![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION
Department of Pharmaceutical Sciences, University of Maryland, Baltimore, Maryland (C.W.M., V.M.D., L.M.B., A.R., P.W.S.); and Biophysics Program, Ohio State University, Columbus, Ohio (M.A.P.)
Received September 23, 2005; accepted January 5, 2006.
| Abstract |
|---|
|
|
|---|
Riboflavin binds nonspecifically to plasma proteins (albumin, globulins, and fibrinogen) (Combs, 1998
), but analogous to other vitamins, such as retinol, vitamin D, and folate (Corrocher et al., 1991
; Gomme and Bertolini, 2004
; Zanotti and Berni, 2004
), it exhibits specific binding to riboflavin carrier proteins (RCPs). Specific RCPs have been identified in the plasma of the laying hen, cow, mice, rats, spadefoot toad, turtle, bonnet monkey, and human umbilical cord serum (Foraker et al., 2003
). However, to date, the molecular identity of this carrier protein remains undetermined. The increased gestational need for RF is pivotal to embryonic growth and development as evaluated in avian (Clagett, 1971
) and rodent (Natraj et al., 1987
) models and stipulates the pregnancy-specific role of hormonally regulated RCPs in RF delivery to the fetus (Murthy and Adiga, 1978a
,b
; Visweswariah and Adiga, 1988
).
Avian riboflavin carrier protein [chicken RCP (cRCP)], the first RCP to be isolated and characterized, is an estrogen-inducible phosphoglycoprotein (37 kDa) that regulates oocyte transport of scavenged RF (Rhodes et al., 1959
). Immunologically, RCPs maintain a degree of interspecies homology since several conformation-dependent monoclonal antibodies raised against the avian protein have been found to cross-react with simian (Visweswariah et al., 1987
), rodent (Subramanian and Adiga, 1996
), and human RCPs (Prasad et al., 1992
; Subramanian and Adiga, 1999
). Given this cross-reactivity and the mammalian taxonomy of this evolutionarily conserved vitamin carrier (Muniyappa and Adiga, 1980a
,b
; MacLachlan et al., 1993
), the existence and role of a human RCP in mediating RF binding and translocation across the fetoplacental membrane barrier seems reasonable.
The working hypothesis describing cellular internalization of RF proposes its sequestration by RCP, recognition by membrane receptors, and uptake via clathrin-coated pits (Mac Lachlan et al., 1994
; Huang et al., 2003
). Attempts to identify cRCP receptors have revealed Ca2+-dependent binding to members of the low-density lipoprotein family of receptors in association with vitellogenin, a broad-specificity carrier (Adiga et al., 1997
). The present study uses mammalian cell lines (BeWo and COS-1) in parallel with avian controls (LMH/2A) to better understand the involvement of RCP in receptor-mediated RF internalization and its fate thereafter. Our combined data demonstrate that RCP translocates across cellular barriers, bringing with it bound ligand (RF) before recycling back to the extracellular milieu. Understanding this system may serve as a novel platform that could be targeted clinically toward cells with enhanced nutritional requirements for RF, such as the fetus and breast tumors.
| Materials and Methods |
|---|
|
|
|---|
Inhibition Assays. BeWo cells were incubated with 10 nM riboflavin-[3H(G)] (25 Ci/mmol; Sigma), and [3H]RF uptake was compared with accumulation of a nonspecific ligand [folic acid (FA)] in the presence of unlabeled RF (1 µM), bovine serum albumin (BSA; 30 µM), protein A-purified cRCP antisera (20200 µg/ml), and preimmune rabbit sera (200 µg/ml). All solutions were prepared in Hanks' balanced salt solution, pH 7.4, containing 25 mM glucose and 10 mM HEPES. After incubation, cells were processed as described previously (Huang and Swaan, 2001
). In brief, cells were washed using ice-cold Dulbecco's phosphate-buffered saline, pH 3.0, and lysed, and intracellular accumulation of [3H]RF was determined using a liquid scintillation counter (Beckman Coulter, Inc., Fullerton, CA). Results were normalized to total protein content determined by the Bradford assay (Bio-Rad, Hercules, CA).
Binding of [3H]RF to anti-cRCP was determined following a 10-min incubation at 37°C using BSA and cRCP as controls. Ligand-associated protein was captured using hydroxyapatite, whereas unbound [3H]RF was recovered in the supernatant after centrifugation at 10,000 rpm for 2 min. The hydroxyapatite pellet was washed with Tris buffer, pH 7.2, and bound radiolabel-associated protein was released using ethanol following centrifugation at 14,000 rpm for 3 min. Results were expressed as percentage total radioactivity.
Expression and Binding of Chicken Riboflavin Carrier Protein in Transfected Cells. A cDNA clone of cRCP, in pBluescript II KS+ ligated via NotI and EcoRI sites, was obtained from the Roslin Institute (Edinburgh, UK). The cRCP cDNA was extracted with HindIII and BamHI ligation sites via the forward primer, AAAAGCTTATGCTGAGGTTTGCCATCA, and the two reverse primers, AAGGATCCTCATCTTCTCTCTTCCCCT (with stop codon) and AAGGATCCATCTTCTCTCTTCCCCTTC (without stop codon). Resulting cDNAs were ligated into pEGFP-N2 vectors (Clontech, Mountain View, CA) and sequenced on the DNA 3700 analyzer at the Plant-Microbe Genomics Facility at Ohio State University (Columbus, OH). For COS-1 transfection with cRCP, Lipofectamine 2000 and Opti-MEM (Invitrogen Life Technologies) were used as per the supplier's protocol.
Medium binding assays were developed to detect the presence of RF-specific binding proteins secreted by transfected COS-1 cells into media. After 12- to 48-h incubations, medium was removed and incubated with 5 mg/ml activated charcoal under agitation at 4°C for 16 to 24 h. Samples were centrifuged at 12,000g, and supernatant was filtered using a 0.22-µm syringe filter. Cleared sample was then mixed 1:1 with 20 nM [3H]RF with or without 10 µM nonradiolabeled RF (to determine nonspecific binding) at 4°C overnight. All samples were processed using hydroxyapatite. Whole-cell binding was carried out similarly to uptake studies, with the exception that incubation with [3H]RF was for 2 h instead of 10 min.
Immunofluorescence Microscopy. BeWo and COS-1 cells transfected with cRCP were grown on four-well culture slides (Becton Dickinson, Bedford, MA) and processed for immunostaining as described previously (Huang et al., 2003
). In brief, cells were washed, fixed with 4% paraformaldehyde, and permeabilized with 0.2% Triton X-100. To evaluate intracellular localization of cRCP, control cells were run in parallel under nonpermeabilizing conditions. Cells were then labeled with rabbit anti-cRCP antibody (1:250) at room temperature for 1 h and then incubated with Alexa Fluor 546-labeled goat anti-rabbit antibody (1:200) for 1 h at room temperature. Cells were counterstained with DAPI, washed, and mounted in SlowFade reagent. Images were captured with an RT SPOT CCD camera and software (National Diagnostics, Atlanta, GA) using the Nikon Eclipse 800 fluorescence microscope (Nikon, Melville, NY) equipped with a 40x objective and fluorescein isothiocyanate-HYQ (
ex, 460500 nm;
em, 510650 nm; dichroic splitter, 505 nm), tetramethylrhodamine B isothiocyanate-HYQ (
ex, 530550 nm;
em, 590650 nm; dichroic splitter, 565 nm), and UV-2E/C DAPI (
ex, 330380 nm;
em, 435485 nm; dichroic splitter, 400 nm) filter sets (Chroma, Rockingham, VT). Composite images were colored and assembled in Adobe Photoshop 6.0 (Adobe Systems Inc., Mountain View, CA).
Intracellular Uptake Kinetics of Iodinated-Chicken Riboflavin Carrier Protein. The apo form of cRCP (Sigma) was labeled with Na125I (
5 µCi/µg; Amersham Biosciences, Piscataway, NJ) using the IODOGEN method (Pierce Biotechnology, Inc., Rockford, IL). Iodinated protein was desalted by gel filtration using Micro-BioSpin columns (Bio-Rad), and 125I incorporation was assessed by gel electrophoresis and autoradiography. The specific activity of the 125I-cRCP was
6700 cpm/pmol.
Cellular uptake of 125I-cRCP in confluent BeWo and LMH/2A cells was determined in the presence of 0 to 1 µM unlabeled cRCP and 2 to 25 µM monensin at 37°C. After 20 min, cells were processed as described above. Kinetic parameters were determined by nonlinear regression analysis using the following equation (Prism 4.0; GraphPad Software Inc., San Diego, CA):
![]() | (1) |
For recycling of cRCP, BeWo cells were loaded with 5 nM 125I-cRCP for 20 min at 37°C. After internalization, cells were washed three times with Dulbecco's phosphate-buffered saline, pH 7.4 and 3.0, to remove nonspecific and membrane-bound radioactivity. Fresh medium containing unlabeled cRCP was added to each well and maintained at 4, 16, or 37°C. Aliquots from the extracellular media were taken at regular intervals up to 1 h, and replacement buffer was added. After an hour, cells were washed thoroughly, lysed, and processed as described above to determine intracellular cRCP accumulation. Recycling t1/2 was determined using first-order kinetics (eq. 2; Prism 4.0):
![]() | (2) |
Ligand Uptake and Subcellular Fractionation. Cell monolayers were dosed with 10 nM each of [3H]riboflavin (Sigma) and 125I-cRCP in Hanks' balanced salt solution, pH 7.4, containing 25 mM glucose and 10 mM HEPES at 37°C for 2 h. After incubation, cells were washed thoroughly and pooled in homogenization buffer containing 0.25 M sucrose, 10 mM Tris-HCl, pH 7.5, and protease inhibitors (Complete Mini; Roche Diagnostics, Indianapolis, IN). Cells were allowed to swell for 15 min prior to lysis through a 25-gauge 5/8 hypodermic needle and then centrifuged at 600g for 5 min at 4°C to yield a nuclear pellet and postnuclear supernatant.
For isolation of endosomes and lysosomes, the fractions were loaded on a discontinuous sucrose gradient (0.82.0 M), subjected to 205,000g for 2 h at 4°C using the SW 55Ti rotor (Beckman Coulter, Inc.), and fractionated into 350-µl aliquots. Accumulation of radiolabeled ligands in each fraction was measured by dual-label (i.e., [3H] and [125I]) liquid scintillation counting (Beckman Coulter, Inc.) and normalized to total protein content. Fractions were identified by Western blot analyses using organelle-specific protein markers [endosomal fractions were identified using clathrin and Rab5 GTPase antibodies; lysosomes were detected using lysosome-associated protein 1 (LAMP-1) antibody; BD Pharmingen, San Diego, CA] Fractionated proteins were resolved on 7.5 or 18% Tris-HCl gels, transferred to polyvinylidene difluoride membranes (Immun-Blot; BioRad), immunoblotted using peroxidase-conjugated secondary antibodies, and detected using the ECL plus system (Amersham Biosciences).
Data Analysis. All experiments were carried out in triplicate and repeated with at least two different cell populations. Results are expressed as mean ± S.D. Statistical analyses between the treatments and their respective controls were performed using one-way analysis of variance followed by the Student Newman-Keuls post-test with significance at p < 0.05.
| Results |
|---|
|
|
|---|
95%) that occurred even at the lowest concentration of antibody (Fig. 1A). This indicates that RF internalization may depend on a specific mammalian protein that shares homology with its avian counterpart but is possibly poorly expressed and tightly regulated to influence ligand uptake in human trophoblasts. These findings were supported by visualization of anti-cRCP-immunoreactive protein(s) detected only under permeabilizing conditions within the cellular compartment (Fig. 1D). Failure to detect signal under nonpermeabilizing conditions (Fig. 1D), together with the inhibition of RF uptake (Fig. 1A), suggests that mammalian cRCP is probably a secreted protein that is released in response to a ligand-triggered stimulus. Specificity of this inhibition with anti-cRCP was established using preimmune rabbit IgG and BSA as controls (Fig. 1A), whereas ligand specificity was confirmed by the limited inhibitory effect of anti-cRCP directly on RF uptake (Fig. 1C), with undetectable changes in intracellular folate accumulation (Fig. 1B). Unlike RF, the large excess of unlabeled folate showed submaximal inhibition of the labeled ligand, possibly due to the presence of multiple components that contribute to its internalization, namely the high-capacity folate carrier and high-affinity folate binding protein, respectively (Sirotnak and Tolner, 1999
|
45% of protein-associated ligand, thus substantiating RF recognition for cRCP but not anti-cRCP. This further lends support to the existence and proposed role of a mammalian RCP homologous to the avian form that mediates RF uptake in human placental trophoblasts. Recognition and Binding of cRCP and RF Post-Transfection in COS-1 Cells. BeWo cells express endogenous RCP that contributes to RF absorption when presented in the extracellular media (data not shown). To validate these results, another mammalian cell line, COS-1 (kidney cell line from Green African monkey), was selected for its lack of expression of endogenous RCP. Immunofluorescence microscopy was carried out to ascertain detectable levels of RCP upon transfection with cRCP and cRCP-GFP vectors (Fig. 2A). Functional relevance of these transfections with the secretory RCP was measured using medium binding assays to detect RF-specific interactions in spent culture media. Figure 2B shows that COS-1 cells transfected with cRCP or the GFP-cRCP fusion construct exhibited RF-specific binding as indicated by significant differences between total and nonspecific binding when excess unlabeled RF was added. These results thereby suggest that mammalian cells secrete a RCP-like protein into the extracellular environment that binds and sequesters RF prior to its internalization. Although the cellular accumulation of RF was not enhanced by cRCP in these studies, based on previous results (Fig. 1), we cannot exclude the possibility that this mammalian cRCP-like protein aids in ligand uptake.
|
|
Preliminary studies revealed a 1:1 stoichiometry for RF-cRCP association essential to the vitamin uptake process. Yet, prior experiments in our laboratory suggest that extraneous RF may not be required for the internalization of cRCP (data not shown). To evaluate whether membrane-bound 125I-cRCP is internalized into BeWo and LMH/2A cells, uptake kinetics of 0 to 1.0 µM 125I-cRCP were determined at 37°C. Figure 3B reveals that the uptake process for 125I-cRCP in both cell lines was saturable. Breakdown of the kinetic analyses using eq. 1 exhibits nanomolar affinities for 125I-cRCP in BeWo and LMH/2A cells (Table 1). However, the maximal transport capacity was approximately 3-fold higher in hepatoma cells (Vmax, 75.14 ± 7.6 pmol/mg protein/min) compared with placental trophoblasts (Vmax, 28.56 ± 2.7 pmol/mg protein/min), suggesting differences in endogenous RCP expression and RF-RCP membrane interaction or increased distribution of unidentified RCP cell surface receptors in the liver. Immunoblot analysis of the cell lysate following cRCP uptake revealed a protein band at
37 kDa, which was compared with the pure protein (Fig. 3C). Consequently, the binding of RF to cRCP may drive the entry of this ligand-protein complex into the intracellular domain, where we propose that RF dissociates from the carrier protein to mediate its downstream metabolic effects.
|
Intracellular Translocation of cRCP via an Endocytic Pathway. Previous studies from our laboratory propose endocytic events in the translocation process of RF (Huang and Swaan, 2000
, 2001
; Huang et al., 2003
). In addition, data from the current study suggest that RF crosses the plasma membrane bound to its carrier protein; hence, to further delineate its cellular trafficking, we evaluated the subcellular distribution profile of this internalized protein.
Cells were coincubated with 125I-cRCP and [3H]RF, and localization of the dual labels within the cell was assessed via fractionation based on organelle-specific densities. Given the relative densities of the organelles of the endocytic system (i.e., endosomes and lysosomes), only non-nuclear fractions were considered to be relevant. Distribution profiles for RF and cRCP in native LMH/2A (Fig. 4A) cells reveal colocalization of the radiolabeled ligands within fractions that were identified using unique organelle-descriptive markers. Colocalization of 125I-cRCP and [3H]RF within endosomes of LMH/2A (Fig. 4B) was established via detection of clathrin and Rab5 in fractions 1 to 8 and 10. Moreover, all fractions were positive for LAMP-1 (Fig. 4B), suggesting varying lysosomal sizes within the chicken hepatocytes that are responsible for at least partial degradation of these vesicular contents within the cells. These results definitively show the involvement of endocytic processes in cointernalization of RF associated with its binding protein (RCP) to the intracellular domain.
|
|
70% of the cellular load. Experimental t1/2 was calculated at 0.97 ± 0.11 min using eq. 2. The amount recycled decreased significantly at the quiescent temperature of 4°C, where only 0.20 ± 0.04 pmol of the cell-loaded cRCP was detected extracellularly after 60 min with a calculated t1/2 of 2.37 ± 0.39 min. At ambient temperatures of 16 to 20°C, previously reported to inhibit lysosomal trafficking (Apodaca et al., 1994
| Discussion |
|---|
|
|
|---|
Recent studies from our laboratory have indicated a receptor-mediated endocytic mechanism of riboflavin transport in human intestinal and placental cells (Huang and Swaan, 2000
, 2001
; Huang et al., 2003
). In this study, we examine the role of protein chaperones that aid RF endocytosis specific to its recognition and sequestration, followed by cell surface binding and internalization in mammalian cells. The well studied cRCP functions to bind and transport RF. Several laboratories have deduced its presence in mammalian species based on the evolutionary conserved protein domains (Foraker et al., 2003
), but a purified human form of the ligand-specific carrier protein presently remains elusive. Here, we demonstrate that human placental trophoblasts depend critically on such a RF-specific carrier protein (RCP) for cellular RF uptake since immunological inhibition with antibodies raised against the chicken RCP results in a total loss of RF accumulation. Indirect immunofluorescence shows that RCP is localized intracellularly in BeWo cells (Fig. 1D), leading us to believe that RCP is secreted by the cell to facilitate RF uptake. Furthermore, this human RCP found in trophoblasts exhibits distinct specificity toward its designated ligand (RF), since cross-reactivity with folate, another water-soluble vitamin, was not established (Fig. 1B).
We next evaluated the mechanism underlying the role of RCP in binding RF and facilitating its internalization process. First, the use of cRCP in a mammalian system was validated by its specific interactions with RF following transfections using cRCP and cRCP-GFP constructs (Fig. 2). We then radiolabeled the apo form of cRCP to serve as a detectable marker and confirmed that these chemical modifications do not interfere with substrate recognition and binding to its interacting receptor(s) in BeWo cells, as well as in chicken hepatocytes (LMH/2A) that functioned as a species-specific control. Kinetic elucidation of cellular cRCP uptake revealed a saturable process with nanomolar affinities for the integral membrane receptor(s) (Table 1; Fig. 3B), which is in accordance with previous kinetic data of RF from our laboratory (Huang and Swaan, 2001
). Based on the aforementioned findings, we propose that RCP serves to sequester its ligand from the extracellular medium and then traverses the membrane barrier with or without the attached cargo.
Differential transport capacities exhibited by the hepatocytes and trophoblasts may be attributed to differences in endogenous RCP expression and membrane interactions with RF or differences in the expression and interaction with unidentified cell surface receptor(s). Although specific RF or RCP receptors have yet to be identified in humans, prior reports allude to cRCP binding with lipoprotein receptors on oocyte membranes (Mac Lachlan et al., 1994
). Hence, we sought to examine the role of mutiligand-specific apical endocytic receptors belonging to the lipoprotein receptor superfamily, cubilin and megalin (Christensen and Birn, 2002
), in RCP-RF internalization. Seemingly, these receptors, although expressed in trophoblasts, do not influence the entry mechanism of RF (data not shown), which suggests that RCP-RF must react with a specific membrane RF receptor to complete the endocytic process. Another possibility that needs to be considered is perhaps the dual role of RCPs that function to sequester the ligand and then dock into the membrane to serve as the RF receptor.
Visualization of rhodamine-labeled RF by immunofluorescence microscopy coupled with colocalization studies using endosomal and lysosomal markers supports the premise for endocytic mode of ligand entry in human placental cells (Huang et al., 2003
). Given that RCP associates with the ligand RF and is then cointernalized, we evaluated the intracellular trafficking profile for the carrier-RF complex. Interestingly, subcellular distribution profiles of RCP within endosomes and lysosomes paralleled those of RF, although intracellular RF concentrations were significantly higher (Fig. 4). This may result from increased rates of RCP degradation and/or recycling to the extracellular environment to acquire additional cargo. This mechanism is analogous to the well characterized transferrin receptor (TFR), which is endocytosed with its ligand [transferrin (TF)] via clathrin-coated pits. TF remains associated with its receptor (TFR) until it recycles to the plasma membrane at which point dissociation takes place (van Dam et al., 2002
). This process distinguishes the TF-TFR complex from other lysosome-targeted proteins.
Coadministration of monensin in BeWo cells resulted in a significant decline of internalized 125I-cRCP. Consequently, the bulk of radiolabeled protein remained associated with the plasma membrane, indicating a potential use for RCP in subsequent ligand interactions. Similar observations have been reported for asialoglycoproteins (Harford et al., 1983
) and proteoglycans (Yanagishita and Hascall, 1985
), where degradation and accumulation of ligand-receptor complexes inside the cell are retarded in the presence of monensin. Furthermore, at and below physiologically relevant temperatures, the depot of internalized RCP that escapes degradation is subject to recycling as intact protein that contributes to the continued cycle of specific ligand recognition and uptake. It is noteworthy that at normal physiological temperature (37°C), we observe increased recycling of RCP, suggesting that some protein may escape lysosomal degradation and cycle back to the extracellular milieu, where it is free to bind free RF.
In summary, our experiments demonstrate the presence of a riboflavin carrier protein in human placental trophoblasts that specifically binds its ligand. RF-associated RCP is then recognized by specific membrane binding partners and is taken up into the cells via previously hypothesized endocytic machinery. Internalized RCP traffics within the cell and is ultimately either degraded in the lysosomes or is preserved to recycle back to the surface to scavenge additional cargo. Clearly, the identity of RCP and its receptor need further characterization. Future studies using proteomic tools are aimed at the isolation and identification of RCP and the interacting receptors, which will aid structural and molecular elucidation of the endocytic events.
| Footnotes |
|---|
ABBREVIATIONS: RF, riboflavin; RCP, riboflavin carrier protein; cRCP, chicken RCP; FA, folic acid; BSA, bovine serum albumin; DAPI, 4,6-diamidino-2-phenylindole; LAMP-1, lysosome-associated protein 1; GFP, green fluorescent protein; TF, transferrin; TFR, transferrin receptor.
Address correspondence to: Dr. Peter W. Swaan, Department of Pharmaceutical Sciences, University of Maryland, Baltimore, 20 Penn Street, Baltimore, MD 21201. E-mail: pswaan{at}rx.umaryland.edu
| References |
|---|
|
|
|---|
Adiga PR, Subramanian S, Rao J, and Kumar M (1997) Prospects of riboflavin carrier protein (RCP) as an antifertility vaccine in male and female mammals. Hum Reprod Update 3: 325334.
Apodaca G, Katz LA, and Mostov KE (1994) Receptor-mediated transcytosis of IgA in MDCK cells is via apical recycling endosomes. J Cell Biol 125: 6786.
Christensen EI and Birn H (2002) Megalin and cubilin: multifunctional endocytic receptors. Nat Rev Mol Cell Biol 3: 256266.[Medline]
Clagett CO (1971) Genetic control of the riboflavin carrier protein. Fed Proc 30: 127129.[Medline]
Combs GF Jr (1998) Emerging relationships of vitamins and cancer risks. Curr Opin Clin Nutr Metab Care 1: 519523.[CrossRef][Medline]
Corrocher R, Olivieri O, and Pacor ML (1991) The folate binding proteins. Haematologica 76: 500504.[Medline]
Ellinger I, Rothe A, Grill M, and Fuchs R (2001) Apical to basolateral transcytosis and apical recycling of immunoglobulin G in trophoblast-derived BeWo cells: effects of low temperature, nocodazole and cytochalasin D. Exp Cell Res 269: 322331.[CrossRef][Medline]
Foraker AB, Khantwal CM, and Swaan PW (2003) Current perspectives on the cellular uptake and trafficking of riboflavin. Adv Drug Deliv Rev 55: 14671483.[CrossRef][Medline]
Gomme PT and Bertolini J (2004) Therapeutic potential of vitamin D-binding protein. Trends Biotechnol 22: 340345.[CrossRef][Medline]
Harford J, Bridges K, Ashwell G, and Klausner RD (1983) Intracellular dissociation of receptor-bound asialoglycoproteins in cultured hepatocytes: a pH-mediated non-lysosomal event. J Biol Chem 258: 31913197.
Huang SN, Phelps MA, and Swaan PW (2003) Involvement of endocytic organelles in the subcellular trafficking and localization of riboflavin. J Pharmacol Exp Ther 306: 681687.
Huang SN and Swaan PW (2000) Involvement of a receptor-mediated component in cellular translocation of riboflavin. J Pharmacol Exp Ther 294: 117125.
Huang SN and Swaan PW (2001) Riboflavin uptake in human trophoblast-derived BeWo cell monolayers: cellular translocation and regulatory mechanisms. J Pharmacol Exp Ther 298: 264271.
MacLachlan I, Nimpf J, and Schneider WJ (1994) Avian riboflavin binding protein binds to lipoprotein receptors in association with vitellogenin. J Biol Chem 269: 2412724132.
MacLachlan I, Nimpf J, White HB 3rd, and Schneider WJ (1993) Riboflavinuria in the rd chicken: 5'-splice site mutation in the gene for riboflavin-binding protein. J Biol Chem 268: 2322223226.
Merrill AH Jr, Froehlich JA, and McCormick DB (1979) Purification of riboflavin-binding proteins from bovine plasma and discovery of a pregnancy-specific riboflavin-binding protein. J Biol Chem 254: 93629364.
Muniyappa K and Adiga PR (1980a) Isolation and characterization of riboflavin-binding protein from pregnant-rat serum. Biochem J 187: 537540.[Medline]
Muniyappa K and Adiga PR (1980b) Occurrence and functional importance of a riboflavin-carrier protein in the pregnant rat. FEBS Lett 110: 209212.[CrossRef][Medline]
Murthy US and Adiga PR (1978a) Estrogen-induced synthesis of riboflavin-binding protein in immature chicks: kinetics and hormonal specificity. Biochim Biophys Acta 538: 364375.[Medline]
Murthy US and Adiga PR (1978b) Oestrogen induction of riboflavin-binding protein in immature chicks nature of the secretory protein. Biochem J 170: 331335.[Medline]
Natraj U, George S, and Kadam P (1988) Isolation and partial characterisation of human riboflavin carrier protein and the estimation of its levels during human pregnancy. J Reprod Immunol 13: 116.[CrossRef][Medline]
Natraj U, Kumar RA, and Kadam P (1987) Termination of pregnancy in mice with antiserum to chicken riboflavin-carrier protein. Biol Reprod 36: 677685.[Abstract]
Prasad PD, Malhotra P, Karande AA, and Adiga PR (1992) Isolation and characterization of riboflavin carrier protein from human amniotic fluid. Biochem Int 27: 385395.[Medline]
Rhodes MB, Bennett N, and Feeney RE (1959) The flavoprotein-apoprotein system of egg white. J Biol Chem 234: 20542060.
Sirotnak FM and Tolner B (1999) Carrier-mediated membrane transport of folates in mammalian cells. Annu Rev Nutr 19: 91122.[CrossRef][Medline]
Subramanian S and Adiga PR (1996) Hormonal modulation of riboflavin carrier protein secretion by immature rat Sertoli cells in culture. Mol Cell Endocrinol 120: 4150.[CrossRef][Medline]
Subramanian S and Adiga PR (1999) Immunological relatedness of chicken and human riboflavin carrier protein. Biochem Biophys Res Commun 262: 539544.[CrossRef][Medline]
van Dam EM, Ten Broeke T, Jansen K, Spijkers P, and Stoorvogel W (2002) Endocytosed transferrin receptors recycle via distinct dynamin and phosphatidylinositol 3-kinase-dependent pathways. J Biol Chem 277: 4887648883.
Visweswariah SS and Adiga PR (1987a) Isolation of riboflavin carrier proteins from pregnant human and umbilical cord serum: similarities with chicken egg riboflavin carrier protein. Biosci Rep 7: 563571.[CrossRef][Medline]
Visweswariah SS and Adiga PR (1987b) Purification of a circulatory riboflavin carrier protein from pregnant bonnet monkey (M. radiata): comparison with chicken egg vitamin carrier. Biochim Biophys Acta 915: 141148.[CrossRef][Medline]
Visweswariah SS and Adiga PR (1988) Estrogen modulation of riboflavin carrier protein in the bonnet monkey (Macaca radiata). J Steroid Biochem 31: 9196.[CrossRef][Medline]
Visweswariah SS, Karande AA, and Adiga PR (1987) Immunological characterization of riboflavin carrier proteins using monoclonal antibodies. Mol Immunol 24: 969974.[CrossRef][Medline]
Yanagishita M and Hascall VC (1985) Effects of monensin on the synthesis, transport and intracellular degradation of proteoglycans in rat ovarian granulosa cells in culture. J Biol Chem 260: 54455455.
Zanotti G and Berni R (2004) Plasma retinol-binding protein: structure and interactions with retinol, retinoids and transthyretin. Vitam Horm 69: 271295.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. B. Foraker, A. Ray, T. C. Da Silva, L. M. Bareford, K. M. Hillgren, T. D. Schmittgen, and P. W. Swaan Dynamin 2 Regulates Riboflavin Endocytosis in Human Placental Trophoblasts Mol. Pharmacol., September 1, 2007; 72(3): 553 - 562. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||