JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on December 13, 2005; DOI: 10.1124/jpet.105.095976


0022-3565/06/3171-53-60$20.00
JPET 317:53-60, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.105.095976v1
317/1/53    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xue, X.
Right arrow Articles by Fourie, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xue, X.
Right arrow Articles by Fourie, A.

INFLAMMATION AND IMMUNOPHARMACOLOGY

Anti-Inflammatory Activity in Vitro and in Vivo of the Protein Farnesyltransferase Inhibitor Tipifarnib

Xiaohua Xue, Kuei-Tai A. Lai, Jing-Feng Huang, Yin Gu, Lars Karlsson, and Anne Fourie

Alza/Johnson & Johnson Pharmaceutical Research & Development-La Jolla, San Diego, California

Received September 22, 2005; accepted December 8, 2005.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Protein farnesyltransferase inhibitors (FTIs) have shown clinical responses in hematologic malignancies, but the mechanisms are unclear. To better understand potential mechanisms of action, we have studied effects of the FTI tipifarnib on inflammatory responses in vitro and in vivo. In a human leukemia cell line THP-1, tipifarnib inhibited lipopolysaccharide (LPS)-induced transcription of chemokines [monocyte chemotactic protein (MCP)-1 and MCP-2], cytokines [interleukin (IL)-1beta, IL-6, and interferon (IFN)beta], signaling molecules (MyD88 and STAT-1), proteases [matrix metalloproteinase (MMP-9)], and receptors (urokinase receptor). Tipifarnib also inhibited LPS-induced secretion of MMP-9, IL-6, MCP-1, and IL-1beta in THP-1 cells. In primary human peripheral blood mononuclear cells, dose-dependent inhibition of LPS-induced tumor necrosis factor (TNF)-{alpha}, IL-6, MCP-1, and IL-1beta by tipifarnib was observed with no evidence of cytotoxicity. Similar results were obtained in vivo in a murine model of LPS-induced inflammation, where pretreatment with tipifarnib resulted in significant inhibition of TNF-{alpha}, IL-6, MCP-1, IL-1beta, and MIP-1{alpha} production. Tipifarnib had no effect in vitro or in vivo on LPS-induced IL-8. Studies in THP-1 cells to address potential mechanism(s) showed that tipifarnib partially inhibited LPS-induced p38 phosphorylation. Tipifarnib significantly inhibited inhibitory subunit of nuclear factor-{kappa}B (NF-{kappa}B) (I{kappa}B)-{alpha} degradation and p65 nuclear translocation induced by LPS, but not by tumor necrosis factor-{alpha}, IL-1{alpha}, or toll-like receptor (TLR)2 ligand, suggesting that the target for inhibition of NF-{kappa}B activation was exclusive to the LPS/TLR4 signal pathway. The extent of I{kappa}B-{alpha} degradation inhibition did not correlate with inhibition of Ras farnesylation, indicating that Ras was not the target for the observed anti-inflammatory activity of tipifarnib. Our findings differ from those for other FTIs, which may have relevance for their dissimilar activity in specific tumor repertoires.


The links between cancer and inflammation are well established (for review, see Balkwill et al., 2005Go). Many human and murine cancers are found in a microenvironment rich in cytokines, chemokines, and inflammatory enzymes. It is therefore of interest to investigate the effects of antitumor drugs on inflammation. Tipifarnib [R115777, Zarnestra, (R)-6-amino[(4-chlorophenyl)(1-methyl-1H-imidazol-5-yl)methyl]-4-(3-chlorophenyl)-1-methyl2(1H)-quinolinone)] is an orally active inhibitor of protein farnesyltransferase. It has shown significant antitumor activity and is currently in clinical trials for acute myeloid leukemia and myelodysplastic syndrome (Cortes, 2003Go). Farnesyltransferase is an enzyme that catalyzes the attachment of a farnesyl group, from farnesyl pyrophosphate, to the cysteine-thiol group of protein C-terminal CAAX consensus sequences (Moores et al., 1991Go; Reiss et al., 1991Go). A variety of cellular proteins are farnesylated (Schafer and Rine, 1992Go; Tamanoi et al., 2001Go), including Ras superfamily G proteins, nuclear lamins A and B, rhodopsin kinase, centromere-binding proteins CENP-E and CENP-F, cochaperone DnaJ/HDJ-2, prostacyclin receptor (O'Meara and Kinsella, 2004Go, 2005Go), and cytosolic phospholipase A2{gamma} (Jenkins et al., 2003Go). Ras farnesylation is critical for oncogenic Ras signaling (Kato et al., 1992Go), and Ras mutants are associated with ~30% of human cancers. Farnesyltransferase inhibitors (FTIs) were developed to prevent Ras farnesylation and cell membrane association and therefore block aberrant Ras function in cancer. However, further studies have shown that the response to FTIs does not correlate with Ras status, suggesting inhibition of farnesylation of other proteins might also contribute to the antitumor properties of FTIs (Cox and Der, 1997Go; Sebti and Hamilton, 2000Go).

Recently a FTI has been shown to inhibit TNF-{alpha}-induced NF-{kappa}B activation in vitro (Takada et al., 2004Go). Na et al. (2004Go) also showed inhibition by another FTI of LPS-induced NF-{kappa}B activation in vitro, and inducible nitric-oxide synthase, cyclooxygenase-2, TNF-{alpha}, and IL-1beta expression in vivo. These findings suggest that FTIs might have anti-inflammatory activity through affecting IL-1R/TLR/TNFR signaling. We tested the effect of tipifarnib on inflammatory responses induced by LPS. The results of our study demonstrated inhibition by tipifarnib of LPS induction of a number of inflammatory mediators, in vitro and in vivo. We present the first evidence for down-regulation by an FTI of LPS-induced MCP-1, IL-6, MMP-9, STAT1, MyD88, and MIP-1{alpha}. We also found that tipifarnib significantly inhibited I{kappa}B degradation and p65 translocation induced by LPS, but not by TNF-{alpha}, TLR2 ligand, or IL-1{alpha}. In addition, inhibition of Ras farnesylation did not correlate with the extent of inhibition of I{kappa}B degradation. The results of our study suggest that tipifarnib affected proinflammatory responses through inhibiting farnesylation of one or more proteins other than Ras that are involved in a pathway exclusive to LPS/TLR4 signaling.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Materials. General chemicals were purchased from Sigma-Aldrich (St. Louis, MO). Human THP-1 cells were obtained from the American Type Culture Collection (Manassas, VA). RPMI 1640 cell culture medium and penicillin-streptomycin were purchased from Sigma-Aldrich, and fetal bovine serum (FBS) was from Invitrogen (Carlsbad, CA). LPS, from Escherichia coli 026:B6, was obtained from Sigma-Aldrich. IL-1{alpha} and TNF-{alpha} were purchased from R&D Systems (Minneapolis, MN). Pam3CSK4, the synthetic lipoprotein, was purchased from InvivoGen (San Diego, CA).

Cell Culture, RNA Isolation, and Cytokine Analysis. THP-1 cells were cultured in RPMI 1640 medium containing 10% FBS, 100 units/ml penicillin, and 10 µg/ml streptomycin at 37°C under 5% CO2. Medium components were certified to contain less than 0.3 endotoxin unit/ml. For RNA isolation, THP-1 cells were cultured at 4.5 x 105/ml in 0.5% FBS/RPMI 1640 medium in the absence or presence of 100 ng/ml LPS plus or minus 5 µM tipifarnib. Cells were collected at 3, 6, and 12 h for total RNA isolation using the RNeasy mini kit from QIAGEN (Valencia, CA). For cytokine secretion studies, THP-1 cells at 3.4 x 105/ml were cultured in 96-well plates in 0.5% FBS/RPMI 1640 medium, in the absence or presence of 100 ng/ml LPS plus or minus tipifarnib. Supernatants were collected at different time points for analysis of cytokine production.

Microarray Experiments and Data Analysis. Five micrograms of total RNA was linearly amplified to double-stranded cDNA using T7-based amplification. The cDNA was purified using the QIAquick 96 PCR purification kit (QIAGEN) and used to generate amplified RNA using AmpliScribe T7 high-yield transcription kit (Epicenter Technologies, Madison, WI). Ten micrograms of purified amplified RNA was reverse transcribed to cDNA using the SuperScript RTII kit (Invitrogen) and labeled by direct incorporation of Cy3-dCTP. The generated cDNA probe was used for hybridizing to cDNA microarrays. The human cDNA microarrays were custom-made as described previously (Peterson et al., 2004Go) and contained approximately 8000 human genes and expressed sequence tags. RNA preparation, cDNA probe synthesis, and hybridization were performed as described by Shaw et al. (2003Go). Data normalization and preparation were performed as described previously (Peterson et al., 2004Go).

Reverse Transcriptase and Real-Time Quantitative Polymerase Chain Reaction. DNase-treated total RNA (2–3 µg) was reverse transcribed to cDNA using the Transcriptor first strand cDNA synthesis kit (Roche Diagnostics, Indianapolis, IN) according to the manufacturer's instructions. Real-time PCR was carried out with the LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche Diagnostics) according to the manufacturer's instructions. Real-time PCR reaction conditions were as follows. The 20-µl final volume contained 4 mM MgCl2, 0.5 µM of each primer, 2 µl of Master mix, and 2 µl of cDNA. The PCR profile was as follows: 1) denaturation at 95°C for 10 min; 2) 45 cycles of 0 s at 95°C, 5 s at 54–58°C (depending on Tm of the primers), 6 to 16 s (determined by the length of amplicon) at 72°C; 3) melting curves for 0 s at 95°C, 15 s at 65°C, and 0 s at 95°C; and 4) cooling at 40°C for 30 s. Transition rates were 20°C/s for all steps except 0.1°C/s for 95°C segment 3 of the melting curves. For data analysis, the baseline adjustment was carried out in the "arithmetic" mode, and the fluorescence curve analysis was carried out in the "Second Derivative Maximum" mode of the LightCycler software (version 3.5). The primers used for real-time PCR were as follows (5' to 3'): IL-1beta: sense, GGATAACGAGGCTTATGTGCACG and antisense, GGACATGGAGAACACCACTTGTTG; MCP-1: sense, AGCCAGATGCAATCAATGCCC and antisense, CCTTGGCCACAATGGTCTTGAA; MMP-9: sense, ACCGCTATGGTTACACTCGG and antisense, AGGGACCACAACTCGTCATC; IL-8: sense, CTGATTTCTGCAGCTCTGTGTGAA and antisense, TGGCATCTTCACTGATTCTTGGA; STAT1: sense, TTCAGAGCTCGTTTGTGGTG and antisense, AGAGGTCGTCTCGAGGTCAA; MyD88: sense, TGGGACCCAGCATTGAGGAGGATT and antisense, AAACTGGATGTCGCTGGGGCAA; and IL-6 sense, TGGATTCAATGAGGAGACTTGC and antisense, CAGGAACTGGATCAGGACTT.

Human PBMC Isolation. Venous blood was drawn from healthy donors and treated with heparin. PBMCs were isolated by density-gradient sedimentation on Ficoll-Paque (Amersham Biosciences Inc., Piscataway, NJ). PBMCs were washed twice with PBS, resuspended in RPMI 1640 cell culture medium, and then plated at 3 x 105 per well in 96-well plates and incubated at 37°C under 5% CO2 for 2 h. Then, cells were pretreated with tipifarnib at 2 and 5 µM for 1 h, followed by incubation with 10 ng/ml LPS for 16 h. The supernatants were collected for cytokine assay. The groups of untreated and LPS-treated only cells were also included.

In Vivo Experiments. The experiments were performed on female BALB/c mice (6–7 weeks old; Charles River Laboratories, Inc., Wilmington, MA) after review of the protocol and approval by the Institutional Animal Care and Use Committee. Tipifarnib was dissolved in 20% cyclodextran, and 50 mg/kg was orally administered to mice at 24, 17, and 1 h before intraperitoneal injection of 20 µg of LPS per mouse, 1 mg/kg. Control mice received vehicle (20% cyclodextran) only. Blood samples were collected by eye bleeding or cardiac puncture at 2 and 3 h after LPS injection. Plasma samples were tested for cytokines using individual ELISA kits (R&D Systems) or Luminex analysis (Luminex Corporation, Austin, TX), according to the manufacturers' instructions.

SDS-Polyacrylamide Gel Electrophoresis and Western Blot Analysis. THP-1 cells in 0.5% FBS/RPMI 1640 medium were pretreated with or without tipifarnib for 18 h and subsequently stimulated with 100 ng/ml LPS, 10 ng/ml TNF-{alpha}, 5 ng/ml IL-1{alpha}, or 1 µg/ml Pam3CSK4 for 30 min. Cells were harvested, washed three times in ice-cold PBS, and lysed in lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride). Nuclear extracts were prepared using the NE-PER kit (Pierce Chemical, Rockford, IL). Cytoplasmic or nuclear lysates from each sample were mixed with an equal amount of 2x SDS-polyacrylamide gel electrophoresis sample buffer (Invitrogen). Proteins were separated by electrophoresis in Tris-glycine 10 to 20% gradient gels (Novex, San Diego, CA), and transferred to nitrocellulose membranes (Protran; Schleicher & Schuell, Keene, NH). The membranes were blocked with 3% bovine serum albumin in PBS-0.05% Tween 20 and sequentially incubated with primary antibodies and horseradish peroxidase-conjugated secondary antibodies (anti-rabbit IgG or anti-mouse IgG and IgM; Pierce), followed by ECL detection (Amersham Biosciences Inc.). The primary antibodies used were rabbit polyclonal anti-I{kappa}B{alpha}, -p65, and -p38 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), mouse monoclonal anti-H-Ras (Chemicon International, Temecula, CA), mouse monoclonal anti-phospho-p38, rabbit polyclonal anti-phospho-ERK, and anti-total ERK (Cell Signaling Technology Inc., Beverly, MA).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Effect of Tipifarnib on LPS-Induced Gene Transcription. Initial analysis of global effects for tipifarnib on transcription of inflammatory genes was performed by cDNA microarray analysis of RNA samples from THP-1 cells, treated with LPS, in the presence or absence of tipifarnib. Of 94 genes showing at least 1.5-fold induction by LPS at two time points, 23 showed at least a 1.5-fold decrease in LPS-induced transcripts by tipifarnib at one or more time points (Fig. 1). Included in the genes down-regulated by the drug were chemokines (MCP-1 and -2), cytokines (IL-1beta and IFNbeta), signaling molecules (MyD88 and STAT-1), receptors (urokinase receptor), and proteases (MMP-9).


Figure 1
View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Microarray analysis of the effect of tipifarnib on LPS-induced genes. THP-1 cells were cultured in the absence (no treatment) or presence of 100 ng/ml LPS plus or minus 5 µM tipifarnib. RNA was isolated at the indicated times for cDNA preparation as described under Materials and Methods. Genes were selected as LPS-induced if the ratio between LPS-treated and nontreated samples was greater than 1.5-fold, at more than two time points. Gene expression during treatment with LPS and the FTI (tipifarnib/LPS) was compared with LPS alone at the corresponding time points. Genes that showed at least a 1.5-fold decrease in induction by tipifarnib at one or more time points were selected for inclusion in the figure. -Fold change values between LPS-treated and nontreated samples are listed and colored in orange for greater than 1.5-fold higher expression and in red for greater than 2-fold higher expression. -Fold change values between tipifarnib/LPS and LPS are listed and colored in light blue for more than 1.5-fold lower expression and in dark blue for more than 2-fold lower expression. The results are representative of two separate experiments.

 
The results of the microarray analysis were confirmed for selected genes by real-time PCR analysis (Fig. 2). Transcription of IL-1beta was induced by LPS as early as 3 h, and the induction was unaffected by tipifarnib up to this time point. However, after 6 h and, to a greater extent, after 12 h, the LPS-dependent induction was decreased by tipifarnib (Fig. 2a). MCP-1 was induced by LPS from 6 h, and this induction was inhibited significantly by tipifarnib (Fig. 2b). MMP-9 induction by LPS increased up to 12 h and was abolished by treatment of tipifarnib (Fig. 2c). In the case of IL-8, induction by LPS was evident as early as 3 h, and the FTI showed no significant effect on this induction (Fig. 2d). STAT1 induction was inhibited by tipifarnib at 6 and 12 h (Fig. 2e). Myeloid differentiation factor MyD88, the adaptor for Toll-like receptor-mediated responses, was significantly up-regulated by LPS at 6 and 12 h, and this was almost completely inhibited by tipifarnib (Fig. 2f). Although microarray data for IL-6 transcription did not meet the criteria for inclusion in Fig. 1, analysis by quantitative real-time PCR clearly showed inhibition by tipifarnib of LPS-induced IL-6 transcription at 6 and 12 h (Fig. 2g). Thus, tipifarnib was able to inhibit LPS induction of numerous inflammatory genes.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. The effect of tipifarnib on LPS-induced transcription of IL-1beta (a), MCP-1 (b), MMP-9 (c), IL-8 (d), STAT1 (e), MyD88 (f), and IL-6 (g). THP-1 cells were cultured in the absence (no treatment) or presence of 100 ng/ml LPS plus or minus 5 µM tipifarnib. RNA was isolated at the indicated times for cDNA preparation as described under Materials and Methods. Relative mRNA levels compared with glyceraldehyde-3-phosphate dehydrogenase were determined by real-time PCR. The results are representative of two separate experiments.

 

Effect of Tipifarnib on LPS-Induced Cytokine and MMP-9 Production. To further investigate the effects of tipifarnib at the protein level, cytokine and MMP-9 secretion by THP-1 cells in response to LPS was examined. Cells were treated with a range of concentrations of tipifarnib in the presence and absence of LPS. Tipifarnib showed dose-dependent inhibition of MMP-9 and IL-6 secretion, reaching greater than 50% inhibition for both mediators at 2 µM (Fig. 3). This concentration was chosen to examine the effects of tipifarnib treatment on LPS-induced inflammatory mediators at different times over a 48-h period. Tipifarnib showed significant inhibition as early as 20 h for MCP-1 and IL-6 and 30 h for IL-1beta and MMP-9 (Fig. 4). Tipifarnib showed no significant inhibition of IL-8 production, consistent with the lack of effect for tipifarnib on IL-8 transcription (Fig. 2d). LPS-induced TNF-{alpha} also showed a trend toward reduction after treatment by tipifarnib for 20 h (not shown), although the production of TNF-{alpha} by THP-1 cells was low and the inhibition did not reach statistical significance. At 2 µM, tipifarnib had no effect on cell viability or growth up to 48 h (trypan blue exclusion; data not shown), as was also evident from the lack of inhibition of continuous IL-8 secretion.


Figure 3
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Dose-dependent effect of tipifarnib on LPS-induced MMP-9 (a) and IL-6 (b) secretion. THP-1 cells were cultured in the absence (no treatment) or presence of 100 ng/ml LPS plus or minus tipifarnib at concentrations starting from 5 µM and 3-fold serial dilutions down to 0.06 µM. After 48 h, supernatants were collected for ELISA assays. Percentage of control of protein secretion by tipifarnib is determined by comparing LPS/tipifarnib-treated with LPS-treated cells only. Values are presented as the mean ± S.D. for triplicate wells.

 

Figure 4
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. The effect of tipifarnib on LPS-induced secretion of MCP-1 (a), IL-6 (b), IL-1beta (c), IL-8 (d), and MMP-9 (e). THP-1 cells were cultured in the absence (no treatment) or presence of 100 ng/ml LPS plus or minus 2 µM tipifarnib. At the indicated time points, supernatants were analyzed for cytokines, chemokines, or MMP-9 by ELISA. Data points are means ± S.D. for triplicate wells (*, P < 0.05; **, P < 0.01, by Student's t test.) The results are representative of three separate experiments.

 

Effect of Tipifarnib on LPS-Induced Cytokine Production in Human PBMCs. We also tested the effect of tipifarnib on primary human PBMCs. PBMCs were pretreated with tipifarnib at 2 and 5 µM for 1 h, followed by incubation with LPS for 16 h. Tipifarnib inhibited LPS-induced TNF-{alpha}, IL-1beta, and MCP-1 significantly at both 2 and 5 µM. IL-6 was significantly inhibited at 5 µM, whereas IL-8 inhibition did not reach statistical significance at either concentration (Fig. 5). Tipifarnib showed no inhibition of LPS-induced IL-10 secretion (data not shown). In the same experiment, the effect of tipifarnib at 2 and 5 µM on PBMC viability was also tested by measuring mitochondrial dehydrogenase activity, using a 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide assay (XTT), and no significant cytotoxicity was observed (data not shown).


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5. The effect of tipifarnib on LPS-induced cytokine secretion by human PBMCs. PBMCs were isolated and preincubated in the absence (no treatment) or presence of 2 and 5 µM tipifarnib for 1 h. Cells were then treated with 10 ng/ml LPS for 16 h. Supernatants were analyzed for cytokines by ELISA. Values are presented as the means ± S.D. for triplicate wells (*, P < 0.05; **, P < 0.01, by Student's t test). The results are representative of three separate experiments.

 

Effect of Tipifarnib on LPS-Induced Cytokine Production in Vivo. To follow-up on our in vitro observations, we tested the effect of tipifarnib pretreatment in a murine model of LPS-induced inflammation. The mice were pretreated for 24 h with the compound by oral administration at three time points: 24, 17, and 1 h before LPS injection. Blood samples were taken 2 and 3 h after LPS injection for analysis.

As shown in Fig. 6, the most striking effect of the FTI was its highly significant inhibition of LPS-induced TNF-{alpha} production at 2 h. Approximately 50% inhibition of IL-6 production, and almost complete inhibition of IL-1beta production, was observed in tipifarnib-treated animals after 3 h. Approximately 50% inhibition of MIP-1{alpha} and MCP-1 production by the FTI was observed at 2 h. IL12-p40 and -p70 induction by LPS was also inhibited by tipifarnib at 3 h, whereas IL-10 was not significantly changed at both time points (data not shown). No effects of tipifarnib on LPS-induced KC were observed, consistent with in vitro results for IL-8. Overall, the results show significant down-regulation by tipifarnib of numerous LPS-induced cytokines and chemokines in vivo.


Figure 6
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. The effect of tipifarnib on LPS-induced cytokine production in vivo. BALB/c mice (n = 4 or 5 per group) were treated orally with tipifarnib in 20% cyclodextran at a dose of 50 mg/kg 24, 17, and 1 h before LPS injection. LPS at 20 µg or 1 mg/kg was administered intraperitoneally. Plasma samples were collected at 2 and 3 h after LPS injection and tested for cytokines using ELISA or Luminex as described under Materials and Methods. Data are presented as the mean ± S.D. (*, P < 0.05; **, P < 0.01, by Student's t test.) The results are representative of two separate experiments.

 
Effect of Tipifarnib on TLR/IL-1R Ligand and TNF-{alpha}-Induced Signaling. It was recently reported that TNF-{alpha} induced NF-{kappa}B activity was inhibited by another FTI (SCH 66336) (Takada et al., 2004Go). To compare the effects of tipifarnib to this finding, we tested TNF-{alpha}-induced NF-{kappa}B activation by luciferase reporter activity in human embryonic kidney 293 cells. Cells were treated with tipifarnib overnight, followed by stimulation with TNF-{alpha} for 4 h. In contrast to the results reported for SCH 66336, TNF-{alpha}-induced NF-{kappa}B activity was not inhibited by tipifarnib at 2 or 5 µM (data not shown). We further examined the effect of tipifarnib on several signaling pathways in THP-1 cells. Cells were pretreated with 2 µM tipifarnib for 18 h and then stimulated with LPS or TNF-{alpha} for 30 min. Cell lysates were tested for p38 expression and p38 phosphorylation by Western blot analysis. Phosphorylation of p38 was significantly increased by LPS and TNF-{alpha} stimulation, but only the LPS-induced increase was partially reduced by tipifarnib treatment (Fig. 7a). No significant inhibition was observed for TNF-{alpha} induced p38 phosphorylation. p38 protein expression was not affected by LPS or TNF-{alpha} stimulation and/or tipifarnib treatment.


Figure 7
View larger version (47K):
[in this window]
[in a new window]
 
Fig. 7. Effect of tipifarnib on TLR/IL-1R ligands and TNF-{alpha}-induced signaling. THP-1 cells were cultured in the absence or presence of 2 µM tipifarnib for 18 h and then incubated with LPS and TNF-{alpha} (a); LPS, TNF-{alpha}, and IL-1{alpha} (b); or Pam3CSK4, LPS, and TNF-{alpha} (c) for 30 min. Cytoplasmic lysates or nuclear extracts (only for p65) were analyzed by Western blotting using antibodies against p38, phosphorylated p38, total ERK1/2, phospho-ERK1/2, I{kappa}B, p65, and H-Ras as described under Materials and Methods (U, unprocessed; P, processed).

 

As shown in Fig. 7, b and c (top), I{kappa}B-{alpha} degradation was significantly induced by TLR/IL-1R ligands (LPS, Pam3CSK4, and IL-1{alpha}) and TNF-{alpha}. Interestingly, tipifarnib significantly inhibited LPS-induced I{kappa}B degradation (Fig. 7b, lane 4; c, lane 6) but showed no inhibition of I{kappa}B degradation induced by TNF-{alpha} or IL-1{alpha} (Fig. 7b) or by Pam3CSK4 (Fig. 7c). We further determined the effect of tipifarnib on NF-{kappa}B translocation by immunoblotting of p65 in nuclear extracts. Tipifarnib almost completely suppressed nuclear translocation of p65 induced by LPS but not that induced by TNF-{alpha} and Pam3CSK4 (Fig. 7c, bottom).

The level of ERK phosphorylation was similar in cells treated with different stimuli, and tipifarnib pretreatment reduced the ERK phosphorylation to a similar extent under all conditions, without affecting the level of total ERK protein (Fig. 7b, middle). We also examined the effect of tipifarnib on H-Ras farnesylation (Fig. 7b, bottom). The level of farnesylated (or processed) H-Ras was not significantly changed in the absence or presence of inflammatory stimuli. Tipifarnib partially inhibited H-Ras farnesylation, as shown by the presence of unprocessed Ras, to the same degree in the different treatment groups, and this inhibition correlated with the extent of inhibition of ERK phosphorylation (Fig. 7b, second panel).


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we investigated the anti-inflammatory activity of the FTI, tipifarnib, both in vitro and in vivo. Tipifarnib demonstrated inhibition of both transcription and secretion of IL-6, IL-1beta, MCP-1, and MMP-9 induced by LPS treatment of THP-1 cells as well as dose-dependent inhibition of LPS-induced TNF-{alpha}, MCP-1, IL-1beta, and IL-6 production in primary human PBMCs, without any evidence for cytotoxicity. We also observed inhibition by tipifarnib in THP-1 cells of LPS-induced MyD88 and STAT1 transcription, providing the first evidence for a role of farnesyltransferase in regulation of these genes. Global anti-inflammatory effects of tipifarnib were also observed in vivo, including down-regulation of LPS-induced TNF-{alpha}, IL-6, MCP-1, IL-1beta, and MIP-1{alpha}.

Tipifarnib had contrasting effects between LPS-induced IL-8 and other mediators both in THP-1 and human PBMCs. No inhibition of LPS-induced IL-8 transcription or secretion was observed in our studies for tipifarnib, at concentrations that were highly effective at inhibiting IL-1beta, IL-6, and MCP-1 production. Consistent with the in vitro data, no inhibition of production of the murine homolog KC was observed in vivo. The results suggest that the target(s) of tipifarnib may be less crucial for optimal expression of IL-8 than for that of other cytokines or chemokines.

A recent study has shown inhibition in vitro and in vivo of LPS-induced nitric oxide, prostaglandin E2, TNF-{alpha}, and IL-1beta by the FTI LB42708 (Na et al., 2004Go). Our present study represents the first observation of FTI-mediated inhibition of LPS-induced IL-6, MCP-1, and MIP-1{alpha} in vivo. We also observed inhibition in vivo by tipifarnib of LPS-induced IL12-p40 and -p70. Although Na et al. (2004Go) showed inhibition by LB42708 of TNF-{alpha} and IL-1beta production in vivo, the LPS-induced cytokine levels were 10- to 100-fold lower than we obtained. The cytokines were measured 12 h after LPS administration in their study (Na et al., 2004Go), which is long after the peak between 1 and 3 h for LPS-induced TNF{alpha} and IL-1beta in this model. We also investigated the effect of tipifarnib on IL-10, which is known as an anti-inflammatory mediator, and have shown that tipifarnib had no effect on LPS-induced IL-10 production, both in human PBMCs and in vivo.

Inhibition of inflammatory mediators by tipifarnib seemed to require pretreatment time. For example, cytokines such as IL-1beta showed significant transcriptional induction by LPS as early as 3 h in vitro. When drug treatment was started at the same time as the LPS stimulation, the earliest signs of transcriptional inhibition were only observed after 6 h and of cytokine release only after 22 h. In contrast, when animals were pretreated with the drug for 24 h before LPS challenge in vivo, inhibition of cytokine release could be observed as early as 1 h after the challenge (data not shown). The lag time in the inhibition of inflammatory responses may indicate a requirement to deplete intracellular pools of particular prenylated proteins.

Previous animal studies with tipifarnib have shown inhibition of cachexia in a tumor xenograft model and reduction of disease scores in dextran sodium sulfate-induced colitis and collagen-induced arthritis, but the mechanism for these effects was unknown (David End, unpublished observations). The major roles of TNF-{alpha}, IL-6, and IL-1beta in the pathogenesis of these diseases suggest that their inhibition by tipifarnib may have been responsible for the observed amelioration. Although we did not measure the plasma concentrations of tipifarnib at which we observed inhibition of inflammatory mediators in vivo, the doses where we observed anti-inflammatory effects in the LPS-induced inflammation model were similar to those used previously for tumoricidal effects in mouse xenograft studies (End et al., 2001Go).

It is of interest to note that in phase I studies with tipifarnib (300–900 mg/day) in myelodysplastic syndrome, the only correlation with positive response to treatment was a 42% median decrease in serum levels of TNF-{alpha} (Kurzrock et al., 2003Go). Tipifarnib, 300 mg twice a day, was the maximum tolerated dose in a number of studies (Head and Johnston, 2003Go). At this dose, plasma levels reached approximately 2 µM (Karp et al., 2001Go), at which concentration significant inhibition of inflammation was obtained in vitro in our present study. Thus, sufficient plasma concentrations of tipifarnib for anti-inflammatory effects were reached in clinical trials where positive responses were observed, but existing data are insufficient to allow any direct correlation.

To explore the underlying mechanism for the anti-inflammatory activity of tipifarnib, we examined the effect of tipifarnib on different proinflammatory signaling pathways. The FTI SCH 66336 was previously shown to inhibit TNF-{alpha}-induced I{kappa}B-{alpha} phosphorylation, degradation, and NF-{kappa}B activity (Takada et al., 2004Go). However, in our study, tipifarnib did not affect TNF-{alpha} induced NF-{kappa}B activity as measured by a luciferase reporter assay. Tipifarnib also showed no inhibition of TNF-{alpha} induced I{kappa}B-{alpha} degradation or NF-{kappa}B nuclear translocation in THP-1 cells. Similarly, tipifarnib did not inhibit TNF-{alpha}-induced p38 phosphorylation. The reason for the lack of inhibition of TNF-mediated signaling by tipifarnib, in contrast to SCH 66336 is not clear, but it is interesting to note that these two FTIs have also shown different efficacy in clinical trials for different tumor types.

The Ras/Raf/mitogen-activated protein kinase pathway has been well studied. GTP-bound Ras binds to Raf, causing Raf activation and relocation to plasma membrane. Activated Raf phosphorylates and activates MEK1 and MEK2, and MEK1/2 phosphorylates and activates ERK1/2. We found that tipifarnib partially inhibited ERK1/2 phosphorylation and that the extent of inhibition correlated with inhibition of Ras farnesylation, both in the absence and in the presence of inflammatory stimuli. These data confirm that tipifarnib suppresses ERK1/2 phosphorylation through inhibition of Ras farnesylation.

LPS, Pam3CSK4, IL-1, and TNF-{alpha} each interact with their own receptors to trigger the corresponding inflammatory signaling cascades (Fig. 8). TNF-{alpha} signaling links to IKK through TNFR/receptor interacting protein (Aggarwal, 2003Go). LPS/TLR4, Pam3CSK4/TLR2, and IL-1/IL-1R signaling all link to IKK through the shared MyD88/IL-1 receptor-associated kinase (IRAK)/TRAF6/transforming growth factor-beta-activated kinase (TAK) pathway (Akira and Takeda, 2004Go). IKK phosphorylates I{kappa}B, which leads to the ubiquitination and degradation of I{kappa}B, and thus enables the translocation of NF-{kappa}B to the nucleus and induction of target gene expression such as TNF-{alpha}, IL-1beta, IL-6, and others. Besides the common MyD88-dependent pathway shared with IL-1R and TLR2, the interaction of LPS and TLR4 also induces I{kappa}B degradation through MyD88-independent pathways, e.g., through TIR domain-containing adaptor protein inducing IFN-beta (TRIF) and TRIF-related adaptor molecule (TRAM) (Akira and Takeda, 2004Go). We found that tipifarnib inhibited I{kappa}B-{alpha} degradation induced by LPS, but not by TNF-{alpha}, Pam3CSK4, or IL-1, suggesting that the target protein for tipifarnib is not involved in TLR2/IL-1R and TNFR signal pathways, but it is involved in a pathway exclusive to LPS/TLR4 signaling.


Figure 8
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Proposed target(s) for tipifarnib inhibition of LPS-induced inflammatory signaling pathways. Signals from TLR/IL-R through the MyD88-dependent pathway or from TNFR1 through receptor interacting protein/MEKK induce the activation of the IKK complex. IKK phosphorylates I{kappa}B, inducing its degradation, which enables translocation of NF-{kappa}B to the nucleus and induction of target gene expression. LPS binding to TLR4 also induces activation of NF-{kappa}B through MyD88-independent pathways. The data in the present study suggest that the target for anti-inflammatory effects of tipifarnib is a component of pathways exclusive to LPS/TLR4 signaling, as indicated in bold (TLR2-L, TLR2 ligands).

 
A recent study has shown that Ras is involved in CpG oligonucleotide signaling as an early event, by associating with TLR9 and promoting IL-1 receptor-associated kinase/TRAF6 complex formation (Xu et al., 2003Go). Another study has shown that Ras controls TRAF6-dependent induction of NF-{kappa}B (Caunt et al., 2001Go). We found that inhibition of Ras farnesylation was consistently observed in control, LPS-, IL-1{alpha}-, and TNF-{alpha}-treated cells, but inhibition of I{kappa}B-{alpha} degradation and NF-{kappa}B translocation was only observed in the LPS-treated cells. This lack of correlation between inhibition of Ras farnesylation and inhibition of NF-{kappa}B signaling indicates that Ras is unlikely to be the target protein mediating the anti-inflammatory effects of tipifarnib. Candidate targets for tipifarnib could be the function or expression of TLR4 itself, or associated proteins such as CD14 or myeloid differentiation protein-2, or other molecules unique to the LPS signaling pathway, either upstream or independent of MyD88.

In conclusion, we present the first evidence for anti-inflammatory effects of the FTI tipifarnib and expand and highlight the potential for farnesyltransferase inhibition as a therapeutic approach to inflammation. We show inhibition by tipifarnib of a number of LPS-induced genes not previously known to be dependent on protein farnesylation. In particular, tipifarnib inhibited LPS induction of MCP-1, IL-6, MMP-9, MIP-1{alpha}, STAT1, and MyD88 in addition to TNF-{alpha} and IL-1beta, all of which have been implicated in inflammatory diseases. Our data suggest that the target protein for these effects of tipifarnib is likely to be a component of the TLR4 pathway, upstream or independent of MyD88, and is unlikely to be Ras, in contrast to the conclusions of Na et al. (2004Go) for the FTI LB42708. Elucidation of the identity of the target protein or proteins may provide new targets for anti-inflammatory therapy. Furthermore, some of the therapeutic efficacy of FTIs in cancer may be related to inhibition of inflammatory mediators, which have been shown to contribute to cancer progression.


    Footnotes
 
ABBREVIATIONS: FTI, farnesyltransferase inhibitor; TNF, tumor necrosis factor; LPS, lipopolysaccharide; NF-{kappa}B, nuclear factor-{kappa}B; IL, interleukin; IL-1R, interleukin-1 receptor; TLR, toll-like receptor; TNFR, tumor necrosis factor receptor; MCP, monocyte chemotactic protein; MMP, matrix metalloproteinase; STAT, signal transducer and activator of transcription; MIP, macrophage inflammatory protein; I{kappa}B, inhibitory subunit of NF-{kappa}B; FBS, fetal bovine serum; PCR, polymerase chain reaction; PBMC, peripheral blood mononuclear cell; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; IFN, interferon; ERK, extracellular signal-regulated kinase; SCH 66336, 4-(2-(4-(8-chloro-3,10-dibromo-6,11-dihydro-5H-benzo-(5,6)-cyclohepta(1,2-b)-pyridin-11(R)-yl)-1-piperidinyl)-2-oxo-ethyl)-1-piperidinecarboxamide; MEK, mitogen-activated protein kinase kinase; IKK, I{kappa}B kinase; TRAF6, tumor necrosis factor receptor-associated factor 6; Pam3CSK, N-palmitoyl-S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-[R]-Cys-[S]-Ser-[S]-Lys (4) trihydrochloride; LB 42708, 4-[[1-[[1-[(4-bromophenyl)methyl]-1H-imidazol-5-yl]methyl]-4-(1-napthalenyl)-1H-pyrrol-3-yl]carbonyl]-(9C1)-morpholine.

doi:10.1124/jpet.105.095976.

Address correspondence to: Dr. Anne Fourie, 3210 Merryfield Row, San Diego, CA 92121-1126. E-mail: afourie{at}prdus.jnj.com


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Aggarwal B (2003) Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol 3: 745–756.[CrossRef][Medline]

Akira S and Takeda K (2004) Toll-like receptor signalling. Nat Rev Immunol 4: 499–511.[CrossRef][Medline]

Balkwill F, Charles KA, and Mantovani A (2005) Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell 7: 211–217.[CrossRef][Medline]

Caunt CJ, Kiss-Toth E, Carlotti F, Chapman R, and Qwarnstrom EE (2001) Ras controls tumor necrosis factor receptor-associated factor (TRAF)6-dependent induction of nuclear factor-kB. Selective regulation through receptor signaling components. J Biol Chem 276: 6280–6288.[Abstract/Free Full Text]

Cortes J (2003) Farnesyltransferase inhibitors in acute myeloid leukemia and myelodysplastic syndromes. Clin Lymphoma 4: S30–S35.[Medline]

Cox AD and Der CJ (1997) Farnesyltransferase inhibitors and cancer treatment: targeting simply Ras? Biochim Biophys Acta 1333: F51–F71.[Medline]

End DW, Smets G, Todd AV, Applegate TL, Fuery CJ, Angibaud P, Venet M, Sanz G, Poignet H, Skrzat S, et al. (2001) Characterization of the antitumor effects of the selective farnesyl protein transferase inhibitor R115777 in vivo and in vitro. Cancer Res 61: 131–137.[Abstract/Free Full Text]

Head JE and Johnston SR (2003) Protein farnesyltransferase inhibitors. Expert Opin Emerg Drugs 8: 163–178.[CrossRef][Medline]

Jenkins CM, Han X, Yang J, Mancuso DJ, Sims HF, Muslin AJ, and Gross RW (2003) Purification of recombinant human cPLA2 gamma and identification of C-terminal farnesylation, proteolytic processing and carboxymethylation by MALDI-TOF-TOF analysis. Biochemistry 42: 11798–11807.[CrossRef][Medline]

Karp JE, Lancet JE, Kaufmann SH, End DW, Wright JJ, Bol K, Horak I, Tidwell ML, Liesveld J, Kottke TJ, et al. (2001) Clinical and biologic activity of the farnesyltransferase inhibitor R115777 in adults with refractory and relapsed acute leukemias: a phase 1 clinical-laboratory correlative trial. Blood 97: 3361–3369.[Abstract/Free Full Text]

Kato K, Cox AD, Hisaka MM, Graham SM, Buss JE, and Der CJ (1992) Isoprenoid addition to Ras protein is the critical modification for its membrane association and transforming activity. Proc Natl Acad Sci USA 89: 6403–6407.[Abstract/Free Full Text]

Kurzrock R, Kantarjian HM, Cortes JE, Singhania N, Thomas DA, Wilson EF, Wright JJ, Freireich EJ, Talpaz M, and Sebti SM (2003) Farnesyltransferase inhibitor R115777 in myelodysplastic syndrome: clinical and biologic activities in the phase 1 setting. Blood 102: 4527–4534.[Abstract/Free Full Text]

Moores SL, Schaber MD, Mosser SD, Rands E, O'Hara MB, Garsky VM, Marshall MS, Pompliano DL, and Gibbs JB (1991) Sequence dependence of protein isoprenylation. J Biol Chem 266: 14603–14610.[Abstract/Free Full Text]

Na HJ, Lee SJ, Kang YC, Cho YL, Nam WD, Kim PK, Ha KS, Chung HT, Lee H, Kwon YG, et al. (2004) Inhibition of farnesyltransferase prevents collagen-induced arthritis by down-regulation of inflammatory gene expression through suppression of p21(ras)-dependent NF-kappaB activation. J Immunol 173: 1276–1283.[Abstract/Free Full Text]

O'Meara SJ and Kinsella BT (2004) Investigation of the effect of the farnesyl protein transferase inhibitor R115777 on isoprenylation and intracellular signalling by the prostacyclin receptor. Br J Pharmacol 143: 318–330.[CrossRef]

O'Meara SJ and Kinsella BT (2005) The effect of the farnesyl protein transferase inhibitor SCH66336 on isoprenylation and signalling by the prostacyclin receptor. Biochem J 386: 177–189.[CrossRef][Medline]

Peterson KS, Huang JF, Zhu J, D'Agati V, Liu X, Miller N, Erlander MG, Jackson MR, and Winchester RJ (2004) Characterization of heterogeneity in the molecular pathogenesis of lupus nephritis from transcriptional profiles of laser-captured glomeruli. J Clin Investig 113: 1722–1733.[CrossRef][Medline]

Reiss Y, Stradley SJ, Gierasch LM, Brown MS, and Goldstein JL (1991) Sequence requirement for peptide recognition by rat brain p21ras protein farnesyltransferase. Proc Natl Acad Sci USA 88: 732–736.[Abstract/Free Full Text]

Schafer WR and Rine J (1992) Protein prenylation: genes, enzymes, targets and functions. Annu Rev Genet 26: 209–237.[Medline]

Sebti SM and Hamilton AD (2000) Farnesyltransferase and geranylgeranyltransferase I inhibitors and cancer therapy: lessons from mechanism and bench-to-bedside translational studies. Oncogene 19: 6584–6593.[CrossRef][Medline]

Shaw KJ, Miller N, Liu X, Lerner D, Wan J, Bittner A, and Morrow BJ (2003) Comparison of the changes in global gene expression of Escherichia coli induced by four bactericidal agents. J Mol Microbiol Biotechnol 5: 105–122.[CrossRef][Medline]

Takada Y, Khuri FR, and Aggarwal BB (2004) Protein farnesyltransferase inhibitor (SCH 66336) abolishes NF-kappaB activation induced by various carcinogens and inflammatory stimuli leading to suppression of NF-kappaB-regulated gene expression and up-regulation of apoptosis. J Biol Chem 279: 26287–26299.[Abstract/Free Full Text]

Tamanoi F, Kato-Stankiewicz J, Jiang C, Machado I, and Thapar N (2001) Farnesylated proteins and cell cycle progression. J Cell Biochem Suppl 37: 64–70.[Medline]

Xu H, An H, Yu Y, Zhang M, Qi R, and Cao X (2003) Ras participates in CpG oligodeoxynucleotide signaling through association with toll-like receptor 9 and promotion of interleukin-1 receptor-associated kinase/tumor necrosis factor receptor-associated factor 6 complex formation in macrophages. J Biol Chem 278: 36334–36440.[Abstract/Free Full Text]



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.105.095976v1
317/1/53    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xue, X.
Right arrow Articles by Fourie, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xue, X.
Right arrow Articles by Fourie, A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition