QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.105.100362v1 317/3/1044    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mbalaviele, G. Articles by Monahan, J. Search for Related Content PubMed PubMed Citation Articles by Mbalaviele, G. Articles by Monahan, J.

INFLAMMATION, IMMUNOPHARMACOLOGY, AND ASTHMA

Inhibition of p38 Mitogen-Activated Protein Kinase Prevents Inflammatory Bone Destruction

Department of Inflammation (G.M., G.A., A.J., P.D.C., S.S., S.M., M.T., J.P., J.M.), Pfizer Inc., St. Louis, Missouri; and Departments of Orthopedics and Cell Biology and Physiology (Y.A.-A.), Washington University School of Medicine, St. Louis, Missouri

Received December 20, 2005; accepted February 22, 2006.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Mitogen-activated protein kinase (MAPK) pathways are implicated in joint destruction in rheumatoid arthritis (RA) by modulating the production and functions of inflammatory cytokines. Although p38 MAPK (p38) participates in signaling cascades leading to osteolysis in arthritis, the mechanisms of its action in this process remain incompletely understood. Here, we found that the osteoclast (Ocl) precursors expressed p38, but not p38, p38, and p38 isoforms. Treatment of these cells with receptor activator of nuclear factor (NF)-B ligand (RANKL) resulted in p38 activation. Importantly, Ocl development induced by RANKL or RANKL and tumor necrosis factor (TNF)- was blocked with the novel p38 inhibitor 4-(3-(4-chlorophenyl)-5-(1-methylpiperidin-4-yl)-1H-pyrazol-4-yl)pyrimidine (SC-409). To validate in vitro data, p38 role was further investigated in streptococcal cell wall (SCW)-induced arthritis in rats. We found that SCW-induced joint swelling and bone destruction were attenuated by SC-409. Mechanistically, the data show that SCW-stimulated DNA binding activity of the transcription factor myocyte-enhancing factor 2 C, which is downstream of p38, was inhibited by SC-409. In addition, SC-409 inhibited SCW-stimulated expression of numerous factors, including TNF-, interleukin-1, and RANKL. Although c-Jun NH₂-terminal kinase and NF-B pathways were activated in vitro by RANKL and in vivo by SCW, SC-409 had no significant effect on these pathways. In conclusion, our data show that p38 modulates the production and signaling of cytokines, thus providing a mechanism of the bone-sparing effect of SC-409 in rat arthritis. These data present SC-409 as a novel potent p38 inhibitor and suggest that p38-based therapies may be beneficial in preventing bone loss associated with RA.

Bone resorption, per se, is the main function of osteoclasts (Ocls), which are derived from hematopoietic stem cells (Roodman, 1999). Formation and activity of these cells depend upon expression of receptor activator of nuclear factor (NF)-B ligand (RANKL). Support for this premise is provided by evidence that deletion of RANKL gene in mice leads to osteopetrosis due to Ocl deficiency (Kong et al., 1999b). RANKL is a TNF family member, expressed within the arthritic joints by activated T cells, synovial fibroblasts, and endothelial cells (Takyanagi et al., 2000; Collin-Osdoby et al., 2001). The cognate RANKL receptor, RANK, is expressed by Ocl precursors, Ocls, and chondrocytes. RANKL activity is regulated by an endogenous decoy receptor termed osteoprotegerin (OPG). In this regard, OPG overexpression in mice causes severe osteopetrosis (Min et al., 2000). Although OPG injection prevents bone resorption in rodent arthritis, it had no effect on joint swelling (Kong et al., 1999a), and RANK/RANKL role in cartilage degradation is still not known.

Despite some discrepancies, evidence indicates that cytokines are potent inducers of bone resorption (Mundy et al., 1995). This includes TNF-, IL-1, and other factors (Pacifici, 1996). Recent studies that addressed this issue concluded that TNF-, for example, promotes osteoclastogenesis in synergy with RANKL (Lam et al., 2000; Komine et al., 2001). Supporting this notion is the fact that blockade of TNF- signaling by genetic manipulation reduced osteoclastogenesis. As other cytokines, including IL-1, superimpose their action over that of RANKL, leading to the propagation of inflammation and bone erosion, it is conceivable to propose that blockade of the production and/or signaling pathways of these cytokines in RA is important to stop disease progression. Those pathways include NF-B and mitogen-activated protein kinase (MAPK) pathways (Feng, 2005).

MAPKs are proline-directed kinases, which include the insulin/mitogen-regulated extracellular signal-regulated kinase (ERK), the stress-activated protein kinases/c-Jun NH₂-terminal kinases (JNKs), and the p38 kinases (p38) (Kyriakis and Avruch, 2001). MAPKs have important functions as mediators of cellular responses to variety of extracellular stimuli. Typically, the MAPK kinase/ERK family is stimulated by growth factors, whereas the JNK/p38 pathways are activated by cellular stresses, cytokines, and hypoxia. MAPKs are under active investigation in RA (Han et al., 2001) since they are known to modulate the expression of certain genes involved in joint destruction, such as matrix metalloproteases (MMPs) (Engsig et al., 2000), carbonic anhydrase II, and cathepsin K (Matsumoto et al., 2004).

Consistent with MAPK role in bone resorption, mice deficient in the c-Jun binding partner, c-fos, develop osteopetrosis (Grigoriadis et al., 1994), although mice deleted of JNK1 or JNK2 genes have normal skeletal metabolism (David et al., 2002). Furthermore, it has been shown that pharmacological blockade of JNK (Bennett et al., 2001) or p38 (Badger et al., 2000) inhibited adjuvant-induced arthritis in rats, suggesting that small molecules may be efficacious in the treatment of RA. However, the mechanisms of the joint-sparing effects of p38 inhibitors remain incompletely understood. Indeed, these inhibitors may prevent bone destruction in arthritis indirectly by altering the function of inflammatory cells without exerting direct effects on bone cells. In support of this notion, glucocorticoids are known to cause osteopenia by deregulating the activity of bone cells (Weinstein et al., 2000), while intriguingly inhibiting bone destruction in rodent models of arthritis by affecting the activity of inflammatory cells (Hom et al., 1991).

Given the key roles of MAPKs in RA, we developed a p38 inhibitor and determined the mechanisms of p38 regulation of inflammatory bone resorption in vivo and in vitro systems. Our findings indicate that the p38 inhibitor, SC-409, inhibits the production of key cytokines such as TNF-, IL-1, and RANKL; RANK-mediated p38 activation in Ocls precursors; and arthritis symptoms and bone destruction. Based on these findings, we propose that p38 inhibitors may be efficient in preventing bone loss associated with RA.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Reagents. Antibodies against IB-, phospho-IB-, heat shock protein 27 (HSP27), c-Jun, phospho-c-Jun, and ERK as well as oligonucleotides containing the binding sites for myocyte-enhancing factor 2 C (MEF2C), AP-1, and NF-B were purchased from Santa Cruz (Santa Cruz, CA). Rabbit polyclonal antibodies against phospho-ERK and phospho-p38 were purchased from Cell Signaling (Beverly, CA), and Biosource International (Camarillo, CA), respectively. Anti-p38 antibody was obtained from Santa Cruz and then affinity-purified in-house. Human RANKL and M-CSF were purchased from PeproTech Inc. (Rocky Hill, NJ), and mouse RANKL and M-CSF were obtained from R&D Systems Inc. (Minneapolis, MN). Lipopolysaccharide (LPS) and salmon calcitonin were purchased from Sigma (St. Louis, MO) and Calbiochem (San Diego, CA), respectively. SC-409 and SC-448 (diarylpyrazole class of compounds) were synthesized by Pfizer (St. Louis, MO) and stored as a free base powder. All other chemicals were obtained commercially and were of the highest purity available.

Cell Cultures. CD34⁺ cells were immunoaffinity purified (purity > 95%) from healthy human bone marrow by BioWhitaker (Walkersville, MD). Mouse RAW 264.7 cells were purchased from American Type Culture Collection (Manassas, VA). Aliquots (3 x 10⁵/cm²) of cryopreserved CD34⁺ cells or of RAW 264.7 cells (3 x 10³/cm²) were cultured in Dulbecco's modified Eagle's medium-high glucose or -MEM, respectively, supplemented with 10% (v/v) fetal bovine serum (FBS), at 37°C in 95% air and 5% CO₂ atmosphere. Cells were treated with RANKL, M-CSF, and/or p38 inhibitor, SC-409. Every 3 days, half of the culture medium was gently removed to minimize loss of nonadherent cells and replaced with an equal volume of fresh medium. Cells were fixed and stained for tartrate-resistant acid phosphatase (TRAP) activity as described below. To study the effect of TNF- on RANKL mRNA expression, mouse bone marrow cells were isolated as follows. Bone harvest, processing, and marrow cell isolation were carried out as described previously (Mbalaviele et al., 1995). Cells were plated at 6 x 10⁵/cm², cultured until the disappearance of hematopoietic cells, and replated at 5 x 10⁵/cm² in the absence or presence of 100 ng/ml TNF-. Total RNA was isolated using the RNeasy isolation kit (Qiagen, Valencia, CA). For bone resorption studies, rat bone marrow cells were resuspended in -MEM containing 10% (v/v) FBS and plated at 1.7 x 10⁶/cm² on bovine cortical bone slices (0.9 x 4.6 x 4.6 mm) in a 96-well culture dish at 37°C in 95% air and 5% CO₂ atmosphere. Cells were treated with or without 100 ng/ml mouse RANKL and 10 ng/ml mouse M-CSF and fed as described above. Five days after initiation of cultures when the Ocls are seen in cultures, medium was completely replaced with fresh medium containing the testing agents in the absence or presence of RANKL and M-CSF. Forty-eight hours later, the conditioned medium was harvested and used to measure cross-linked C-telopeptides of type I collagen release by ELISA (Nordic Biosciences, Herlev, Denmark).

TRAP Staining. At the end of the culture period, the medium was removed, and the cells were fixed by the addition of a 60% (v/v) acetone solution prepared in sodium citrate buffer, pH 5.4, for 30 s. The fixed cells were washed twice with distilled water and air-dried. TRAP⁺ cells were detected using a TRAP staining kit (Sigma). TRAP⁺ multinucleated cells (3 nuclei, Ocls) were counted manually using a light microscope.

Stimulation of Cytokine Expression by Streptococcal Cell Wall or LPS. The animal studies were approved by the St. Louis Pfizer Institutional Animal Care and Use Committee. Female Lewis rats (100–140 g) received a single i.p. injection of streptococcal cell wall (SCW) suspension (Lee Laboratories, Grayson, GA) at a dose of 15 to 60 µg rhamnose equivalents/g body weights. Treatment of rats (eight rats/group) daily with 15 mg/kg SC-409 b.i.d. administered orally or with 10 mg/kg recombinant soluble rat TNFRII fused to the Fc fragment of rat IgG (sTNFRII-Fc chimera; J. O. Polazzi and J. Portanova, unpublished data), administered i.p. twice weekly, was begun on day 10 or 18. Rats were sacrificed at day 21, 2 to 4 h after the last drug administration. The severity of arthritis was determined by measuring paw volume using plethysmometer, visual scoring, and histology. A subset of Lewis rats was injected i.v. with 1 mg/kg LPS (Sigma). The spleens were collected for electrophoretic mobility shift assay (EMSA) as described below and the serum for measurement of cytokine levels by ELISA (Biosource International).

Computed Tomography, Histology, and Histomorphometry. Three-dimensional images from intact rat paws were obtained from microcomputed T20 scanner (Scanco Medical, Wayne, PA) set at 380 slices, 115-ms integration time, and 34-µm resolution. Bone mineral density was determined by peripheral quantitative computed tomography using a Norland XCT Research M densitometer (Norland Medical Systems, White Plains, NY). Hind paws were removed and frozen until the analysis. The paws were laid out on the lateral side and three serial 1-mm sections were taken beginning 3 mm from the tibial-tarsal joint. Voxel size was 0.09 mm, the analysis was done with the threshold set at 620 mg/cm³, and trabecular bone area was 99%. Total bone density and total bone area were recorded. The densitometer was calibrated daily with a bone phantom, with a variance less than 2%. For histology and histomorphometry, hind paws were preserved in 10% buffered formalin, trimmed off of the first digit and skin, and subjected to a decalcification process using 10% EDTA, pH 7.0, until radiotranslucent based on radiography. Decalcified paws were then dehydrated in graded alcohol, cleared through xylene, and embedded in paraffin. Paraffin blocks were sectioned longitudinally along the second digit through the metatarsal, talus, and distal tibia. Five-micron sections were then stained with either Safranin O:fast green for cartilage parameters or histochemically for TRAP plus methyl green:thionin counterstaining for Ocl parameters. Quantitative histology measurements were performed at the distal tibiotalar joint and the distal tibial epiphysis/metaphysis using Osteomeasure software (Osteomeasure software version 4.00c; OsteoMetrics, Inc., Atlanta, GA). The measured parameters included percentage of articular cartilage surface eroded or stained with proteoglycan and Ocl numbers per marrow area.

RNA Isolation and Purification. Tissue was crushed using a stainless steel mortar and pestle, which had been chilled at –80°C, and then resuspended with an appropriate volume of denaturation buffer. RNA was extracted from frozen (–80°C) rat paws using the Totally RNA Isolation Kit (Ambion, Inc., Austin, TX). All RNA was further purified by DNase digestion to remove genomic DNA and LiCl precipitation to remove carbohydrates as follows. RNA (100 µg) was precipitated overnight at –20°C by adding 0.5 volumes of 7.5 M LiCl/50 mM EDTA solution (Ambion, Inc.) followed by centrifugation for 30 min at 13,000 to 16,000g at 4°C. The RNA pellet was then resuspended in DNase/RNase-free water, DNase treated using the Qiagen RNase-free DNase kit according to manufacturer's instructions (Qiagen), and quantified.

TaqMan One-Step Reverse Transcriptase-PCR Analysis. The fluorogenic 5'-nuclease assay (TaqMan PCR) using Applied Biosystems' Sequence Detection System (Applied Biosystems, Foster City, CA) allows for real-time detection/quantitation of a specific gene by monitoring the increase in fluorescence of a gene specific dye-labeled oligonucleotide probe. Probes are labeled at the 5' end with 6-carboxyfluorescein (FAM) reporter dye and at the 3' end with either 6-carboxy-N,N,N',N'-tetramethylrhodamine (TAMRA) quencher dye or a minor groove binder/nonfluorescent quencher (MGB/NFQ). The close proximity of the reporter and quencher inhibits fluorescence of FAM. The exonuclease activity of Taq polymerase in the PCR reaction releases the dyes from the oligonucleotide, causing fluorescence excitation in direct proportion to the amount of target message present. Standard curves using 5-fold dilutions of total RNA (from 200 ng to 320 pg) were performed to determine the efficiency of each primer/probe set in the TaqMan reaction prior to the analysis of the experimental samples. All results were normalized to the housekeeping gene, cyclophilin. Fifty to 100 ng of total RNA, 500 nM each primer, and 100 nM each probe were used for each reaction run in duplicate. The following protocol was applied to all reactions: 30 min at 48°C (reverse transcription), 10 min at 95°C (inactivation of reverse transcriptase), 40 cycles of 15 s at 95°C, and 1 min at 60°C (polymerization). Data analysis was performed using the Sequence Detection System software from Applied Biosystems. Sequences of the rat primers and probes used in the reactions were as follows: cyclophilin, forward primer (FP) = AGAGAAATTTGAGGATGAGAACTTCAT, reverse primer (RP) = TTGTGTTTGGTCCAGCATTTG, probe = FAM-TCCTGGCATCTTGTC-MGB/NFQ; TNF-, FP = CCGGTTTGCCATTTCATACC, RP = TCCTTAGGGCAAGGGCTCTT, probe = FAM-AAAGTCAGCCTCCTCTC-MGB/NFQ; IL-1, FP = AGGAAGGCAGTGTCACTCATTGT, RP = CTTGGGTCCTCATCCTGGAA, probe = FAM-CAGCTACCTATGTCTTGC-MGB/NFQ; IL-6, FP = ATATGTTCTCAGGGAGATCTTGGAA, RP = GTGCATCATCGCTGTTCATACA, probe = FAM-AGTTGTGCAATGGCA-MGB/NFQ; cyclooxygenase (COX)-2, FP = TCAAAGACACTCAGGTAGACATGATCT, RP = CGGCACCAGACCAAAGACTT, probe = FAM-CACGTCCCTGAGCACCTGCGG-TAMRA; MMP-3, FP = TCCCAGGAAAATAGCTGAGAACTT, RP = GAAACCCAAATGCTTCAAAG ACA, probe = FAM-CCAGGCATTGGCACMGB/NFQ; MMP-9, FP = CACTACCAAGACAAGGCCTATTTCT, RP = TCACCCGGTTGTGGAAACTC, probe = FAM-CCATGACAAATACTTCTG-MGB/NFQ; MMP-13, FP = TGCACCCTCAGCAGGTTGA, RP = ACATGAGGTCTCGGGATGGAT, probe = FAM-TTGGCCAGAACTTC-MGB/NFQ; OPG, FP = AACCGAGTGTGCGAATGTGA, RP = GACAGCTCCGGTGCTTCAAG, probe = FAM-GAATTCGAGCTCCAGGTAGCGCCCTT-TAMRA; and RANKL, FP = CGTGCAAAGGGAATTACAACAC, RP = AACCTTCCATCATAGCTGGAACTC, probe = FAM-CACAGCGCTTCTCA-MGB/NFQ. The sequences for detection of mouse RANKL were: FP = CAGCATCGCTCTGTTCCTGTAC, RP = AAGCAGTGAGTGCTGTCTTCTGA, probe = FAM-TTCGAGCGCAGATGGATCCTAACAGAAT-TAMRA.

Immunoblot Analysis. RAW 264.7 cells were plated at 1 x 10⁵ cells/cm² and cultured overnight in -MEM containing 10% and then treated with vehicle, RANKL. or LPS for the indicated times before extracting proteins. To determine the effect of SC-409 on RANKL-induced protein phosphorylation, cells were pretreated with SC-409 in the same medium for 30 min before treating with RANKL for 20 min. CD34⁺ cells were plated at 3 x 10⁵/cm² and treated with M-CSF and RANKL for 7 days to induce Ocl differentiation. Cultures were then treated with RANKL for 20 min in the absence or presence of SC-409. Proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Invitrogen, Carlsbad, CA). Membranes were incubated for 2 h at room temperature in blocking buffer (5% nonfat dry milk in phosphate-buffered saline with 0.1% Tween 20) and then incubated overnight at 4°C with various Abs. Antigen-antibody complexes were visualized by incubation of the blots in a dilution of horseradish peroxidase-conjugated antibodies and the ECL detection system (Pierce, Rockford, IL).

EMSA. Nuclear extracts were prepared from rat paws following Han et al. (1998). In brief, whole-rat paws were flash-frozen in liquid nitrogen, crushed using a stainless steel mortar and pestle, and then pulverized using CertiPrep Freezer Mill 6570 (Spex CertiPrep Inc., Metuchen, NJ) under liquid nitrogen to achieve a fine powder of approximately 2 x 1 min. Approximately 200 mg of powder was suspended with buffer A [10 mM HEPES, pH 7.4, 1.5 mM MgCl₂,10 mM KCl, 1 mM DTT, Complete protease inhibitor cocktail (Roche, Indianapolis, IN), and 0.1% Nonidet P-40]. The samples were centrifuged at 850g for 10 min at 4°C, and the pellets were resuspended in buffer A without Nonidet P-40, incubated on ice for 15 min, and centrifuged at 850g for 10 min at 4°C. One hundred microliters of buffer C [25% (v/v) glycerol, 20 mM HEPES, pH 7.9, 0.42 M NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, pH 8.0, 1 mM DTT, and Complete protease inhibitor cocktail] was added to the pellets, and the samples were rocked at 4°C for 30 min. Samples were pelleted at 4°C for 30 min in a microcentrifuge, and the supernatants were aliquoted and stored at –80°C. Protein concentrations were measured using standard BCA kit (Pierce). Aliquots (10 µg) of nuclear extracts were incubated with 5'-³²P-end-labeled double-stranded oligonucleotide probes. The reaction was performed at room temperature for 30 to 60 min in a total volume of 20 µl of binding buffer [20 mM HEPES, pH 7.8, 100 mM NaCl, 0.5 mM DTT, 1 µg of poly(dI-dC), and 10% glycerol]. Samples (10 µl) were fractionated on a 4 to 20% gradient Tris borate-EDTA gel, and the proteins were visualized by autoradiography.

In Vitro Selectivity Assays. The selectivity of SC-409 for p38 was tested against a variety of targets. Inhibition studies were carried out using ATP concentrations at the K_m measured for the respective enzymes and substrate concentration 10-fold greater than the K_m determined for each kinase. However, there was some difference among assays. For instance, p38 and JNK were tested for their sensitivity to SC-409, which was tested in 10-fold serial dilutions beginning at 200 µM in 10% dimethyl sulfoxide. Reactions were initiated by addition of activated p38 (20–40 nM) or JNK (150 –300 nM) previously activated with GST-MKK6 or GST-MKK7b, respectively. p38 and JNK activities were determined by following the phosphorylation of epidermal growth factor receptor peptide and GST-cJun, respectively. Reaction mixtures included 50-µl reaction volumes containing 10 mM magnesium acetate, 4% glycerol, 0.4% bovine serum albumin, 0.4 mM DTT, 1 mM Na₃VO₄, 25 mM HEPES, pH 7.5, 50 µM unlabeled ATP, 200 µM epidermal growth factor receptor peptide or 10 µM GST-cJun, and 0.05 to 011 µCi [-³³P] ATP at pH 7.5. Reactions were stopped by addition of 150 µl of Dowex AG 1 x 8 resin in 900 mM sodium formate buffer, pH 3.0, and enzyme activity was quantified through measurement of ³³P present in an aliquot from the supernatant.

Statistical Analysis. All data were analyzed by a paired Student's t test. Samples were run always in triplicate, and data represent the mean ± S.E. Independent experiments were performed at least twice.

	Results

Top Abstract Materials and Methods Results Discussion References

 
The p38 Inhibitor, SC-409, Blocks Ocl Formation but Not Ocl Activity. Previous studies have suggested that p38 is involved in osteolysis. However, the mechanisms of p38 in the process of osteolysis have not been elucidated. To address this issue, we developed a selective p38 inhibitor, SC-409 (Fig. 1; Table 1), and determined its effect on Ocl differentiation from RAW 264.7 cells. Treatment of these cells with RANKL and M-CSF induced Ocl formation after 6 days of cultures (Fig. 2, A and B), and this effect was inhibited in a dose-dependent manner by SC-409 (Fig. 2, C and G), but not by a structurally similar but inactive SC-409 analog, SC-448 (p38 IC₅₀ >100 µM) (Fig. 2G). This dose-response effect (Fig. 2G) mimicked SC-409 potency on p38 (Table 1; data not shown). SC-409 inhibited Ocl formation in this system, even when it was present during only the first 3 days of the cultures (data not shown), suggesting that p38 is involved in the early steps of Ocl formation. SC-409 also inhibited Ocl formation induced by RANKL from human CD34⁺ cells (Fig. 2, D–F) and mouse and rat bone marrow cells (data not shown).

View larger version (11K): [in this window] [in a new window]   Fig. 1. Structure of SC-409.

View larger version (56K): [in this window] [in a new window]   Fig. 2. SC-409 inhibits Ocl formation. Mouse RAW 264.7 cells (A–C and G) or human CD34+ cells (D–F and H) were treated with RANKL and M-CSF in the absence or presence of SC-409 or a structurally similar but inactive SC-409 analog, SC-448, for the entire culture period. Cells (A–F) or culture plates (G) were photographed, and Ocls (TRAP+ cells with three nuclei, arrows) were quantified. The red color in G indicates TRAP staining. Although SC-409 had no inhibitory effect on cell growth up to 10 µM (C and F), cytotoxicity was observed with SC-448 at 10 µM (G). The synergism between RANKL and TNF- on osteoclastogenesis was blocked by 1 µM SC-409 (H). Cell density and morphology are shown at different times of the cultures. The asterisks indicate statistically significant differences, ***, p < 0.001.

Because TNF- has been reported to stimulate osteoclastogenesis in synergy with RANKL (Komine et al., 2001; Feng, 2005), we evaluated the effects of SC-409 on osteoclastogenesis that is induced by TNF- and RANKL. As shown in Fig. 2H, TNF- and RANKL synergistically induced Ocl formation, an effect that was blocked by 1 µM SC-409. We also investigated the role of p38 in Ocl activity. Treatment of bone rat marrow cells plated on cortical bone slices with 100 ng/ml RANKL and 10 ng/ml M-CSF for 6 days stimulated Ocl formation (data not shown). Ocls thus formed were then treated with SC-409 or calcitonin in the continuous presence of RANKL and M-CSF. We found that the release of cross-linked C-telopeptides of type I collagen from bone slices stimulated by RANKL and M-CSF was inhibited by calcitonin, but not SC-409, even at SC-409 concentrations higher than those required to inhibit Ocl formation (data not shown). These findings suggest that p38 is involved in Ocl formation, but not activity.

RANKL Activates the p38 Pathway in Ocl Precursors. To demonstrate that p38 is downstream of RANK and is functional in Ocl precursors, we determined the effect of RANKL on p38 activation. RAW 264.7 cells expressed p38 but not p38, , and isoforms (Fig. 3A). Lack of antibody reactivity to p38, , and isoforms from cell lysates was ruled out since the antibody reacted with recombinant p38, , and (Fig. 3B). Treatment of RAW 264.7 cells with RANKL or LPS resulted in a rapid transient phosphorylation of p38, reaching a peak 20 min after stimulation (Fig. 3, C and D). RANKL also increased phosphorylation of ERK1/2, c-Jun, and IB- in RAW 264.7 cells (Fig. 3, E–G). In these cells, the degradation of phosphorylated IB- was obvious after 15 min of cell exposure to RANKL (Fig. 3G). These data demonstrate that RANKL activated multiple pathways, including p38, in RAW 264.7 cells.

View larger version (70K): [in this window] [in a new window]   Fig. 3. The Ocl precursors express only the p38 isoform, which is downstream of RANK. Proteins were extracted from untreated RAW 264.7 cells and then analyzed by Western immunoblot (A). p38 was the only isoform detected by its specific antibody, although specific antibodies to either p38 or p38 or p38 did detect the corresponding recombinant proteins (10 ng/lane) that were used as positive controls (B). The isoform-selective detection limit for each antibody was <2 ng of the corresponding p38 isoform (data not shown). RAW 264.7 cells were also treated with 100 ng/ml RANKL for different times (C), and the degree of p38 phosphorylation (p-p38) after 20 min of exposure to RANKL, analyzed by Western immunoblot, was compared with that of 100 ng/ml LPS, used as a positive control (D). Optimal stimulation of p38 phosphorylation was reached after 20 min of exposure to RANKL. Protein extracts from untreated RAW 264.7 cells or RAW 264.7 cells treated for 10 or 20 min with 100 ng/ml RANKL or 100 ng/ml LPS were also analyzed by Western immunoblot for p-ERK (E), p-c-Jun (F), or p-IB (G). RANKL stimulated ERK, c-Jun, and IB- phosphorylation with no change in total ERK and c-Jun. Degradation of phosphorylated IB- was obvious after 15 min of cell exposure to RANKL.

SC-409 Selectively Blocks p38 Signaling in Pre-Ocls without Interfering with JNK and NF-B Pathways. Although SC-409 is a selective inhibitor of p38 (Table 1; J. Monahan, unpublished data), the selectivity of its effects on p38 signaling induced by RANKL in RAW 264.7 cells was analyzed. These cells were preincubated with SC-409 for 30 min before treatment with RANKL for 20 min. No inhibition by SC-409 of RANKL-induced c-Jun phosphorylation (Fig. 4A) and IB- degradation (Fig. 4B) was observed even at 10 µM SC-409, a concentration higher than those required to block osteoclastogenesis (Fig. 2G). Since SC-409 has no effect on p38 phosphorylation (data not shown), HSP-27, a protein downstream of p38 and selectively phosphorylated by the p38 pathway, was used to study the specificity of SC-409. Since HSP-27 was undetectable in RAW 264.7 cells (data not shown), CD34⁺ cells were used to test the specificity of SC-409 effects in cells. RANKL failed to induce c-Jun and IB- phosphorylation in CD34⁺ cells, despite the fact that these proteins were expressed in these cells (data not shown). This observation was consistent with very low to undetectable levels of RANK on these cells (data not shown). Next, CD34⁺ cells were treated with M-CSF and RANKL for 7 days to induce cell commitment to the Ocl lineage. Like RAW 264.7 cells, only p38 was expressed in human Ocls (Fig. 4C). In these cells, RANKL induction of HSP27 phosphorylation, but not c-Jun and IB- phosphorylation, was inhibited by SC-409 at concentrations of 2 and 10 µM (Fig. 4, D–F). These data suggest that SC-409 inhibited Ocl development in vitro by selectively inhibiting p38 signaling.

View larger version (45K): [in this window] [in a new window]   Fig. 4. SC-409 selectively inhibits p38 signaling without interfering with JNK and NF-B pathways. Proteins were extracted from untreated RAW 264.7 cells or RAW 264.7 cells pretreated with 10 µM SC-409 for 30 min before they were exposed to RANKL for 20 min (A and B). Proteins were also extracted from CD34+ cells treated with M-CSF and RANKL for 7 days to induce cell commitment to the Ocl lineage and then were left untreated or treated with increased SC-409 concentrations for 30 min before additional exposure to RANKL for 20 min (D–F). Western blot analysis shows that SC-409 had no effect on c-Jun phosphorylation (A and D) or IB degradation (B and E) induced by RANKL, whereas it inhibited RANKL-stimulated HSP-27 phosphorylation (F).

View larger version (88K): [in this window] [in a new window]   Fig. 5. SC-409 decreases bone destruction, joint infiltration by inflammatory cells, and the number of Ocls in SCW-induced arthritis in rats. Normal rats (A) or rats were inoculated with SCW and then left untreated (B) or were treated 10 days later daily with 15 mg/kg SC-409 b.i.d. administered orally (C). Microcomputed tomography (A–C) or bone mineral density (D) assessment at day 21 of representative paws showed that SC-409 inhibited paw swelling and bone and joint destruction. Specimens were stained with H&E (E and G) or for TRAP and methyl green:thionin (H–J). Note the presence of many cell infiltrates (black asterisks, F) and TRAP+ cells (arrowheads, I). The growth plates can be seen in normal rats and arthritis + SC-409 (arrows, H and J) but not in SCW-induced arthritis in the absence of SC-409 (I). *, p < 0.05.

SC-409 Inhibits the Expression of Numerous Inflammatory Mediators. The data suggest that inhibition of p38 in Ocl precursors by SC-409 may account for its mechanism of action into the bone-sparing effects in vivo. Since a variety of genes are induced in states of arthritis, we examined the role of p38 on the expression of genes that are commonly increased in arthritis. Since elevation of cytokines levels is not readily measured in blood during SCW-induced arthritis, we used real-time reverse transcriptase-PCR (TaqMan) analysis of paw mRNA to determine change in gene expression associated with paw inflammation. Rats were treated with SC-409 from day 18 to 21, late after the onset of the disease, to determine the effects of SC-409 on gene expression by cells that have already infiltrated the joints. RANKL, IL-6, IL-1, TNF-, TRAP, MMP-3, -9, and -13, and COX-2 mRNA expression was induced in paws from SCW-injected animals (day 21), whereas OPG mRNA expression was decreased slightly in the same paws (Fig. 6A). Treatment with SC-409 normalized SCW-induced RANKL, IL-6, IL-1, TRAP, MMP-9, -13, and COX-2, but not TNF-, OPG, and MMP-3 mRNA expression. Consistent with its inhibitory effect on COX-2 mRNA expression, SC-409 completely blocked prostaglandin E₂ production by human fibroblasts at concentrations as low as 2 µM (data not shown). To further understand the mechanisms of SC-409 inhibition of gene expression, we analyzed RANKL mRNA expression by primary rat bone marrow stromal cells treated in vitro with TNF-. We found that RANKL mRNA expression was only partially inhibited by SC-409 (Fig. 6B) in this cell system compared with SCW samples, suggesting that this compound may inhibit the expression of certain cytokines in the joint via prevention of cell influx. Although SC-409 did not decrease the levels of TNF- mRNA induced by SCW, it did inhibit LPS-induced both serum TNF- and IL-6 levels by 90% (Fig. 6C), suggesting post-transcriptional regulation of TNF- expression by p38.

View larger version (32K): [in this window] [in a new window]   Fig. 6. SC-409 inhibits cytokine expression. A, normal rats (open columns) or rats inoculated with SCW were left untreated (arthritis, closed columns) or treated daily from day 18 to 21 with 15 mg/kg SC-409 b.i.d. administered orally (hatched columns). Total RNA was isolated and subjected to TaqMan analysis, and relative RNA transcription levels were compared. SCW increased mRNA expression of most genes analyzed, with the exception of OPG mRNA expression, which was decreased slightly. SC-409 prevented the SCW-induced rise in most mRNA studied, with the exception of OPG, MMP-3, and TNF- mRNA. B, normal mouse bone marrow cells were cultured until most of the hematopoietic cells disappeared. Adherent cells were then treated with TNF- in the absence or presence of SC-409. C, normal rats were pretreated with 30 mg/kg SC-409 for 1 h and then treated with 1 mg/kg LPS. The levels of TNF- or IL-6 protein in serum were measured using ELISA.

View larger version (69K): [in this window] [in a new window]   Fig. 7. p38 pathway is activated in vivo in SCW-induced arthritis. Nuclear extracts isolated from paws from normal, arthritis, or arthritis + SC-409 rats were incubated with MEF2C (A and B) or NF-B (C and D) or AP-1 (E and F) consensus double-stranded oligonucleotides labeled with [32P]ATP and analyzed by EMSA. DNA binding activity of MEF2C, AP-1, and NF-B was increased in arthritic paws (A–F). SC-409 blocked MEF2C activity (B) but not NF-B (D) and marginally inhibited AP-1 activity (F). Nuclear extracts from arthritic paws were incubated with 100x nonradioactive oligonucleotide to demonstrate the specificity of the binding (A–E).

TNF- Production or Signaling Is Critical in SCW-Induced Arthritis. SC-409 inhibits the expression of many genes induced by SCW (Fig. 6). To elucidate the role of TNF- in SCW-induced arthritis, we compared the effects of SC-409 and the recombinant soluble decoy TNF receptor II, sTNF-RII-Fc chimera, on RNA expression in this model. Interestingly, the profile of inhibition of cytokine expression by SC-409 was similar to that of sTNFRII-Fc chimera (Fig. 8). Taken together with data on the inhibitory effects of SC-409 on TNF--induced prostaglandin E₂ production in vitro (data not shown), these data suggest that TNF- production or signaling modulates the expression of many the genes induced by SCW, including RANKL.

View larger version (23K): [in this window] [in a new window]   Fig. 8. TNF- production or signaling is critical in SCW-induced arthritis. Normal rats (open columns) or rats inoculated with SCW were left untreated (arthritis, closed columns) or treated daily from days 18 to 21 with 15 mg/kg SC-409 b.i.d. administered orally (hatched columns) or with 10 mg/kg sTNFRII-Fc chimera administered i.p. (dotted columns). Total RNA were isolated and subjected to TaqMan analysis. The profile of inhibition of cytokine expression by SC-409 was similar to that of sTNFRII-Fc chimera.

	Discussion

Top Abstract Materials and Methods Results Discussion References

Although it has been reported that p38 compounds inhibited adjuvant-induced arthritis (Badger et al., 2000) and more recently that p38 is involved in osteoclastogenesis (Matsumoto et al., 2000; Lee et al., 2002) and tumor-induced osteolysis (Merrell et al., 2003), other studies have suggested that p38 pathway regulates bone resorption through its action in osteoblasts (Li et al., 2002). In this study, we demonstrate that SC-409 is efficient in protecting bone from destruction in the SCW-induced arthritis model due to its ability to inhibit the expression of key inflammatory mediators, including MMPs, which are involved in the breakdown of the extracellular matrix and are regulated by p38 (Wada et al., 2006). Our data point out that SC-409 spared bone in arthritis likely by inhibiting the expression of TNF- by monocytes or macrophages. Subsequently, it may inhibit the expression of MMPs, RANKL, IL-1, IL-6, and others by various cells, including synovial fibroblasts, endothelial cells, and chondrocytes. This is consistent with our data showing that TNF- stimulated RANKL expression in bone marrow stromal cell cultures and SC-409 blocked by 90% LPS-induced TNF- protein production. Furthermore, rats that were treated with SC-409 were indistinguishable from those treated with sTNFRII-Fc chimera in that paws from both treatment groups contained lower levels of inflammatory mediators and were equally protected from developing arthritis (G. Anderson, G. Mbalaviele, and J. Monahan, unpublished data). Thus, prevention of TNF- production or signaling is sufficient to protect the bone from destruction in SCW arthritis. Consistent with this, TNF- not only regulates RANKL expression (Kumar et al., 2001), but both cytokines also act in synergy to stimulate Ocl development (Komine et al., 2001; Feng, 2005). SC-409 has no effect on p38 phosphorylation, implying that SC-409 binding to p38 does not prevent proximal upstream MAPK kinases, such as MKK3 and MKK6, from phosphorylating this enzyme but inhibits the activity of p38 itself. In addition to p38, inhibition by SC-409 of casein kinase 1, which phosphorylates p80 TNF receptor (Darnay et al., 1997), may contribute to its tissue protective effects. This mechanism is however unlikely since our other selective p38 inhibitors from different chemical series that spare casein kinase 1 by >200x are, if anything, more efficacious than SC-409 in inhibiting osteoclastogenesis and experimental arthritis in rats.

In addition to inhibiting cytokine expression, SC-409 may also directly inhibit bone resorption in vivo by antagonizing cytokine signaling inside the Ocl precursors. In support of this notion, in vitro data demonstrate that these cells expressed p38, which could be activated by RANKL. Furthermore, SC-409 blocked Ocl formation that was induced by exogenous recombinant RANKL, by inhibiting p38 activity, demonstrating that this pathway is involved in downstream RANKL/RANK signaling. The reason that multiple pathways, including p38, ERK, JNK, and NF-B (Matsumoto et al., 2000, 2004; Miyazaki et al., 2000; David et al., 2002; Xing et al., 2002) are inducible in Ocls is poorly elucidated. These pathways may be differentially triggered in physiological and pathological bone conditions or during the many steps involved in Ocl development, including precursor cell proliferation, differentiation, fusion, activation, and survival. Concomitant activation of all of these pathways by RANKL, similar to that seen in vitro, may be due to high levels of this protein needed to achieve desired effects. It is possible that JNK and p38 pathways, which are classically activated by stresses and inflammatory cytokines (Kyriakis and Avruch, 2001), are critical in bone loss associated with inflammation. This is consistent with the finding that mice deleted of JNK1 or JNK2 genes have normal skeletal metabolism (David et al., 2002). Future experiments are required to determine the role of p38 pathway in bone loss in other pathological conditions such as osteoporosis.

The mechanisms of p38 signaling in Ocl precursors are still not clear. Our unpublished data indicate that SC-409 has no effect on cell growth or TRAP expression by mononucleated cells. However, this compound is able to block osteoclastogenesis even when added to cultures for only a short-term period of time when Ocl precursors fuse to form multinucleated Ocls. Recent data indicate that the microphthalmia transcription factor (MITF) is directly phosphorylated by p38 (Mansky et al., 2002b). Interestingly, MITF binding sites have been found in the promoter sequences of TRAP and E-cadherin genes, and expression of the latter was significantly decreased in Ocls from mice with null mutation for MITF (Mansky et al., 2002a). We previously showed that E-cadherin is involved in the fusion of murine Ocl precursors (Mbalaviele et al., 1995), and in this study, we found that SC-409 decreased E-cadherin protein expression in Ocl precursors (data not shown). In addition, E-cadherin was found in Ocl ruffled borders, although its role in Ocl activity has not been shown. It is tempting to suggest that SC-409 inhibits osteoclastogenesis at least in part by inhibiting E-cadherin expression.

In conclusion, our p38 inhibitor, SC-409, was shown in this study to block the expression of inflammatory genes and p38 signaling in Ocl precursors. As a result, this inhibitor inhibited Ocl development and attenuated SCW-induced arthritis symptoms and bone destruction in rats.

	Footnotes

 
J.P. deceased in July, 2002.

doi:10.1124/jpet.105.100362.

ABBREVIATIONS: RA, rheumatoid arthritis; TNF, tumor necrosis factor; IL, interleukin; sTNFRII, soluble TNF receptor II; Ocl, osteoclast; NF, nuclear factor; RANK, receptor activator of NF-B; RANKL, RANK ligand; OPG, osteoprotegerin; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun NH₂-terminal kinase; MMP, matrix metalloprotease; SC-409, 4-(3-(4-chlorophenyl)-5-(1-methylpiperidin-4-yl)-1H-pyrazol-4-yl)pyrimidine; SC-448, 1-(4-(3-(4-chlorophenyl)-4-(pyrimidin-2-yl)-1H-pyrazol-5-yl)piperidin-1-yl)-2-hydroxyethanone; MEF2C, myocyte-enhancing factor 2 C; AP-1, activator protein-1; LPS, lipopolysaccharide; MEM, minimal essential medium; FBS, fetal bovine serum; TRAP, tartrate-resistant acid phosphatase; ELISA, enzyme-linked immunosorbent assay; SCW, streptococcal cell wall; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxy-N,N,N',N'-tetramethylrhodamine; MGB/NFQ, minor groove binder/nonfluorescent quencher; FP, forward primer; RP, reverse primer; COX, cyclooxygenase; DTT, dithiothreitol; GST, glutathione S-transferase; MITF, microphthalmia transcription factor; M-CSF, macrophage colony-stimulating factor.

Address correspondence to: Gabriel Mbalaviele, Pfizer Inc., 700 Chesterfield Parkway West, Mail Stop AA5G, Chesterfield, MO 63017. E-mail: gabriel.mbalaviele{at}pfizer.com

	References

Top Abstract Materials and Methods Results Discussion References

 

Badger AM, Griswold DE, Kapadia R, Blake S, Swift BA, Hoffman SJ, Stroup GB, Webb E, Rieman DJ, Gowen M, et al. (2000) Disease-modifying activity of SB 242235, a selective inhibitor of p38 mitogen-activated protein kinase, in rat adjuvant-induced arthritis. Arthritis Rheum 43: 175–183.[CrossRef][Medline]

Bennett BL, Sasaki DT, Murray BW, O'Leary EC, Sakata ST, Xu W, Leisten JC, Motiwala A, Pierce S, Satoh Y, et al. (2001) SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA 98: 13681–13686.[Abstract/Free Full Text]

Brahn E (1991) Animal models of rheumatoid arthritis: clues to etiology and treatment. Clin Orthop 265: 42–53.

Choy EH and Panayi GS (2001) Cytokine pathways and joint inflammation in rheumatoid arthritis. N Engl J Med 344: 907–916.[Free Full Text]

Collin-Osdoby P, Rothe L, Anderson F, Nelson M, Maloney W, and Osdoby P (2001) Receptor activator of NF-B and osteoprotegerin expression by human microvascular endothelial cells, regulation by inflammatory cytokines and role in human osteoclastogenesis. J Biol Chem 276: 20659–20672.[Abstract/Free Full Text]

Darnay BG, Singh S, and Aggarwal BB (1997) The p80 TNF receptor-associated kinase (p80TRAK) associates with residues 354–397 of the p80 cytoplasmic domain: similarity to casein kinase. FEBS Lett 406: 101–105.[Medline]

David JP, Sabapathy K, Hoffmann O, Idarraga MH, and Wagner EF (2002) c-Jun phosphorylation by JNK1 but not JNK2 is necessary for efficient osteoclastogenesis in response to TRANCE stimulation. J Cell Sci 115: 4317–4325.[Abstract/Free Full Text]

Engsig MT, Chen QJ, Vu TH, Pedersen AC, Therkidsen B, Lund LR, Henriksen K, Lenhard T, Foged NT, Werb Z, et al. (2000) Matrix metalloproteinase 9 and vascular endothelial growth factor are essential for osteoclast recruitment into developing long bones. J Cell Biol 151: 879–889.[Abstract/Free Full Text]

Feng X (2005) Regulatory roles and molecular signaling of TNF family members in osteoclasts. Gene (Amst) 350: 1–13.[CrossRef][Medline]

Garg A and Aggarwal BB (2002) Nuclear transcription factor-B as a target for cancer drug development. Leukemia 16: 1053–1068.[CrossRef][Medline]

Goldring SR and Gravallese EM (2000) Mechanisms of bone loss in inflammatory arthritis: diagnosis and therapeutic implications. Arthritis Res 2: 33–37.[CrossRef][Medline]

Grigoriadis AE, Wang ZQ, Cecchini MG, Hofstetter W, Felix R, Fleisch HA, and Wagner EF (1994) c-Fos: a key regulator of osteoclast-macrophage lineage determination and bone remodeling. Science (Wash DC) 266: 443–448.[Abstract/Free Full Text]

Han Z, Boyle DL, Chang L, Bennett B, Karin M, Yang L, Manning AM, and Firestein GS (2001) c-Jun N-terminal kinase is required for metalloproteinase expression and joint destruction in inflammatory arthritis. J Clin Investig 108: 73–81.[CrossRef][Medline]

Han Z, Boyle DL, Manning AM, and Firestein GS (1998) AP-1 and NF-B regulation in rheumatoid arthritis and murine collagen-induced arthritis. Autoimmunity 28: 197–208.[Medline]

Hom JT, Gliszczynski VL, Cole HW, and Bendele AM (1991) Interleukin 1 mediated acceleration of type II collagen-induced arthritis: effects of anti-inflammatory or anti-arthritic drugs. Agents Actions 33: 300–309.[Medline]

Komine M, Kukita A, Kukita T, Ogata Y, Hotokebuchi T, and Kohashi O (2001) Tumor necrosis factor- cooperates with receptor activator of nuclear factor B ligand in generation of osteoclasts in stromal cell-depleted rat bone marrow cell culture. Bone (NY) 28: 474–483.

Kong YY, Feige U, Sarosi I, Bolon B, Tafuri A, Morony S, Capparelli C, Li J, Elliott R, McCabe S, et al. (1999a) Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. Nature (Lond) 402: 304–309.[CrossRef][Medline]

Kong YY, Yoshida H, Sarosi I, Tan HL, Timms E, Capparelli C, Morony S, Oliveirados-Santos AJ, Van G, Itie A, et al. (1999b) OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature (Lond) 397: 315–323.[CrossRef][Medline]

Kumar S, Votta BJ, Rieman DJ, Badger AM, Gowen M, and Lee JC (2001) IL-1- and TNF-induced bone resorption is mediated by p38 mitogen activated protein kinase. J Cell Physiol 187: 294–303.[CrossRef][Medline]

Kyriakis JM and Avruch J (2001) Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807–869.[Abstract/Free Full Text]

Lam J, Takeshita S, Barker JE, Kanagawa O, Ross FP, and Teitelbaum SL (2000) TNF- induces osteoclastogenesis by direct stimulation of macrophages exposed to permissive levels of RANK ligand. J Clin Investig 106: 1481–1488.[Medline]

Lee SE, Woo KM, Kim SY, Kim HM, Kwack K, Lee ZH, and Kim HH (2002) The phosphatidylinositol 3-kinase, p38 and extracellular signal-regulated kinase pathways are involved in osteoclast differentiation. Bone (NY) 30: 71–77.

Li X, Udagawa N, Itoh K, Suda K, Murase Y, Nishihara T, Suda T, and Takahashi N (2002) p38 MAPK-mediated signals are required for inducing osteoclast differentiation but not for osteoclast function. Endocrinology 143: 3105–3113.[Abstract/Free Full Text]

Mansky KC, Marfatia K, Purdom GH, Luchin A, Hume DA and Ostrowski MC (2002a) The microphthalmia transcription factor (MITF) contains two N-terminal domains required for transactivation of osteoclast target promoters and rescue of mi mutant osteoclasts. J Leukoc Biol 71: 295–303.[Abstract/Free Full Text]

Mansky KC, Sankar U, Han J, and Ostrowski MC (2002b) Microphthalmia transcription factor is a target of the p38 MAPK pathway in response to receptor activator of NF-B ligand signaling. J Biol Chem 277: 11077–11083.[Abstract/Free Full Text]

Matsumoto M, Kogawa M, Wada S, Takayanagi H, Tsujimoto M, Katayama S, Hisatake K, and Nogi Y (2004) Essential role of p38 mitogen-activated protein kinase in cathepsin K gene expression during osteoclastogenesis. J Biol Chem 279: 45969–45979.[Abstract/Free Full Text]

Matsumoto M, Sudo T, Saito T, Osada H, and Tsujimoto M (2000) Involvement of p38 mitogen-activated protein kinase signaling pathway in osteoclastogenesis mediated by receptor activator of NF-B ligand (RANKL). J Biol Chem 275: 31155–31161.[Abstract/Free Full Text]

Mbalaviele G, Chen H, Boyce BF, Mundy GR, and Yoneda T (1995) The role of cadherin in the generation of multinucleated osteoclasts from mononuclear precursors in murine marrow. J Clin Investig 95: 2757–2765.[Medline]

Merrell M, Suarez-Cuervo C, Harris KW, Väänänen HK, and Selander KS (2003) Bisphosphonate induced growth inhibition of breast cancer cells is augmented by p38 inhibition. Breast Cancer Res Treat 81: 231–241.[Medline]

Min H, Morony S, Sarosi I, Dunstan CR, Capparelli C, Scully S, Van G, Kaufman S, Kostenuik PJ, Lacey DL, et al. (2000) Osteoprotegerin reverses osteoporosis by inhibiting endosteal osteoclasts and prevents vascular calcification by blocking a process resembling osteoclastogenesis. J Exp Med 192: 463–474.[Abstract/Free Full Text]

Miyazaki T, Katagiri H, Kanegae Y, Takayanagi H, Sawada Y, Yamamoto A, Pando MP, Asano T, Verma IM, Oda H, et al. (2000) Reciprocal role of ERK and NF-B pathways in survival and activation of osteoclasts. J Cell Biol 148: 333–342.[Abstract/Free Full Text]

Mundy GR, Boyce BF, Yoneda T, Bonewald LF, and Roodman GD (1995) Cytokines and bone remodeling, in Osteoporosis (Marcus R, Feldman D, and Kelsey J eds) pp 302–313, Academic Press, San Diego, CA.

Pacifici R (1996) Estrogen, cytokines and pathogenesis of postmenopausal osteoporosis. J Bone Miner Res 11: 1043–1051.[Medline]

Rauch F, Travers R, Parfitt AM, and Glorieux FH (2000) Static and dynamic bone histomorphometry in children with osteogenesis imperfecta. Bone (NY) 26: 581–589.

Roodman GD (1999) Cell biology of the osteoclast. Exp Hematol 27: 1229–1241.[CrossRef][Medline]

Takyanagi H, Ogasawara K, Hida S, Chiba T, Murata S, Sato K, Takaoka A, Yokochi T, Oda H, Tanaka K, et al. (2000) T-cell-mediated regulation of osteoclastogenesis by signalling cross-talk between RANKL and IFN-. Nature (Lond) 408: 600–605.[CrossRef][Medline]

Wada Y, Shimada K, Sugimoto K, Kimura T, and Ushiyama S (2006) Novel p38 mitogen-activated protein kinase inhibitor R-130823 protects cartilage by down-regulating matrix metalloproteinase-1,-13 and prostaglandin E₂ production in human chondrocytes. Int Immunopharmacol 6: 144–155.[Medline]

Weinstein RS, Nicholas RW, and Manolagas SC (2000) Apoptosis of osteocytes in glucocorticoid-induced osteonecrosis of the hip. J Clin Endocrinol Metab 85: 2907–2912.[Abstract/Free Full Text]

Wolfe F and Strand V (2001) Radiography of rheumatoid arthritis in the time of increasing drug effectiveness. Curr Rheumatol Rep 3: 46–52.[Medline]

Xing L, Bushnell TP, Carlson L, Tai Z, Tondravi M, Siebenlist U, Young F, and Boyce BF (2002) NF-B p50 and p52 expression is not required for RANK-expressing osteoclast progenitor formation but is essential for RANK- and cytokine-mediated osteoclastogenesis. J Bone Miner Res 17: 1200–1210.[CrossRef][Medline]

This article has been cited by other articles:

				T. Thalhamer, M. A. McGrath, and M. M. Harnett MAPKs and their relevance to arthritis and inflammation Rheumatology, April 1, 2008; 47(4): 409 - 414. [Abstract] [Full Text] [PDF]

				J.F. Schindler, J.B. Monahan, and W.G. Smith p38 Pathway Kinases as Anti-inflammatory Drug Targets J. Dent. Res., September 1, 2007; 86(9): 800 - 811. [Abstract] [Full Text] [PDF]

				C.S. Patil and K.L. Kirkwood p38 MAPK Signaling in Oral-related Diseases J. Dent. Res., September 1, 2007; 86(9): 812 - 825. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.105.100362v1 317/3/1044    most recent Submit a response