![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL
Department of Pharmacology, Program in Pharmacogenomics, College of Medicine and Public Health, The Ohio State University, Columbus, Ohio (P.A., J.P., W.S.); Institut Suisse de Recherche Expérimentale sur le Cancer, Epalinges, Switzerland (P.A.); Molecular Biopharmaceutics, Department of Pharmaceutics and Analytical Chemistry, The Danish University of Pharmaceutical Sciences, Copenhagen, Denmark (C.U.N., P.L.K., B.B.); and Plasma Membrane Transporter Group, Department of Biopharmaceutical Sciences, University of California San Francisco, San Francisco, California (W.S.)
Received August 24, 2005; accepted October 27, 2005.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
; Han et al., 1998). Bioavailability of the prodrug L-valacyclovir (VAC) is substantially increased by PEPT1 transport activity.
Response to drug therapy varies in patients, in part because of genetic differences among individuals. Polymorphisms of drug receptors, metabolizing enzymes, and transporters each can affect therapeutic efficacy (Licinio and Wong, 2002). Whereas the effect of genetic variants has been well documented for drug-metabolizing enzymes, drug transporters have been less thoroughly studied (Dai and Sadee, 2005). Yet, recent results demonstrate a pervasive role for genetic variants of several membrane transporters, such as multidrug-resistant protein 1 (Hoffmeyer et al., 2000). For the PEPT1 substrate VAC, a significantly larger interindividual than intraindividual variability in intestinal absorption suggests the presence of genetic factors, potentially involving PEPT1 (Phan et al., 2003). In a previous sequencing study of PEPT1 involving 44 ethnically diverse individuals, 13 SNPs had been located in the coding region of PEPT1 (Zhang et al., 2004). Functional characterizations of the nine nonsynonymous SNPs revealed that only one rare variant had reduced transport activity as a result of reduced protein expression. The UCSF Membrane Transporter Group had also performed a more extensive sequence analysis of PEPT1, of which the results are publicly available (http://pharmacogenetics.ucsf.edu/set1/index.html#SLC15A1). We had independently prepared mutant PEPT1 plasmids for functional in vitro analysis based on these more extensive sequence data and have now confirmed and extended the functional analysis of PEPT1 variants. Moreover, we have sequenced not only PEPT1 coding regions but also adjoining intronic regions, which may be subject to alternative splicing. The large sample size also permits detailed analysis of haplotype structures and ethnic distributions of the main alleles and haplotypes.
Genomic surveys have revealed that regulatory polymorphisms acting in cis- (i.e., on the transcription of the gene they are located in) represent a main source of human phenotypic variability (Rockman and Wray, 2002; Johnson et al., 2005). Moreover, polymorphisms in transcribed regions of a gene can affect mRNA processing and turnover (Johnson et al., 2005). Hoffmeyer et al. (2000), for instance, observed that a synonymous SNP in ABCB1 correlates with expression levels and in vivo activity of the protein product of ABCB1. We have now demonstrated that this SNP (C3435T) alters mRNA turnover because of changes in mRNA folding (Wang et al., 2005). Nearly half of all human genes are alternatively spliced (Modrek and Lee, 2002), which can be subject to genetic variations. However, a majority of these cis-acting polymorphisms have yet to be discovered. We use here a quantitative analysis of each of the two PEPT1 alleles in small intestines, the main site of expression, as an integrative measure of all cis-acting polymorphisms affecting gene regulation and mRNA processing, as previously shown for PEPT2 (Pinsonneault et al., 2004). Any significant differences in allelic ratios between genomic DNA and mRNA (measured as cDNA) reveals the presence of allelic expression imbalance (Yan et al., 2002) and hence the presence of cis-acting factors. Moreover, we have measured the relative formation of a splice variant, PEPT1-RF (Urtti et al., 2001), previously shown in vitro to regulate H+-dependent PEPT1 transport (Saito et al., 1997). Taken together, this study provides a quantitative assessment of genetic variability of PEPT1, providing details on a new but rare functional variant in the coding region while showing that genetic factors overall seem to play only a small role in determining interindividual variability in PEPT1 transporter activity in intestines.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). Other chemicals were either analytical or HPLC grade.
Genotyping and Variant Construction
Primers for exons and adjoining intron regions (ca. 50 base pairs) for PEPT1 (National Center for Biotechnology Information reference sequence NM_005073
[GenBank]
) were designed using the Virtual Genome center website (http://alces.med.umn.edu/VGC.html) and ordered from QIAGEN Operon (Alameda, CA). A collection of 247 ethnically identified genomic DNA samples were obtained from the Coriell Institute of Medicine (Camden, NJ) and used to screen for PEPT1 variants. PCR was performed in split 20-µl reactions using TaqGold on the GeneAmp 9700 thermocycler, both from PerkinElmer Life and Analytical Sciences. One of three PCR protocols was chosen based on an optimization performed prior to amplifying all 247 samples, adding glycerol or dimethyl sulfoxide or both to a reaction for optimization of product yield. PCR products were tested by agarose gel electrophoresis (2%, 150 V, 35 min). Three reaction products were pooled for dHPLC analysis on a Varian HPLC with Varian Helix columns. Amplicon sequences were analyzed with a dHPLC Melt Program (http://insertion.stanford.edu/melt.html) to establish optimal dHPLC conditions. If a sample scored positive, the three individual amplicons were treated with 2 units of shrimp alkaline phosphatase and ExoI (from USB, Cleveland, OH) and sequenced using ABI BigDye v2 (Applied Biosystems/MDS Sciex, Foster City, CA), cleaned with 96-well gel filtration blocks from Edge BioSystems (Gaithersburg, MD), and run on the ABI 3700 DNA Analyzer (Applied Biosystems/MDS Sciex). In the following cases, dHPLC was skipped, and all samples were individually sequenced: 1) a known SNP exists with an allelic frequency greater than 33%, 2) dHPLC revealed a common polymorphism, 3) dHPLC results were not scoreable, and 4) an additive such as dimethyl sulfoxide or glycerol was used in PCR. Sequences were scored with Sequencher v4 (Gene Codes Corporation, Ann Arbor, MI). All singleton SNPs were verified with an independent PCR reaction followed by sequencing.
Haplotype Analysis
Haplotypes were determined using the PHASE algorithm. The method regards the unknown haplotypes as unobserved random quantities and aims to evaluate their conditional distribution in light of the genotype data (Stephens et al., 2001).
Cell Culture and Transfection
Monkey Cos7, CHO cells, and HEK 293 cells were obtained from American Type Culture Collection (Manassas, VA). Cos7 cells were grown in Dulbecco's modified Eagle's medium H16/Ham's F-12 medium with NEAA (1:1) containing 10% fetal bovine serum and penicillin (100 units/ml) and streptomycin (100 µg/ml) at 37°C in a humidified atmosphere with 5% CO2. CHO cells were grown in Ham's F-12 medium with NEAA containing 10% fetal bovine serum under the same conditions as Cos7 cells. Cos7 and CHO cells were plated in 12-well plates at 3.5 x 105 cells/well and cultured for 24 h. The medium was replaced by a mixture of 3 µg of plasmid (pcDNA 3.1 containing wild-type PEPT1 or its variants or no insert) and 3 µl of LipofectAMINE 2000 (Invitrogen) in 200 µl of OptiMem (Invitrogen). The cells were incubated for 6 h at 37°C, and after centrifugation, the supernatant was replaced with fresh medium. HEK 293 cells were grown at 37°C in an atmosphere of 5% CO2 and 90% relative humidity in standard growth media: modified Eagle's medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 1% NEAA, 2 mM L-glutamine, 100 U · ml-1 penicillin, and 100 µg · ml-1 streptomycin. Cells were seeded at a density of 8 x 104 cells/cm2 onto polylysine-coated polycarbonate wells with a growth area of 3.8 cm2. HEK 293 cells were transfected once they reached approximately 50% confluence using Jet-PEI (Qbiogene, Carlsbad, CA) according to the manufacturer's protocol. pcDNA 3.1 plasmid constructs were transiently transfected into HEK 293 cells using Jet-PEI. Twenty-four hours after transfection, the cell monolayers were used for experiments.
Uptake Studies in Cell Culture
Uptake Studies. In Cos7 and CHO cells, uptake studies were performed 24 h after transfection. Cells were washed twice at 37°C with Krebs' phosphate buffer (1 mM CaCl2, 1 mM MgCl2, 150 mM NaCl, 3 mM KCl, 1 mM NaH2PO4, 5 mM MES, and 5 mM glucose, pH 6.0), and washing buffer was replaced with buffer containing 1.44 µM cephalexin. HEK 293 cells were placed on a shaking plate, preheated to 37°C (SWIP, EB; Toshiba, Tokyo, Japan) and allowed to equilibrate for 15 min in Hanks' balanced salt solution (HBSS), pH 7.4, buffer solution. Uptake of [14C]Gly-Sar and of [3H]mannitol was measured in HBSS supplemented with 0.05% BSA and buffered with 10 mM HEPES to the appropriate pH value. The experiment was started by adding fresh buffer containing Gly-Sar (20-5000 µM) and 0.5 µCi [14C]Gly-Sar per well. [3H]Mannitol (0.5 µCi/well) was added to the solution as a marker of extracellular space. The uptake of Gly-Sar in transiently transfected cells was linear for 5 to 15 min, depending on the cells used. Uptake experiments were terminated after 5 to 15 min by removing the uptake medium, followed by three washes of the monolayers with ice-cold HBSS. The cells were detached from the well with 0.1% Triton-X in phosphate-buffered saline. Samples were divided for protein analysis and radioactivity determinations using liquid scintillation counting. Experiments were performed using four to nine individual transfections.
Inhibition Studies. For inhibition studies in Cos7 and CHO cells, the 0.5-µCi [14C]Gly-Sar was incubated together with increasing concentrations of the test compound (0.1-106 µM for Gly-Sar and Leu-Ala, 0.1-5 x 105 µM for enalapril maleate, and 0.1-105 µM for VAC). After 60 min, drug solution was removed, and cells were washed twice with chilled buffer. To each well 0.5 ml of Milli-Q water was added, and cells were incubated on a shaker for 2 h and harvested by aspirating four times with a syringe. Twenty microliters were removed from the suspension for protein concentration measurements using the Bio-Rad protein assay (Hercules, CA). The suspension was then centrifuged for 10 min at 10,000 rpm, and the supernatant was removed and used for HPLC analysis. For HEK 293 cells, the experiment was initiated by adding 0.5 ml of MES-buffer (pH 6.0) containing 0.5 µCi/ml [14C]Gly-Sar (20 µM) and various amounts of unlabeled test compounds to the transfected HEK 293 cells. From this point on, the affinity experiment was similar to the Gly-Sar uptake experiment. Affinity experiments were performed using cells from four to eight individual transfections.
pH-Dependent Uptake. We investigated the pH dependence of Gly-Sar transport via the wild-type PEPT1 and variant F28Y from pH 5 to 7.4. HEK 293 cells were equilibrated with HEPES buffer pH 7.4 for 15 min. The medium was then changed to MES buffer solutions with a pH of 5.0, 5.5, or 6.0, or HEPES buffer solutions with a pH of 6.5, 7.0, or 7.4. Gly-Sar uptake into the cells at concentrations of 20 µM or 5 mM was then measured over a 5-min period. HEK 293 cells were then treated as described above. Experiments were performed with six individual transfections.
Protein Extraction and Determination
HEK 293 cells detached from the cell culture dishes were placed in Eppendorf tubes (Eppendorf-5 Prime, Inc., Boulder, CO) with NP-40 lysis buffer [10 mM Tris-HCl (pH 7.4), 0.25 M sucrose, 1 mM EDTA, 1 mM EGTA, 2% NP-40]. The tubes were centrifuged at 10,000g for 10 min. The protein content in lysates free of cellular debris was determined by the method of Bradford (1976), using a Bio-Rad protein assay kit according to the manufacturer's instructions (Bio-Rad, Hemel Hempstead, UK).
High-Pressure Liquid Chromatography
The HPLC system used was a Shimadzu HPLC SCL-10A system (Shimadzu, Kyoto, Japan). Cephalexin was separated by reversed phase chromatography on a RP18 Alltima column [100 A, 5 µm; 25 cm x 4.6 mm (Alltech Associates, Deerfield, IL)] at room temperature and detected in the UV at 210 nm. The mobile phase consisted of 20% acetonitrile and 0.1% phosphoric acid in water. The flow rate was 1.0 ml·min-1.
Confocal Laser Scanning Microscopy
PEPT1 localization and expression in transiently transfected HEK 293 cells was studied using confocal laser scanning microscopy. Cells grown on filters were rinsed in HBSS buffer, fixed for 10 min in 3% paraformaldehyde solution in HBSS, and permeabilized for 5 min in 0.1% Triton X-100 in PBS, followed by blocking overnight with 2% BSA in PBS. After rinsing in PBS, cells were treated with 100 µg ml-1 RNase in 2XSSC buffer solution (300 mM NaCl and 30 mM sodium citrate, pH 7.0) for 20 min. PEPT1 localization and expression was studied by immunostaining. After fixation and permeabilization, cells were incubated with anti-PEPT1 (1:200) antibody for 2 h. The filters were rinsed in PBS and incubated with secondary antibody (Alexa 488-conjugated goat anti-rabbit IgG) for 90 min, followed by RNase treatment and propidium iodide counterstaining. All preparation steps were performed at room temperature (20°C). Filters were mounted on coverslips, and confocal imaging was performed on a Zeiss LSM 510 confocal laser scanning microscope, using a Zeiss plan apochromat 63x oil immersion objective with a numerical aperture of 1.4 (Carl Zeiss Inc., Thornwood, NY). Fluorophores were excited using an argon laser line at 488 nm (filter, BP 505-550) and a HeNe laser line at 543 nm (filter, LP 560).
Data Analysis
Total uptake of Gly-Sar in transfected HEK 293 cells was corrected for noncellular uptake using mannitol as previously described (Bravo et al., 2004) and for the uptake of Gly-Sar in mock-transfected HEK 293 cells. The cellular carrier-mediated uptake as a function of apical Gly-Sar concentration was fitted to a Michaelis-Menten type equation (eq. 1):
 | (1) |
where V is the uptake rate (picomoles x milligrams of protein-1 x minutes-1), Vmax is the maximum uptake rate (picomoles x milligrams of protein-1 x minutes-1), Km is the Michaelis-Menten constant (millimolar), and [S] is the Gly-Sar concentration (millimolar).
The IC50 values were determined from the dose-response inhibition curves. These values were calculated with the SigmaPlot software as described earlier (Covitz et al., 1996).
Values are given as mean ± S.D. The statistical significance of the results was determined using two-tailed paired Student's t test. P < 0.05 was considered significant (*, P < 0.05; **, P < 0.01; and ***, P < 0.001).
Analysis of Sequence Variations and Nucleotide Diversity
The neutral parameter 
, the nucleotide diversity 
, and the Tajima variable D were calculated as described by Tajima (1989). The nucleotide diversity is the average number of pair-wise nucleotide differences between sequences in a sample. It depends on both the number of polymorphic sites and their frequency.
The neutral parameter is based on the number of polymorphic sites in a sample of sequences drawn at random from a population. Thus, takes into account the frequencies at which polymorphisms are present in the sample, whereas is based solely on the observed number of segregating sites. The difference between and , expressed by the Tajima's D statistics, is used to detect departures from the standard neutral model (Stephens et al., 2001). A negative D value can be evidence for selection of one specific allele over alternate alleles. If, however, the majority of genes have a negative D, it could mean that the human study population underwent a recent expansion (Stephens et al., 2001).
SNaPshot Assay and Quantitative Analysis of Allelic Ratios in Genomic DNA and mRNA in Small Intestinal Samples
Fifty-six biopsies of small intestine were obtained from the Cooperative Human Tissue Network at The Ohio State University. Tissues were obtained from the duodenum, the jejunum, the ileum, or unspecified small intestines. Most tissues were frozen between 15 and 30 min postbiopsy, although some had longer intervals (1-3 h). Genomic DNA and RNA were extracted from each sample as described (Pinsonneault et al., 2004). In short, frozen tissue samples were pulverized under liquid nitrogen. The frozen powder was portioned into aliquots for DNA and RNA extractions. DNA was prepared by digestion of the pellet or frozen powder with sodium dodecyl sulfate and proteinase K followed by sodium chloride precipitation of proteins (Miller et al., 1988). The DNA in the supernatant was further purified and recovered by ethanol precipitation. For RNA preparation, the starting material was homogenized in TRIzol reagent (monophasic solution of phenol and guanidine isothiocyanate) (Invitrogen) and extracted with chloroform. The RNA was recovered by precipitation with isopropanol followed by centrifugation. For additional purification, the RNA precipitate was dissolved in RNase-free water or QIAGEN buffer (QIAGEN, Valencia, CA), then extracted using QIAGEN RNeasy columns according to the manufacturer's instructions. Complementary DNA (cDNA) was generated from the mRNA by Superscript II reverse transcriptase (Invitrogen) using oligo(dT) and a PEPT1-specific reverse primer (ACACTAGAAGCGTGTGGCGTT).
SNaPshot is a primer extension method we have adapted for analysis on the ABI 3730, with a few modifications needed to accommodate data handling. We selected an abundant marker SNP (synonymous) in the transcribed region of PEPT1 (rs1339067, exon 17, position 78, T1347T). All 56 samples were first genotyped, and then 24 heterozygous samples were selected for allele-specific mRNA analysis. A stretch of genomic DNA (
70 base pairs) or cDNA generated from mRNA containing the marker SNP was amplified by PCR, and the allelic ratio was measured in heterozygous samples by primer extension using fluorescently labeled terminator nucleotides, as previously described for PEPT2 (Pinsonneault et al., 2004). Genomic DNA serves as an internal control compared with amplification of cDNA of the same samples. Standard PCR conditions were used on 15-µl reactions. Amplification conditions consisted of 35 cycles of denaturation at 95°C for 30 s, then primer annealing at 60°C for 1 min, followed by extension at 72°C for 1 min. (PEPT1 exon 17 amplification primer pairs: forward primer, ACATTTCTTCTCCTGGATCACCA; and reverse primer, ACACTAGAAGCGTGTGGCGTT.) After amplification, the reactions were treated with exonuclease I and bacterial Antarctic alkaline phosphatase (New England Biolabs, Beverly, MA). For the primer extension, two separate gene-specific primers (one for each strand) were designed with the 3'-end one base from the SNP position (PEPT1 exon 17, forward extension primer: CTGGATCACCAGTCACTGC; and PEPT1 exon 17, reverse extension primer: CTGCTTGAAGTCGTCAGTTAC). SNaPshot reagent from Applied Biosystems was used to incorporate a single fluorescently labeled dideoxynucleotide to the 3' end of the primer in a template-dependent manner. The final primer extension reactions were run on an ABI 3730 capillary electrophoresis DNA instrument and analyzed with Gene Mapper 3.0 (ABI) software. The peak area is proportional to the amount of each amplified allele. Because differing fluorophores may influence nucleotide incorporation, migration rates, and fluorescent yields, the peak areas are not identical between two alleles present in equal abundance in genomic DNAs, which was normalized to a ratio of 1. mRNA/cDNA ratios were corrected accordingly by dividing the observed allelic mRNA/cDNA ratios for each sample by the mean of the allelic ratios observed for genomic DNA across all samples (none of the samples showed a significant difference in the genomic DNA ratio compared the mean, indicating the absence of any gene dosage effects). The cDNA results are averages (±S.D.) of eight separate experiments (four with each extension primer), normalized to genomic DNA. Significant deviations from unity in the normalized mRNA/cDNA ratios reveal the presence of cis-acting factors affecting transcription and/or mRNA processing (allelic expression imbalance).
Reverse Transcription-PCR of PEPT1 Splice Variant
cDNA preparations from 32 intestinal samples were also used for analysis of the RF splice variant, which consists of exons 3 to 7 (where exons 3 and 7 are partially shared with full-length wild-type PEPT1) and one additional exon 7' further downstream (located between exons 18 and 19) (Urtti et al., 2001; http://www.aapspharmsci.org/view.asp?art=ps030106). PCR was performed on cDNA samples using SYBR green dye on an ABI 7000 sequence detection system (Applied Biosystems, Foster City, CA). PCR was performed in standard 96-well plates with heat-activated TaqDNA polymerase and SYBR Green. SYBR green fluorescence was measured after each cycle. Primers specific for each splice variant were combined with a common primer from exon 7. (Forward primer, GGCTATTAATGCTGGAAGTTTGC; reverse primer, AGACCAACAGAAGTTCCTTTCAGG; and full-length reverse primer, TTGTTGAACTCTGAGCATGGGT.) Each reaction was replicated once. Cycle thresholds (Ct), at which an increase in reporter fluorescence above a baseline signal is detected, were determined with ABI 7000 SDS software. Replicate cycle thresholds were averaged. Approximate expression levels of each splice variant in each sample were determined [X] = 1/2Ct. Relative abundance of full-length to RF in each sample were calculated as ratios and converted to percentages.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
For some SNPs ethnic differences in distribution were observed. One nonsynonymous (exon 17, SNP#2) and three intronic SNPs (exon 1, SNP#4; exon 15, SNP#1; and exon 21, SNP#1) differed at least 2-fold between ethnic groups compared with mean allele frequency (cf. Table 1).
We analyzed the sequence data to detect any evolutionary trends suggesting selection pressures for genetic variants. Table 2 summarizes estimates of the neutral parameter , nucleotide diversity , and the variable Tajima's D calculated for the entire sample and for each ethnic group. In all ethnic populations, the values for the nucleotide diversity was consistently lower than the neutral parameter . The difference between and can be expressed by the Tajima's D statistics used for detecting departures from the standard neutral evolutionary model (Stephens et al., 2001). African Americans had the highest neutral parameter value. The neutral parameter for the entire population was greater than that of the individual subpopulation, which is consistent with the existence of population substructure in this sample set.
|
Haplotype Analysis. Using the PHASE algorithm, 107 distinct haplotypes emerged over 10 PHASE runs, of which 24 were unambiguous haplotypes (i.e., were derived from homozygotes and single-site heterozygotes). Of these, 17 had a frequency of 1%, accounting for 82.9% of all haplotypes (Table 3). The two most common, haplotypes 1 and 2, were more frequent in Caucasians than African Americans. On the other hand, 10 of the remaining 15 haplotypes were more frequent in African Americans, showing greater sequence diversity in this population.
|
Functional Characterization of PEPT1 Variants. Eight nonsynonymous variants were functionally characterized to study the phenotypic influence of genetic variation of the PEPT1 transporter. As a first screen, the uptake of cephalexin was investigated in transiently transfected Cos7 and CHO cells (Fig. 2). Reduced cephalexin uptake compared with wild-type transfected cells was observed only in cells transiently transfected with variant F28Y. Next, we examined concentration-dependent Gly-Sar uptake for 15 min at pH 6.0 in transiently transfected HEK 293 cells. Figure 3 illustrates the obtained saturation curves with accompanying fits to eq. 1. The fitted values for Km were as follows: WT, 2.8 ± 0.5 mM; F28Y, 3.2 ± 0.7 mM; S117N, 2.5 ± 0.6 mM; and G419A, 2.7 ± 0.6 mM. The Vmax values for Gly-Sar uptake were between 1.5 ± 0.2 to 1.8 ± 0.2 nmol/mg of protein/min. The variants did not show any functional differences as judged from the kinetic parameters Km and Vmax, although the F28Y variant had tendency toward a higher Km value (Table 4). However, uptake studies of Gly-Sar at a low-substrate concentration (20 µM) revealed functional differences between the variants (Fig. 4). At all pH levels, PEPT1-mediated uptake of Gly-Sar was significantly lower for the F28Y variant compared with WT, S117N, and G419A (Fig. 4). For the latter three, the uptake increased as the extracellular pH was lowered from 7.4 to 5. On the other hand, differences between wild type and F28Y varied with pH with a maximum at pH 5.5 to 6.0. The pH-dependent Gly-Sar uptake experiments were repeated under identical conditions except for using 5 mM Gly-Sar instead of 20 µM. Under these high-substrate conditions, both WT and the PEPT1 variants all showed similar absolute uptake rates and similar uptake patterns as a function of pH (data not shown).
|
|
|
|
To explore the transport kinetics further, we investigated the concentration-dependent uptake of Gly-Sar in HEK cells transiently transfected with F28Y and WT using a shorter incubation time (5 min) at pH 6.0 and at 5.0, where the difference in uptake of 20 µM Gly-Sar between WT and F28Y was greatest (Table 4). The Km value for F28Y was significantly higher than the Km value for WT at both pH 5 and 6 with no differences in the Vmax values.
To study substrate selectivity, competitive inhibition of cephalexin uptake was tested with enalapril maleate, VAC, and Leu-Ala. The IC50 values of enalapril maleate (2.1 mM), VAC (1.2 mM), and Leu-Ala (0.67 mM) were determined and the uptake of cephalexin measured in the variants at a concentration affording 70% inhibition of cephalexin in the wild-type transfected cells (Table 5). No significant differences were observed between any of the variants in terms of cephalexin inhibition, the exception being a VAC inhibition in F28Y cells. However, standard deviations of the assays were relatively high and, thus, the sensitivity of this assay is relatively low.
|
Subcellular Expression of WT and F28Y in Transiently Transfected HEK 293 Cells. The subcellular localization of PEPT1 in HEK 293 cells transiently transfected with WT and F28Y is shown in Fig. 5. For both WT and F28Y, the PEPT1 protein was primarily localized in the cell membrane and in adjacent vesicles. No staining was observed in mock-transfected cells or in preparations without primary antibody (data not shown). Therefore, subcellular localization of the PEPT1 protein in HEK 293 cells seems to be similar for WT and F28Y.
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). Moreover, we determined allelic expression imbalance and alternative splicing to regulatory variants of PEPT1 in human intestinal samples. The results demonstrate a lack of functional genetic defects, with only rare variants affecting protein function or gene regulation. The significance of variable splicing remains to be determined. This study validates the use of PEPT1 as an entry port for oral bioavailability for peptidomimetic drugs, with genetic variability in intestinal transport activity expected to be limited.
Because we had access to a large sequence database, the results were evaluated in terms of population dynamics and evolution, using the ratio of synonymous over nonsynonymous SNPs as an indicator. This assumes that nonsynonymous substitution may be deleterious and selected against. Nucleotide diversity, , was consistently lower than , yielding negative Tajima's D values similar to those observed previously (Cargill et al., 1999; Halushka et al., 1999; Stephens et al., 2001) except for Hispanics, possibly due to small sample size. This finding is consistent with selection of one specific allele over alternate alleles. Ratios of nonsynonymous over synonymous, overall <1, are similar to those reported earlier (Cargill et al., 1999; Halushka et al., 1999) in studies of genetic variation in over 75 genes. Ratios over 1 indicate that there is a selection for a function of a given gene, which does not seem to be the case for PEPT1.
Overall, our results confirm earlier findings (Zhang et al., 2004) observed in a smaller sample set. Most coding region SNPs were observed in both sample sets (Zhang et al., 2004) with some exceptions. Most nonsynonymous SNPs occur in poorly conserved regions, and the majority of protein variants tested showed no altered functionality. Only two rare SNPs lead to a functional change: PEPT1-P586L, studied earlier (Zhang et al., 2004), and PEPT1-F28Y, characterized here. Whereas P586L shows decreased transport capacity due to reduced protein expression, F28Y has similar expression levels as wild type but altered affinity (i.e., higher Km value for dipeptide transport).
In addition to coding sequence analysis performed in the earlier study (Zhang et al., 2004), we analyzed adjoining intronic regions and a portion of the deduced upstream promoter region. Approximately 6% of the mutations occur in introns and could potentially modulate consensus splice-site signals; such mutations have the potential to cause exon skipping (Aretz et al., 2004). The highest allele frequency (30%) was observed for one SNP in the intronic region adjoining exon 13. PEPT1 has 23 exons, whereas the splice variant PEPT1-RF has six. PEPT1-RF shares three exons completely and two exons partially with PEPT1 (Urtti et al., 2001). No polymorphisms were observed in regions surrounding the splice sites that would predict genetic differences in PEPT1-RF formation.
In vitro uptake studies in transiently transfected CHO and Cos7 cells were performed for phenotypic characterization of nonsynonymous PEPT1 variants. Of the eight variants investigated, one (F28Y) showed significantly reduced cephalexin uptake compared with wild type. Detailed kinetic studies in HEK 293 cells demonstrated that the Km and Vmax values for Gly-Sar uptake by variants S117N and G419A were similar to values obtained for WT PEPT1. This confirms the earlier study (Zhang et al., 2004), where Gly-Sar uptake was measured in transiently transfected HeLa cells, showing that S117N, V122M, G419A, and T451N had similar Gly-Sar uptake compared with wild-type PEPT1.
For F28Y, altered transport of Gly-Sar and cephalexin was observed in various transfected mammalian cells. PEPT1 transport is partly driven by the proton-gradient across intestinal epithelial cells. The pH dependence for Gly-Sar transport via WT, S117N, and G419A reported here is similar to that obtained in oocytes transfected with PEPT1 and in Caco-2 cells where functional Na+/H+ exchanger 3 activity was suppressed with inhibitors (Kennedy et al., 2002). This indicates that both S117N and G419A retain substrate transport activity with unchanged pH dependence. In contrast, F28Y showed a pH profile similar to that previously observed in Caco-2 cells with functional Na+/H+ exchanger 3 activity and the presence of the regulatory factor PEPT1-RF (Saito et al., 1997; Kennedy et al., 2002). Altered pH dependence of F28Y could be related to the phenylalanine to tyrosine substitution, which may affect proton binding to His57, shown to be important for proton binding (Fei et al., 1997, 1998). Previous studies have shown that tyrosine residues in positions 54, 65, and 167 seem to be involved in proton binding (Yeung et al., 1998; Chen et al., 2000). For position 282, a substitution of arginine to lysine did not alter PEPT1 transport activity, whereas substitution to glutamine resulted in the uncoupling of proton dependence (Kulkarni et al., 2003). Because the three-dimensional structure of PEPT1 is currently unknown, no one knows how these residues interact. Sequence comparison across different species showed that the surrounding F28Y region (Urtti et al., 2001; Zhang et al., 2004) is highly conserved across species. The only other PEPT1 variant in a highly conserved region is V21I, showing no functional defect. However, in contrast to Phe28, which was conserved across all species, replacement of valine with isoleucine occurs in gallus (cf. Table 6). Lee et al. (1999) proposed a theoretical model for PEPT1. The model, based on pair-wise calculations and amphipathicity, proposed that transmembrane domains with highest amphipathicity faced a central channel. Using this computational model, they identified amino acids that were probably to alter PEPT1 transport function. Three of four mutations implicated by this model were indeed defective in Gly-Sar transport. None of the natural PEPT1 variants identified here are in regions proposed to be relevant for transport function, consistent with a lack of functional effect of these natural variants.
|
Whereas most previous studies on human genetic variability have focused on coding regions, it is likely that more genetic variants affect mRNA levels by multiple mechanisms. Thus, synonymous SNPs, and SNPs in intronic or regulatory regions, could affect PEPT1 expression or splicing and hence PEPT1 activity. We have addressed this possibility by measuring allelic expression imbalance with a marker SNP in exon 17 in relevant target tissues, in this case, small intestines. We obtained tissue samples from various locations (duodenum, jejunum, and ileum) but did not attempt to analyze these separately because we were limited in sample number. Still, the 24 samples analyzed permit a survey of 48 alleles, sufficient to detect any functional polymorphism with 5% allele frequency. Only seven samples displayed allelic mRNA expression imbalance with 20 to 30% deviations from unity and indicate the presence of frequent cis-acting polymorphisms with limited effect on relative mRNA levels. One can use allelic mRNA ratios as a phenotype for identifying any polymorphisms in the PEPT1 gene locus (including potential regulatory polymorphisms that could reside far upstream of the initiation site). However, in view of the relatively small expression imbalance, we judged it unlikely that any functional polymorphism we might identify would have substantial effect on interindividual variability in PEPT1 intestinal activity. Therefore, we did not pursue the functional genetic variants responsible for the allelic expression imbalance.
Alternative splicing leads to the formation of PEPT1-RF that modulates transport activity of PEPT1 (Saito et al., 1997). Alternative splicing occurs at exon 3 and yields a product that shares several exons with the wild-type PEPT1 (Urtti et al., 2001). We determined the extent of PEPT1-RF mRNA formation in 32 intestinal samples, showing a variance of 2 to 44% of total PEPT1 mRNA activity. Because the marker SNP we selected for the allelic expression imbalance assay resides in exon 17, not present in PEPT1-RF, we cannot determine whether variable splicing is mediated by cis-acting factors or in trans-. Our sequence analysis failed to reveal any sufficiently frequent polymorphisms in the relevant splice region, arguing against the presence of cis-acting factors. Moreover, we cannot determine whether PEPT1/PEPT-RF mRNA ratios are constant within the same individual or fluctuate with nutrition, age, disease, etc. Before these questions are addressed, in vitro studies need to be performed to determine whether PEPT1-RF has the potential to significantly affect PEPT1 transport at the levels found in the intestinal samples.
In conclusion, characterization of the nonsynonymous SNPs reveals an absence of functional SNPs of sufficient frequency to exert significant impact on bioavailability of PEPT1 substrates. Similarly, any cis-acting factors affecting mRNA expression and processing are unlikely to have a strong impact on intestinal PEPT1 transport. Possibly, genetic factors could introduce some systematic variability for drugs critically dependent on PEPT1 activity for intestinal absorption. However, other factors acting on PEPT1 transport activity are more likely to cause interindividual variability, recently studied with VAC in human subjects (Phan et al., 2003). Alternative splicing cannot yet be ruled out as a clinically relevant variable. Overall, however, PEPT1 displays remarkable low genetic variability. This finding is important for drug therapy with peptoid drugs, and for exploiting PEPT1 in prodrug design for improved bioavailability.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: PEPT1, peptide transporter 1; VAC, L-valacyclovir; UCSF, University of California San Francisco; BSA, bovine serum albumin; MES, 2-(N-morpholino) ethanesulfonic acid; Gly-Sar, glycylsarcosine; Gly-Pro, glycylproline; CHO, Chinese hamster ovary; HEK, human embryonic kidney; HPLC, high-performance liquid chromatography; PCR, polymerase chain reaction; dHPLC, denaturing high-performance liquid chromatography; NEAA, nonessential amino acids; HBSS, Hanks' buffered saline solution; PBS, phosphate-buffered saline; SNP, single nucleotide polymorphism; RF, relative formation; WT, wild type.
Address correspondence to: Prof. Wolfgang Sadée, Department of Pharmacology, OSU Program in Pharmacogenomics, 5078 Graves Hall, 333 W. 10th Avenue, Columbus, OH 43210. E-mail: sadee-1{at}medctr.osu.edu
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Aretz S, Uhlhaas S, Sun Y, Pagenstecher C, Mangold E, Caspari R, Moslein G, Schulmann K, Propping P, and Friedl W (2004) Familial adenomatous polyposis: aberrant splicing due to missense or silent mutations in the APC gene. Hum Mutat 24: 370-380.[CrossRef][Medline]
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.[CrossRef][Medline]
Bravo SA, Nielsen CU, Amstrup J, Frokjaer S, and Brodin B (2004) Epidermal growth factor decreases PEPT2 transport capacity and expression in the rat kidney proximal tubule cell line SKPT0193 cl.2. Am J Physiol 286: F385-F393.
Cargill M, Altshuler D, Ireland J, Sklar P, Ardlie K, Patil N, Shaw N, Lane CR, Lim EP, Kalyanaraman N, et al. (1999) Characterization of single-nucleotide polymorphisms in coding regions of human genes. Nat Genet 22: 231-238.[CrossRef][Medline]
Chen XZ, Steel A, and Hediger MA (2000) Functional roles of histidine and tyrosine residues in the H(+)-peptide transporter PepT1. Biochem Biophys Res Commun 272: 726-730.[CrossRef][Medline]
Covitz KM, Amidon GL, and Sadee W (1996) Human dipeptide transporter, hPEPT1, stably transfected into Chinese hamster ovary cells. Pharm Res (NY) 13: 1631-1634.
Dai Z and Sadee W (2005) Pharmacogenetics/genomics and personalized medicine. Hum Mol Genet 14 (Spec. No. 2): R207-R14.
Fei YJ, Liu JC, Fujita T, Liang R, Ganapathy V, and Leibach FH (1998) Identification of a potential substrate binding domain in the mammalian peptide transporters PEPT1 and PEPT2 using PEPT1-PEPT2 and PEPT2-PEPT1 chimeras. Biochem Biophys Res Commun 246: 39-44.[CrossRef][Medline]
Fei YJ, Liu W, Prasad PD, Kekuda R, Oblak TG, Ganapathy V, and Leibach FH (1997) Identification of the histidyl residue obligatory for the catalytic activity of the human H+/peptide cotransporters PEPT1 and PEPT2. Biochemistry 36: 452-460.[CrossRef][Medline]
Ganapathy ME, Brandsch M, Prasad PD, Ganapathy V, and Leibach FH (1995) Differential recognition of beta-lactam antibiotics by intestinal and renal peptide transporters, PEPT 1 and PEPT 2. J Biol Chem 270: 25672-25677.
Halushka MK, Fan JB, Bentley K, Hsie L, Shen N, Weder A, Cooper R, Lipshutz R, and Chakravarti A (1999) Patterns of single-nucleotide polymorphisms in candidate genes for blood-pressure homeostasis. Nat Genet 22: 239-247.[CrossRef][Medline]
Han H, de Vrueh RL, Rhie JK, Covitz KM, Smith PL, Lee CP, Oh DM, Sadee W, and Amidon GL (1998) 5'-Amino acid esters of antiviral nucleosides, acyclovir and AZT are absorbed by the intestinal PEPT1 peptide transporter. Pharm Res (NY) 15: 1154-1159.
Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmoller J, Johne A, Cascorbi I, Gerloff T, Roots I, Eichelbaum M, and Brinkmann U (2000) Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA 97: 3473-3478.
Johnson AD, Wang D, and Sadee W (2005) Polymorphisms affecting gene regulation and mRNA processing: broad implications for pharmacogenetics. Pharmacol Ther 106: 19-38.[CrossRef][Medline]
Kennedy DJ, Leibach FH, Ganapathy V, and Thwaites DT (2002) Optimal absorptive transport of the dipeptide glycylsarcosine is dependent on functional Na+/H+ exchange activity. Pflueg Arch Eur J Physiol 445: 139-146.[CrossRef][Medline]
Kulkarni AA, Haworth IS, Uchiyama T, and Lee VH (2003) Analysis of transmembrane segment 7 of the dipeptide transporter hPepT1 by cysteine-scanning mutagenesis. J Biol Chem 278: 51833-51840.
Lee VH, Chu C, Mahlin ED, Basu SK, Ann DK, Bolger MB, Haworth IS, Yeung AK, Wu SK, Hamm-Alvarez S, and Okamoto CT (1999) Biopharmaceutics of transmucosal peptide and protein drug administration: role of transport mechanisms with a focus on the involvement of PepT1. J Control Release 62: 129-140.[CrossRef][Medline]
Licinio J and Wong ML (2002) Pharmacogenomics: The Search for Individualized Therapies. Wiley-VCH Verlag GmbH, Weinheim.
Miller SA, Dykes DD, and Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16: 1215.
Modrek B and Lee C (2002) A genomic view of alternative splicing. Nat Genet 30: 13-19.[CrossRef][Medline]
Nielsen CU, Amstrup J, Steffansen B, Frokjaer S, and Brodin B (2001) Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line. Am J Physiol 281: G191-G199.
Phan DD, Chin-Hong P, Lin ET, Anderle P, Sadee W, and Guglielmo BJ (2003) Intra- and interindividual variabilities of valacyclovir oral bioavailability and effect of coadministration of an hPEPT1 inhibitor. Antimicrob Agents Chemother 47: 2351-2353.
Pinsonneault J, Nielsen CU, and Sadee W (2004) Genetic variants of the human H+/dipeptide transporter PEPT2: analysis of haplotype functions. J Pharmacol Exp Ther 311: 1088-1096.
Rockman MV and Wray GA (2002) Abundant raw material for cis-regulatory evolution in humans. Mol Biol Evol 19: 1991-2004.
Saito H, Motohashi H, Mukai M, and Inui K (1997) Cloning and characterization of a pH-sensing regulatory factor that modulates transport activity of the human H+/peptide cotransporter, PEPT1. Biochem Biophys Res Commun 237: 577-582.[CrossRef][Medline]
Stephens JC, Schneider JA, Tanguay DA, Choi J, Acharya T, Stanley SE, Jiang R, Messer CJ, Chew A, Han JH, et al. (2001) Haplotype variation and linkage disequilibrium in 313 human genes. Science (Wash DC) 293: 489-493.
Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595.
Urtti A, Johns SJ, and Sadee W (2001) Genomic structure of proton-coupled oligopeptide transporter hPEPT1 and pH-sensing regulatory splice variant. AAPS PharmSci 3: E6.[CrossRef][Medline]
Wang D, Johnson AD, Papp A, Kroetz DL, and Sadee W (2005) Multidrug resistance polypeptide 1 (MDR1, ABCB1) variant 3435C>T affects mRNA stability. Pharmacogenet Genomics 15: 693-704.[Medline]
Yan H, Yuan W, Velculescu VE, Vogelstein B, and Kinzler KW (2002) Allelic variation in human gene expression. Science (Wash DC) 297: 1143.
Yeung AK, Basu SK, Wu SK, Chu C, Okamoto CT, Hamm-Alvarez SF, von Grafenstein H, Shen WC, Kim KJ, Bolger MB, et al. (1998) Molecular identification of a role for tyrosine 167 in the function of the human intestinal proton-coupled dipeptide transporter (hPepT1). Biochem Biophys Res Commun 250: 103-107.[CrossRef][Medline]
Zhang EY, Fu DJ, Pak YA, Stewart T, Mukhopadhyay N, Wrighton SA, and Hillgren KM (2004) Genetic polymorphisms in human proton-dependent dipeptide transporter PEPT1: implications for the functional role of Pro586. J Pharmacol Exp Ther 310: 437-445.
This article has been cited by other articles:
|
|
 |
|
  J. A. Williams, T. Andersson, T. B. Andersson, R. Blanchard, M. O. Behm, N. Cohen, T. Edeki, M. Franc, K. M. Hillgren, K. J. Johnson, et al. PhRMA White Paper on ADME Pharmacogenomics J. Clin. Pharmacol., July 1, 2008; 48(7): 849 - 889. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sala-Rabanal, D. D. F. Loo, B. A. Hirayama, E. Turk, and E. M. Wright Molecular interactions between dipeptides, drugs and the human intestinal H+-oligopeptide cotransporter hPEPT1 J. Physiol., July 1, 2006; 574(1): 149 - 166. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||
) at pH 6, WT; (
), G419A; (
), S117N; and (
), F28Y. Cells were washed four times in ice-cold HBSS and solubilized. Radioactivity and protein amounts were determined and uptake was calculated. Each bar represents mean ± S.E. of five to six individual transfections. The lines represent the calculated fits to the Michaelis-Menten equation (eq. 1).
