined the effects of RA and hyperoxia on pulmonary CYP1A1 and hepatic CYP1A1 and 1A2 expression. Hyperoxia alone for 7 days caused a 3-fold increase in pulmonary EROD (CYP1A1) activities compared with air-breathing animals (Fig. 4). RA + hyperoxia samples also showed significant induction of CYP1A1 activities on PND 8 (Fig. 4). However, RA administration to air-breathing animals did not significantly alter the expression of CYP1A1 (Fig. 4). Seven to 30 days after return of the animals to room air, the CO + hyperoxia, but not RA + hyperoxia, animals displayed a sustained induction (1.5- to 3-fold) of CYP1A1 activities over room air animals (Fig. 4). Interestingly, the RA + hyperoxia samples displayed a 50% decrease in CYP1A1 expression compared with air-breathing animals treated with the vehicle CO or RA on PND 38 (Fig. 4). Western blot analyses of pulmonary CYP1A1 revealed that the modulation of protein expression by hyperoxia and/or RA followed trends that were similar to those observed with the corresponding enzyme activities' data (Fig. 5).
|
|
|
|
Because we have previously observed significant modulation of hepatic CYP1A enzymes by hyperoxia (Moorthy et al., 1997
, 2000
; Couroucli et al., 2002
; Jiang et al., 2004
; Sinha et al., 2005
), we conducted experiments to determine the effect of hyperoxia and RA on hepatic EROD (CYP1A1) and MROD (CYP1A2) activities. Hyperoxia caused a 2-fold induction of hepatic EROD after 7 days compared with room air animals (Fig. 7). RA + hyperoxia samples did not elicit any significant changes in EROD activities compared with air-breathing animals but were lower than the CO + hyperoxia group (Fig. 7). The hyperoxia-mediated induction of CYP1A1 persisted through PND 38 (Fig. 7). RA by itself did not alter CYP1A1 expression at PND 38, but RA + hyperoxia attenuated CYP1A1 expression. Similar results were observed regarding the effects of hyperoxia and RA on MROD activities (Fig. 8). The Western blot analyses revealed that the protein expression was in agreement with EROD and MROD activity data (Fig. 9).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The retarded alveolarization of animals 15 to 30 days after return of hyperoxic animals to room air (Fig. 3) was in agreement with previous studies showing abnormal lung maturation in animals that had been exposed to hyperoxia during the newborn period (Frank, 1991
; Bourbon et al., 2005
; Lin et al., 2005
). That RA pretreatment significantly improved lung alveolarization strongly suggests that RA protects against abnormal lung maturation by hyperoxia.
The marked increases (
3-fold) in lung EROD activities (Fig. 4) caused by exposure to hyperoxia for 7 days indicate the induction of CYP1A1, since EROD activities are relatively specific for CYP1A1 (Moorthy, 2000
; Couroucli et al., 2002
). Similar results were obtained in adult male Sprague-Dawley rats, wherein induction of pulmonary CYP1A1 activities was observed after 48 h of hyperoxia (Couroucli et al., 2002
). Our observation that hyperoxic animals displayed a significant induction of pulmonary EROD activities even 30 days after return of the animals to room air suggests that neonatal hyperoxia causes long-term alterations in CYP1A1 gene expression. However, the RA + hyperoxia samples did not show P450 induction at either time point, suggesting that suppression of hyperoxia-mediated CYP1A1 induction by RA may have played a role in the protection against acute lung injury and abnormal lung injury by hyperoxia.
The mechanisms underlying the prolonged CYP1A1 induction by hyperoxia are not clearly understood. The levels of P450 enzymes are very low at birth, and increase rapidly in a time-dependent manner, with the perinatal period showing a marked increase in P450 levels (Omeicinski et al., 1990
). Exposure of animals to drugs and other foreign compounds (xenobiotics) has been shown to alter neonatal androgen levels during the critical neonatal period (Omeicinski et al., 1990
) and cause permanent alterations in the expression of several P450 isozymes (imprinting) in the grown animals (Fujita et al., 1995
). Because exposure of newborn animals to hyperoxia causes lung developmental abnormalities, we hypothesize that long-term alterations in the expression of specific P450 isoforms, caused by neonatal exposure of rats to hyperoxia, contributes mechanistically to the persistent developmental abnormalities that are observed in adult life.
We reported earlier that treatment of adult rats with the PAH 3-methylcholanthrene elicits persistent induction of hepatic and extrahepatic CYP1A enzymes for several weeks after PAH withdrawal (Moorthy, 2000
). This persistent induction seems to occur by mechanisms independent of the persistence of the parent compound. Because newborn animals exposed to hyperoxia also display long-term induction, it is conceivable that these two phenomena may involve similar mechanisms.
The mechanisms of induction of CYP1A1 by PAHs have been extensively studied (Okey et al., 1994
), and the AHR plays an important role in the induction process. We recently provided evidence that hyperoxia also induces CYP1A1 by AHR-mediated mechanisms (Couroucli et al., 2002
; Jiang et al., 2004
). Recent studies have suggested that AHR has important physiological functions beyond mediating the response to environmental contaminants, such as liver development and immune function (Gambone et al., 2002
; Rushing and Denison, 2002
; Jiang et al., 2004
). In fact, a number of naturally occurring compounds have been reported to be relatively weak AHR ligands (e.g., tryptophan metabolites, bilirubin, benzocoumarins, and substituted flavonoids; Gambone et al., 2002
). Although several synthetic retinoids (e.g., AGN 193109, AGN 190730) can elevate CYP1A1 mRNA levels in mouse embryos and in Hepa-1c1c7 cells through the AHR/AHR nuclear translocator pathway (Gambone et al., 2002
), RA does not induce CYP1A1. In fact, RA causes repression of AHR-induced CYP1A1 gene expression by mechanisms involving the SMRT corepressor (Fallone et al., 2004
). Recent studies have also suggested cross-talk between the RAR/RXR with the AHR (Rushing and Denison, 2002
), a phenomenon that could contribute to the attenuation of CYP1A expression by RA + hyperoxia in our experiments.
The less acute lung injury and improved alveolarization in animals given RA + hyperoxia versus those given oxygen only supports the hypothesis that RA ameliorates hyperoxic lung injury. Because CYP1A1 has been implicated in the generation of reactive oxygen species, the attenuation of pulmonary CYP1A1 expression by RA + hyperoxia suggests that RA may have ameliorated lung injury, in part, by down-regulating CYP1A1 expression. The recent findings of Yang et al. (2005
) showing suppression of 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced CYP1A1 expression through the repression of the AHR lends credence to the hypothesis that RA may have attenuated hyperoxia-induced CYP1A1 expression by mechanisms involving down-regulation of the AHR. On the basis of our experiments and studies of other investigators, we have proposed a mechanism (Fig. 12) that could explain the beneficial effects of RA. We postulate that hyperoxia-mediated induction of CYP1A enzymes in the newborn rat could lead to increased ROS production, resulting in lung injury. RA, by attenuating CYP1A expression and thereby decreasing ROS formation, prevents lung injury. The other possibility is that high CYP1A1 levels in the hyperoxic animals may have led to increased metabolism and elimination of RA, leading to developmental abnormalities. Alternatively, the increased expression of CYP4F4, which plays a role in the catabolism of proinflammatory eicosanoids, by RA + hyperoxia may have contributed to the attenuation of lung injury by this agent.
|
The increases in pulmonary (Fig. 4) and hepatic EROD activities (Fig. 7) were paralleled by augmentation of CYP1A1/1A2 protein contents (Figs. 5 and 9), and mRNA levels (Figs. 6, 10, and 11) suggested that hyperoxia induced CYP1A enzymes by transcriptional or post-transcriptional mechanisms. The observation that hyperoxia induced hepatic MROD activities in the hyperoxic animals (Fig. 8), a phenomenon that was paralleled by induction of CYP1A1/1A2 apoprotein (Fig. 9) contents and the corresponding mRNA (Figs. 10 and 11), suggested that induction of CYP1A2 by hyperoxia was also mediated by transcriptional or post-transcriptional mechanisms.
Recent studies have suggested that impaired angiogenesis as a result of inhibition of vascular endothelial growth factor (VEGF) signaling decreases alveolar growth in the developing lung, suggesting that impaired VEGF signaling may contribute to decreased lung growth in BPD (Lin et al., 2005
). In fact, Clerch et al. (2004
) have shown that dexamethasone-induced inhibition of alveolar septation is associated with a block in angiogenesis because of down-regulation of VEGF receptor-2 and that the down-regulation of VEGR receptor-2 is prevented by treatment with RA. It is not known whether there is a mechanistic link between CYP1A1, VEGF signaling, and lung development, but future studies along these lines could contribute to the development of new interventions in the treatment of BPD in infants. Regardless of the mechanism by which RA seems to protect animals against oxygen-induced tissue damage, the present study provides conclusive evidence that RA does play a beneficial role in hyperoxic lung injury, and future work to identify the specific mechanisms of protection could lead to the development of rational strategies for the prevention/treatment of lung diseases in infants and adults undergoing supplemental oxygen therapy.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: BPD, bronchopulmonary dysplasia; ROS, reactive oxygen species; P450, cytochrome P450; Ah, aryl hydrocarbon; AHR, Ah receptor; RA, retinoic acid; RAR; retinoic acid receptor; RXR, retinoic acid X receptor; CO, corn oil; PND, postnatal day(s); LW/BW, liver weight/body weight; EROD, ethoxyresourufin O-deethylase; MROD, methoxyresorufin O-demethylase; AHRE, Ah response element; RT-PCR, reverse transcriptase-polymerase chain reaction; CYC, cyclophilin; ANOVA, analysis of variance; PAH, polycyclic aromatic hydrocarbon; VEGF, vascular endothelial growth factor.
Address correspondence to: Dr. Xanthi I. Couroucli, Assistant Professor of Pediatrics, Baylor College of Medicine, 6621 Fannin, F.C. 530.01, Houston, TX 77030. E-mail: xanthic{at}bcm.tmc.edu
| References |
|---|
|
|
|---|
Bourbon J, Boucherat O, Chailley-Heu B, and Delacourt C (2005) Control mechanisms of lung alveolar development and their disorders in bronchopulmonary dysplasia. Pediatr Res 57: 38R46R.
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of dye-binding protein. Anal Biochem 72: 248254.[CrossRef][Medline]
Bucher JR and Roberts RJ (1981) The development of the newborn rat lung in hyperoxia: a dose-response study of lung growth, maturation and changes in antioxidant enzyme activities. Pediatr Res 15: 9991008.[Medline]
Chambon P (1996) A decade of molecular biology of retinoic acid receptors. FASEB J 10: 940954.[Abstract]
Clerch LB, Baras AS, Massaro GD, Hoffman EP, and Massaro D (2004) DNA microarray analysis of neonatal mouse lung connects regulation of KDR with dexamethasone-induced inhibition of alveolar formation. Am J Physiol 286: L411L419.
Couroucli XI, Wei Y-H, Jiang W, Muthiah K, Evey LW, Barrios R, and Moorthy B (2006) Modulation of pulmonary cytochrome P4501A1 expression by hyperoxia and inhaled nitric oxide in the newborn rat: implications for lung injury. Pediatr Res 59: 401406.[Medline]
Couroucli XI, Welty SE, Geske RS, and Moorthy B (2002) Regulation of pulmonary and hepatic cytochrome P4501A expression in the rat by hyperoxia: implications for hyperoxic lung injury. Mol Pharmacol 61: 507515.
Fallone F, Villard PH, Seree E, Rimet O, Nguyen QB, Bourgarel-Rey V, Fouchier F, Barra Y, Durand A, and Lacarelle B (2004) Retinoids repress Ah receptor CYP1A1 induction pathway through the SMRT corepressor. Biochem Biophys Res Commun 332: 551556.
Frank L (1991) Developmental aspects of experimental pulmonary oxygen toxicity. Free Radic Biol Med 11: 463494.[CrossRef][Medline]
Fujita I, Sindhu RK, and Kikkawa Y (1995) Hepatic cytochrome P450 enzyme imprinting in adult rat by neonatal benzo[a]pyrene administration. Pediatr Res 37: 646651.[Medline]
Gambone CJ, Hutcheson JM, Gabriel JL, Beard RL, Chandraratna RA, Soprano KJ, and Soprano DR (2002) Unique property of some synthetic retinoids: activation of the aryl hydrocarbon receptor pathway. Mol Pharmacol 61: 334342.
Gonder JC, Proctor RA, and Will JA (1985) Genetic differences in oxygen toxicity are correlated with cytochrome P450 inducibility. Proc Natl Acad Sci USA 82: 63156319.
Gudas L, Sporn MB, and Roberts AB (1994) Cellular biology and biochemistry of retinoids, in The Retinoids (Sporn MB, Roberts AB, and Goodman DS eds) pp 443520, Raven Press, New York, NY.
Guengerich FP (1990) Enzymatic oxidation of xenobiotic chemicals. CRC Crit Rev Biochem Mol Biol 25: 97153.
Jiang W, Welty SE, Couroucli XI, Barrios R, Kondraganti SR, Muthiah K, Yu L, Avery SE, and Moorthy B (2004) Disruption of the Ah receptor gene alters the susceptibility of mice to oxygen-mediated regulation of pulmonary and hepatic cytochromes P4501A expression and exacerbates hyperoxic lung injury. J Pharmacol Exp Ther 310: 512519.
Lin Y-J, Markham NE, Balasubramaniam V, Tang J-R, Maxey A, Kinsella JP, and Abman SH (2005) Inhaled nitric oxide enhances distal lung growth after exposure to hyperoxia in neonatal rats. Pediatr Res 58: 222229.[CrossRef][Medline]
Mansour H, Brun-Pascaud M, Marquetty C, Gougerot-Pocidalo M, Hakim J, and Pocidalo JJ (1988a) Protection of rat from oxygen toxicity by inducers of cytochrome P450 system. Am Rev Respir Dis 137: 688694.[Medline]
Mansour H, Levacher M, Azoulay-Dupuis E, Moreau J, Marquetty C, and Gougerot-Pocidalo MA (1988b) Genetic differences in response to pulmonary cytochrome P-450 inducers and oxygen toxicity. J Appl Physiol 64: 13761381.
Margraf LR, Tomashefski JF Jr, Bruce MC, and Dahms BB (1991) Morphometric analysis of the lung in prolonged bronchopulmonary dysplasia. Am Rev Respir Dis 143: 391400.[Medline]
Massaro GD and Massaro D (2000) Retinoic acid partially rescues failed septation in rats and mice. Am J Physiol 278: L955L960.
Moorthy B (2000) Persistent expression of 3-methylcholanthrene-inducible cytochrome P4501A in rat hepatic and extrahepatic tissues. J Pharmacol Exp Ther 294: 313322.
Moorthy B, Nguyen UTL, Gupta S, Stewart KD, Welty SE, and Smith CV (1997) Induction and decline of hepatic cytochromes P4501A1 and 1A2 in rats exposed to hyperoxia are not paralleled by changes in glutathione S-transferase-
. Toxicol Lett 90: 6775.[CrossRef][Medline]
Moorthy B, Parker KM, Smith CV, Bend JR, and Welty SE (2000) Potentiation of oxygen-induced lung injury in rats by the mechanism-based cytochrome P450 inhibitor, 1-aminobenzotriazole. J Pharmacol Exp Ther 292: 553560.
Moorthy B, Wang L, Muthiah K, Couroucli X, Barrios R, Kondraganti SR, and Jiang W (2005) Differential modulation of hyperoxic lung injury in mice deficient in the genes for CYP1A2 or CYP2E1, in 14th International Conference on Cytochromes P450. Biochemistry, Biophysics and Bioinformatics; 2005 May 31Jun 5; Bologna, Italy. pp 193198, Medimond International Proceedings, Bologna, Italy.
Northway WH and Rosan RC (1968) Radiographic features of pulmonary oxygen toxicity in the newborn: Bronchopulmonary dysplasia. Radiology 91: 4957.[Medline]
Okamoto T, Mitsuhashi M, Fujita I, Sindhu RK, and Kikkawa Y (1993) Induction of cytochrome P4501A1 and 1A2 by hyperoxia. Biochem Biophys Res Commun 197: 878885.[CrossRef][Medline]
Okey AB, Riddick DS, and Harper PA (1994) The Ah receptor: mediator of the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. Toxicol Lett 70: 122.[CrossRef][Medline]
Omeicinski CJ, Hassett C, and Costa P (1990) Developmental expression and in situ localization of the phenobarbital-inducible rat hepatic mRNAs for cytochromes CYP2B1, CYP2B2, CYP2C6 and CYP3A1. Mol Pharmacol 38: 462470.[Abstract]
Ozer EA, Kumral A, Ozer E, Duman N, Yilmaz O, Ozkal S, and Ozkan H (2005) Effect of retinoic acid on oxygen-induced lung injury in the newborn rat. Pediatr Pulmonol 39: 3540.[CrossRef][Medline]
Pohl RJ and Fouts JR (1980) A rapid method for assaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Anal Biochem 107: 150155.[CrossRef][Medline]
Rushing SR and Denison MS (2002) The silencing mediator of retinoic acid and thyroid hormone receptors can interact with the aryl hydrocarbon (Ah) receptor but fails to repress Ah receptor-dependent gene expression. Arch Biochem Biophys 403: 189201.[CrossRef][Medline]
Sinha A, Muthiah K, Jiang W, Couroucli X, Barrios R, and Moorthy B (2005) Attenuation of hyperoxic lung injury by the cytochrome P4501A1 inducer,
-naphthoflavone. Toxicol Sci 87: 204212.
Soprano DR, Gambone CJ, Sheikh SN, Gabriel JL, Chandraratna RA, Soprano KJ, and Kochhar DM (2001) The synthetic retinoid AGN 193109 but not retinoic acid elevates CYP1A1 levels in mouse embryos and hepa-1c1c7 cells. Toxicol Appl Pharmacol 174: 153159.[CrossRef][Medline]
Thibeault DW, Downing G, Reddy N, Sonderfan AJ, and Parkinson A (1991) Oxygen-induced lung damage in newborn rats, potentiated by 3-methylcholanthrene, a P-450 inducer and lack of protection by cimetidine, a P450 inhibitor. J Pharmacol Exp Ther 259: 444451.
Thomas PE, Reik LM, Ryan DE, and Levin W (1984) Characterization of nine monoclonal antibodies against rat hepatic cytochrome P450c. Delineation of at least five spatially distinct epitopes. J Biol Chem 259: 38903899.
Tsai SH, Anderson WR, Strickland MB, and Pliego M (1972) Bronchopulmonary dysplasia associated with oxygen therapy in infants with respiratory distress syndrome. Radiology 105: 107115.[Medline]
Tyson JE, Wright LL, Oh W, Kennedy KA, Mele L, Ehrenkranz RA, Stoll BJ, Lemons JA, Stevenson DK, Bauer CR, et al. (1999) Vitamin A supplementation for extremely-low-birth-weight infants. National Institutes of Child Health and Human Developmental Neonatal Research Network. N Engl J Med 340: 19621968.
Veness-Meehan KA, Pierce RA, Moats-Staats BM, and Stiles AD (2002) Retinoic acid attenuates O2-induced inhibition of lung septation. Am J Physiol 283: L971L980.
Wang H and Strobel HW (1998) Regulation of CYP3A9 gene expression by estrogen and catalytic studies using cytochrome P450 3A9 expressed in Escherichia coli. Arch Biochem Biophys 344: 365372.
Yang YM, Huang DY, Liu GF, Zhong JC, Du K, Li YF, and Song XH (2005) Inhibitory effects of vitamin A on TCDD-induced cytochrome P4501A1 enzyme activity and expression. Toxicol Sci 85: 727734.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||