![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION
Department of Pharmaceutics and Biopharmaceutics, Showa Pharmaceutical University, Machida, Tokyo, Japan (C.E., M.K., N.H., M.H., M.F., Y.W.); Graduate School of Pharmaceutical Sciences, Osaka University, Suita, Osaka, Japan (H.M.); Laboratory of Gene Transfer and Regulation, National Institute of Biomedical Innovation, Ibaraki, Osaka, Japan (H.M.); and Department of Bacterial and Toxinology, Division of Infectious Diseases, Osaka University, Suita, Osaka, Japan (Y.H.)
Received July 26, 2005; accepted September 2, 2005.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
). Recent progress in combinatorial chemistry, proteomics, and genomics research has further advanced the development of effective drugs against carcinomas, but, for clinical application, it is also essential to develop selective and efficient drug delivery systems for these novel drugs (Allen and Cullis, 2004).
These drugs can be delivered by targeting several cell surface molecules, including carcinoembryonal antigen, carboanhydrage IX, and epithelial cell adhesion molecule (Steffens et al., 1997; Chester et al., 2000; Mayer et al., 2000; McLaughlin et al., 2001). In fact, experimental therapies have been developed using antibody-mediated targeting of these molecules. However, because carcinoembryonal antigen and carboanhydrage IX are expressed by carcinomas as well as normal epithelium in kidney and liver, side effects are difficult to avoid (Steffens et al., 1997; Chester et al., 2000; Mayer et al., 2000). Moreover, the antibody for epithelial cell adhesion molecule itself is toxic to normal epithelium (McLaughlin et al., 2001).
Tight junctions (TJs), which are points of intercellular contact and interaction, are characteristic and complex structures in the epithelia. TJs play a critical role in forming a barrier between apical and basal sides of the cell, and they are present on the lateral side of the cell where they mediate intercellular interactions (Schneeberger and Lynch, 2004). Loss of polarity is a typical feature of transformation in epithelial cells. Furthermore, abnormal localization of membrane proteins, including TJ components, adherence junction proteins, and apical and basal proteins, is observed during carcinogenesis (Wodarz, 2000; Yarden and Sliwkowski, 2001; Vermeer et al., 2003). These findings indicate that abnormally localized membrane proteins may be useful for targeting drugs to carcinoma cells.
Claudin is an approximately 23-kDa transmembrane protein found in the TJ, and it plays a pivotal role in the barrier function of the TJ (Tsukita et al., 2001). There are more than 20 members of claudin family, and they are expressed in a tissue-specific manner (Morita et al., 1999a,b). For instance, claudin-1 is ubiquitously expressed, and claudin-3 is observed in the lung and liver. In mice, claudin-5 is expressed in all blood endothelial cells. Claudin-6 is widely expressed only in the fetus. Interestingly, the overexpression of claudins is frequently observed in the epithelium of ovarian cancer, hepatocellular carcinoma, malignant pancreatic cancer, and prostate cancer (Hough et al., 2000; Long et al., 2001; Michl et al., 2003; Rangel et al., 2003; Cheung et al., 2005). Therefore, claudins are promising candidates for the targeting of anticancer drugs to carcinoma cells.
Clostridium perfringens enterotoxin (CPE) is a single polypeptide with a molecular mass of 35 kDa that causes food poisoning associated with most human food-borne illnesses (McClane and Chakrabarti, 2004). CPE is made up of two functionally distinct domains: an approximately 22-kDa N-terminal domain that mediates cytotoxicity and an approximately 13-kDa C-terminal domain (C-CPE) that mediates binding (McClane and Chakrabarti, 2004). Claudin-3 and -4 are the receptors for CPE (Katahira et al., 1997; Sonoda et al., 1999), and we and others have shown that they bind to CPE via the C-CPE domain (Katahira et al., 1997; Sonoda et al., 1999; Fujita et al., 2000; Kondoh et al., 2005). These findings suggest that CPE could be used for the targeting of claudins on epithelial carcinoma cells. Indeed, CPE has been successfully used to treat human ovarian and pancreatic cancers, both of which express high levels of claudin-3 or -4 (Michl et al., 2001; Santin et al., 2005).
In the present study, we investigated whether C-CPE can be used to target claudin-4-expressing cells. For this purpose, we utilized a PSIF derived from PE as a reporter molecule (Leamon et al., 1993; Mesri et al., 1994; Beers et al., 2000) to assess targeting of claudin-4-expressing cells. PE (GenBank accession no. K01397
[GenBank]
; http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=151215) binds to the cell surface and is internalized via the endocytotic pathway, after which it escapes from endosomes into the cytosol. The PE fragments (PSIF) released into the cytosol inhibit protein synthesis by blocking the function of elongation factor 2 (Ogata et al., 1990). The PSIF, which cannot invade into cells, does not show any cytotoxicity because of lacking the cell binding domain. We show here that a C-CPE-PSIF fusion was toxic to cells expressing claudin-4 but not to cells expressing claudin-1. In addition, the cytotoxic effects of C-CPE-PSIF were dose dependently attenuated by C-CPE. Thus, C-CPE is a potent molecule for targeting of claudin-4-expressing cells and should be useful as a system for delivering drugs against malignant carcinomas.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-actin mAb were obtained from Zymed Laboratories (South San Francisco, CA). All other reagents used were research grade.
Cell Culture. Human breast cancer cell line MCF-7 cells and human intestinal cell line Caco-2 cells were maintained in RPMI 1640 medium and Dulbecco's modified Eagle's medium containing 10% fetal calf serum at 37°C, respectively. Mouse fibroblast cell line L cells and mouse claudin-expressing L cells, kindly provided by Dr. S. Tsukita (Kyoto University, Japan) (Morita et al., 1999b; Sonoda et al., 1999), were cultured in modified Eagle's medium containing 10% fetal calf serum at 37°C.
Preparation of C-CPE-PSIF Fusions. The plasmids containing fusions of PSIF with C-CPE and C-CPE lacking its C-terminal 30 amino acids (C-CPE289) were prepared as follows. C-CPE and C-CPE289 were amplified by polymerase chain reaction (PCR) using pET16bHis10C-CPE as a template (Katahira et al., 1997), a common forward primer (5'-CCATGGCCGAGAGATGTGTTTTAACAGTT-3', NcoI site is underlined), and a reverse primer for C-CPE (5'-GCGGCCGCAAATTTTTGAAATAATATTGA-3', NotI site is underlined) or C-CPE289 (5'-GCGGCCGCTATATCAACATAATGATCTTT-3', NotI site is underlined). The resulting PCR fragments were subcloned into the pGEM T-Easy Vector to create pTA/C-CPE and pTA/C-CPE289 (Promega, Madison, WI), and the sequences were confirmed. PSIF was amplified using PSIF primer-1 (5'-GATGATCGATCGCGGCCGCAGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTGCCGCAGACTACAAAGACGACGACGACAAACCCGAGGGCGGCAGCCTGGCCGCGCTGACC-3', the underline indicates the NotI site, and the italic letters indicate the FLAG sequence), PSIF primer-2 (5'-GATCGATCGATCACTAGTCTACAGTTCGTCTTTCTTCAGGTCCTCGCGCGGCGGTTTGCCGGG-3', the underline indicates SpeI site), and Pseudomonas aerginosa cDNA as a template. The resulting PCR products were subcloned into the pGEM T-Easy Vector, and the sequences were confirmed. The NotI/SpeI-digested PSIF fragment was inserted into the NotI/SpeI-digested pY02 (Yamamoto et al., 2003) to generate pY02-PSIF. The pTA/C-CPE and pTA/C-CPE289 plasmids were digested with NotI and NcoI, and the fragments were inserted into NotI/NcoI-digested pY02-PSIF to generate pY02-C-CPE-PSIF and pY02-C-CPE289-PSIF. The C-CPE-PSIF plasmids were transduced into Escherichia coli strain TG1, after which the cells were grown at 37°C in 2YT medium (Invitrogen, Carlsbad, CA) containing 2% glucose to an optical density at 600 nm of 0.6 to 0.9. The medium was then changed to 2YT medium containing 1 mM isopropyl -D-thiogalactopyranoside. After an additional 18 h of culture at 30°C, the cells were harvested and centrifuged. The resulting supernatant was applied to anti-FLAG M2 affinity gel, and the bound proteins were eluted with FLAG peptide. The buffer was exchanged with phosphate-buffered saline (PBS) using a PD-10 column (GE Healthcare), and the purified protein was stored at -80°C until use. Purification of the of C-CPE-PSIF proteins was confirmed by SDS-polyacrylamide gel electrophoresis (PAGE), followed by staining with Coomassie Brilliant Blue and by immunoblotting with anti-FLAG M2 antibody (Fig. 1; data not shown). Protein was quantified using a commercially available assay kit with BSA as a standard (Bio-Rad, Hercules, CA).
|
-D-thiogalactopyranoside, and the cells were grown for an additional 6 h. The cells were harvested and then solubilized in lysis buffer (10 mM Tris-HCl, 150 mM NaCl, and 1 mM EDTA, pH 8.0) containing 100 µg/ml lysozyme, 5 mM dithiothreitol, and 1.5% N-lauroylsarcosine. The lysate was centrifuged, after which the supernatant was collected and adjusted to 2% Triton X-100. The supernatant was incubated with glutathione-agarose beads for 2 h at 4°C. The beads were then washed with the lysis buffer, and C-CPE was eluted from the beads by cleavage with thrombin. Thrombin was removed from the eluted protein using Benzamidine-Sepharose 4 Fast Flow. The buffer was then exchanged with PBS using a PD-10 column. The purification of C-CPE was confirmed by SDS-PAGE (data not shown).
Trypan Blue Assay. Cells were treated with vehicle or C-CPE-PSIF proteins for the indicated periods. Both the floating and adherent cells were recovered and were suspended in ice-cold PBS. The cell suspension was adjusted to 0.2% trypan blue, and the number of stained (dying or dead) and unstained (living) cells was counted. At least 300 cells were counted to determine the fraction of dead cells.
L-Lactate Dehydrogenase Release Assay. The release of lactate dehydrogenase (LDH) from the cells was analyzed using a CytoTox96 NonRadioactive Cytotoxicity Assay kit (Promega) according to the manufacturer's protocol. LDH release was calculated using the following equation: percentage of maximal LDH release = LDH in the cultured medium/total LDH in the culture dish.
Competition Assay. MCF-7 cells were pretreated with C-CPE or BSA at the indicated concentration for 1 h, after which C-CPE-PSIF was added to the cells. After an additional 36 h of culture, LDH release was assayed as described above.
Statistical Analysis. Statistical significance of differences was assessed using one-way analysis of variance followed by Dunnett's test. Differences were considered significant when p < 0.05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Cytotoxic Properties of C-CPE-PSIF. To examine the cytotoxic properties and specificity of C-CPE-PSIF, we compared its effects on L cells, which lack endogenous claudins, and MCF-7 cells, which express endogenous claudin-4 (Fig. 2A). Trypan blue dye exclusion showed C-CPE-PSIF caused dose-dependent cell death in MCF-7 cells, with 92% death after a 36-h treatment with 2 µg/ml C-CPE-PSIF (Fig. 2B). Similar results were observed in the LDH release assay. In this case, 8 µg/ml C-CPE-PSIF caused the release of approximately 100% of the LDH (Fig. 2C). In contrast, even at 8 µg/ml, C-CPE/PSIF was not cytotoxic to L cells and Caco-2 cells (Fig. 2, B and C). Taken together, these results suggested that C-CPE-PSIF is toxic to claudin-4-expressing tumor epithelial cells.
|
Targeting Properties of C-CPE-PSIF. We next used a competition assay to determine whether C-CPE-PSIF binds to MCF-7 cells via C-CPE. As shown in Fig. 3A, pretreatment of the cells with C-CPE dose dependently attenuated the cytotoxic activity of 0.5 µg/ml C-CPE-PSIF, with a maximal effect observed at 5 µg/ml C-CPE. In contrast, pretreatment of the cells with 10 µg/ml BSA did not reduce the cytotoxicity of 0.5 µg/ml C-CPE/PSIF. These results suggest that C-CPE-PSIF interacts with MCF-7 cells via the C-CPE domain.
|
). To confirm that claudin-4 is involved in the cytotoxicity of C-CPE-PSIF, we prepared C-CPE289-PSIF, which lacks the claudin-4-binding region of C-CPE. As expected, C-CPE-PSIF had a powerful toxic effect on MCF-7 cells, reaching 70% cell death at 4 µg/ml. In contrast, even at 8 µg/ml, C-CPE289-PSIF was not cytotoxic. These results suggested that interaction with claudin-4 is essential for the cytotoxicity of C-CPE-PSIF. To confirm this possibility, we evaluated the cytotoxic activity of C-CPE-PSIF in L cells expressing claudin-1 (CL1/L cells), -2 (CL2/L cells), -4 (CL4/L cells), and -5 (CL5/L cells) (Figs. 4, B and C). C-CPE-PSIF was not cytotoxic in CL1/L, CL2/L, and CL5/L cells (Fig. 4C), and it was toxic in CL4/L cells (31.3 and 73.5% LDH release at 0.1 and 5 µg/ml, respectively). These results confirm that the C-CPE domain of C-CPE-PSIF interacts with claudin-4 on the cell membrane.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
We used a fusion in which the C terminus of C-CPE was linked to the N terminus of PSIF. Thus, the receptor-binding region of C-CPE may be influenced by fusion with PSIF. To investigate this further, we are currently attempting to prepare C-CPE-PSIF with a G4S linker inserted between the C-CPE and PSIF domains. In the current studies, it was necessary to connect PSIF to the C terminus of C-CPE because of technical aspects of plasmid construction, and we need to consider the function of C-CPE when preparing other claudin-4-targeting molecules. Solution of the three-dimensional structures of claudins and CPE should be helpful. Competitive analysis using C-CPE revealed that C-CPE-PSIF interacted with cells via the C-CPE domain. Thus, cellular uptake of C-CPE-PSIF appears to be dependent on the interaction of claudin-4 with C-CPE. Indeed, we found that L cells expressing claudin-1, -2, or -5 are insensitive to C-CPE-PSIF and that deletion of the claudin-4-binding domain of C-CPE eliminates its cytotoxicity. These results indicate that C-CPE-PSIF binds to claudin-4 on the cell surface. Similarly, Fujita et al. (2000) showed that CPE binds to claudin-4 but not claudin-1, -2, or -5. Also, expression of claudin-4 but not -1 or -5 confers sensitivity to CPE (Sonoda et al., 1999; Fujita et al., 2000). Thus, our data are consistent with previous findings, and they show that fusion with C-CPE, the receptor-binding region of CPE, confers claudin binding to PSIF. The receptor-binding region of CPE was previously narrowed to the C-terminal 30 amino acids (Hanna et al., 1991). Similarly, we reported that deletion of the C-terminal 30 amino acids of C-CPE eliminates its ability to bind claudin-4 (Kondoh et al., 2005). Here, we showed that deletion of the 30 amino acids in C-CPE-PSIF abolishes its toxic effects. Taken together, the results indicate that C-CPE could be used to target drugs to claudin-4.
For the use of claudins as targets for drug delivery, it is important to understand whether molecules binding to claudin on the cell surface are taken up into the cells. PSIF is a useful as a reporter for screening ligands (Siegall et al., 1990; Theuer et al., 1992; Leamon et al., 1993). Because C-CPE-PSIF was cytotoxic in claudin-4-expressing cells, we expect that C-CPE-PSIF must enter the cytosol. This leaves the question of how C-CPE-PSIF enters the cells. One possibility is that it is taken up by endocytosis, after which it escapes from the endosomes into the cytosol. Generally, proteins are targeted to clathrin-coated vesicles by a sorting signal sequence, including YXXØ or EXXXLL (where X is any amino acid, and Ø is a bulky hydrophobic residue) (Bonifacino and Traub, 2003). Because claudin-4 contains an ALGVLL motif at amino acids 92 to 97 and a YVGW motif at amino acids 165 to 168 (Ivanov et al., 2004), it may be taken up by clathrin-mediated endocytosis. Indeed, Matsuda et al. (2004) showed that the endocytosis of claudins occurs during the remodeling of TJs.
Claudins are overexpressed in some tumor cells. Administration of CPE has been shown to reduce the growth of claudin-4-overexpressing human ovarian and pancreatic tumors (Michl et al., 2001; Rangel et al., 2003; Santin et al., 2005). CPE contains not only a claudin-4-binding domain but also a cytotoxic domain (McClane and Chakrabarti, 2004). Therefore, it is hard to use CPE in itself as a targeting molecule to claudin-4. Offner et al. (2005) reported that antibodies for claudins bind to claudin-expressing carcinomas, suggesting that anti-claudin antibodies or their Fv domains could be used to target antitumor agents to claudin-positive tumors. However, targeting of an antitumor agent to cells via a claudin has never been achieved. In this point, C-CPE is a useful claudin-4-targeting molecule, and C-CPE could target not only antitumor agents but also liposomes to claudin-4-overexpressing tumor cells. Although claudin-4 is also distributed in normal tissues such as normal colon epithelium and several glands, the expression in normal tissues is weaker than in tumors (Long et al., 2001; Michl and Gress, 2004). Therefore, detailed analysis for mechanism of interaction between C-CPE and claudin-4 is needed for a future application of antitumor therapy using C-CPE. In the present study, we found that C-CPE-PSIF was nontoxic in Caco-2 cells. We previously reported that addition of C-CPE in basal side not apical side of Caco-2 monolayer resulted in decrease of the barrier function of TJ (Masuyama et al., 2005; Takahashi et al., 2005). McClane and Chakrabarti (2004) also reported that Caco-2 cells are more sensitive to CPE when CPE is applied to their basal side than when CPE is applied to their apical sides. Taken together, insensitivity of Caco-2 cells to C-CPE-PSIF may be due to polarization of Caco-2 cells. This is an interesting founding, and it is an important issue to clarify the relationship between sensitivity of C-CPE-PSIF and polarization of claudin-4 in tumor tissues and normal tissues. C-CPE reduced the barrier function of TJ of epithelia (Kondoh et al., 2005), and utilization of C-CPE may facilitate drug delivery to intratumor tissues.
We previously showed that the C-terminal 16 amino acids of C-CPE are responsible for its interaction of claudin-4 (Kondoh et al., 2005), indicating that modification of the C terminus of C-CPE could allow other claudins to be targeted. For example, it may be useful to target claudin-10 because it is overexpressed in hepatocellular carcinomas (Cheung et al., 2005). Because the plasmid encoding C-CPE-PSIF is a phagemid vector, its binding specificity can be easily manipulated using phage display. We are currently attempting to identify the precise claudin-4 binding region of C-CPE and to use a phage display library to prepare versions of C-CPE that can bind other claudins.
In summary, we showed that the C-CPE domain of C-CPE-PSIF targets claudin-4. This is the first report that C-CPE can allow the targeting of a drug to claudin-4. Because of these results, we are currently developing a claudin-targeting drug delivery system.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
C.E. and M.K. contributed equally to this work.
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: TJ, tight junction; CPE, C. perfringens enterotoxin; C-CPE, C-terminal fragment of C. perfringens enterotoxin; PSIF, protein synthesis inhibitory factor derived from Pseudomonas exotoxin; PE, Pseudomonas exotoxin; C-CPE-PSIF, C-terminal fragment of C. perfringens enterotoxin fused to a protein synthesis inhibitory factor; BSA, bovine serum albumin; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; LDH, L-lactate dehydrogenase.
Address correspondence to: Dr. Masuo Kondoh, Department of Pharmaceutics and Biopharmaceutics, Showa Pharmaceutical University, Machidashi, Tokyo 194-8543, Japan. E-mail: masuo{at}ac.shoyaku.ac.jp
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Allen TM and Cullis PR (2004) Drug delivery systems: entering the mainstream. Science (Wash DC) 303: 1818-1822.
Beers R, Chowdhury P, Binger D, and Pastan I (2000) Immunotoxins with increased activity against epidermal growth factor receptor vIII-expressing cells produced by antibody phage display. Clin Cancer Res 6: 2835-2843.
Bonifacino JS and Traub LM (2003) Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu Rev Biochem 72: 395-447.[CrossRef][Medline]
Chester KA, Mayer A, Bhatia J, Robson L, Spencer DI, Cooke SP, Flynn AA, Sharma SK, Boxer G, Pedley RB, et al. (2000) Recombinant anti-carcinoembryonic antigen antibodies for targeting cancer. Cancer Chemother Pharmacol 46 (Suppl): S8-S12.
Cheung ST, Leung KL, Ip YC, Chen X, Fong DY, Ng IO, Fan ST, and So S (2005) Claudin-10 expression level is associated with recurrence of primary hepatocellular carcinoma. Clin Cancer Res 11: 551-556.
Fujita K, Katahira J, Horiguchi Y, Sonoda N, Furuse M, and Tsukita S (2000) Clostridium perfringens enterotoxin binds to the second extracellular loop of claudin-3, a tight junction integral membrane protein. FEBS Lett 476: 258-261.[CrossRef][Medline]
Greenlee RT, Murray T, Bolden S, and Wingo PA (2000) Cancer Statistics, 2000 CA Cancer J Clin 50: 7-33.
Hanna PC, Mietzner TA, Schoolnik GK, and McClane BA (1991) Localization of the receptor-binding region of Clostridium perfringens enterotoxin utilizing cloned toxin fragments and synthetic peptides. J Biol Chem 266: 11037-11043.
Hough CD, Sherman-Baust CA, Pizer ES, Montz FJ, Im DD, Rosenshein NB, Cho KR, Riggins GJ, and Morin PJ (2000) Large-scale serial analysis of gene expression reveals genes differentially expressed in ovarian cancer. Cancer Res 60: 6281-6287.
Ivanov AI, Nusrat A, and Parkos CA (2004) Endocytosis of epithelial apical junctional proteins by a clathrin-mediated pathway into a unique storage compartment. Mol Biol Cell 15: 176-188.
Katahira J, Inoue N, Horiguchi Y, Matsuda M, and Sugimoto N (1997) Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J Cell Biol 136: 1239-1247.
Kondoh M, Masuyama A, Takahashi A, Asano N, Mizuguchi H, Koizumi N, Fujii M, Hayakawa T, Horiguchi Y, and Watanabe Y (2005) A novel strategy for the enhancement of drug absorption using a claudin modulator. Mol Pharmacol 67: 749-756.
Leamon CP, Pastan I, and Low PS (1993) Cytotoxicity of folate-Pseudomonas exotoxin conjugates toward tumor cells. J Biol Chem 268: 24847-24854.
Long H, Crean CD, Lee WH, Cummings OW, and Gabig TG (2001) Expression of Clostridium perfringens enterotoxin receptors claudin-3 and claudin-4 in prostate cancer epithelium. Cancer Res 61: 7878-7881.
Masuyama A, Kondoh M, Seguchi H, Takahashi A, Harada M, Fujii M, Mizuguchi H, Horiguchi Y, and Watanabe Y (2005) Role of N-terminal amino acids in the absorption-enhancing effects of the C-terminal fragment of Clostridium perfringens enterotoxin. J Pharmacol Exp Ther 314: 789-795.
Matsuda M, Kubo A, Furuse M, and Tsukita S (2004) A peculiar internalization of claudins, tight junction-specific adhesion molecules, during the intercellular movement of epithelial cells. J Cell Sci 117: 1247-1257.
Mayer A, Tsiompanou E, O'Malley D, Boxer GM, Bhatia J, Flynn AA, Chester KA, Davidson BR, Lewis AA, Winslet MC, et al. (2000) Radioimmunoguided surgery in colorectal cancer using a genetically engineered anti-CEA single-chain Fv antibody. Clin Cancer Res 6: 1711-1719.
McClane BA and Chakrabarti G (2004) New insights into the cytotoxic mechanisms of Clostridium perfringens enterotoxin. Anaerobe 10: 107-114.
McLaughlin PM, Harmsen MC, Dokter WH, Kroesen BJ, van der Molen H, Brinker MG, Hollema H, Ruiters MH, Buys CH, and de Leij LF (2001) The epithelial glycoprotein 2 (EGP-2) promoter-driven epithelial-specific expression of EGP-2 in transgenic mice: a new model to study carcinoma-directed immunotherapy. Cancer Res 61: 4105-4111.
Mesri EA, Ono M, Kreitman RJ, Klagsbrun M, and Pastan I (1994) The heparin-binding domain of heparin-binding EGF-like growth factor can target Pseudomonas exotoxin to kill cells exclusively through heparan sulfate proteoglycans. J Cell Sci 107: 2599-2608.[Abstract]
Michl P, Barth C, Buchholz M, Lerch MM, Rolke M, Holzmann KH, Menke A, Fensterer H, Giehl K, Lohr M, et al. (2003) Claudin-4 expression decreases invasiveness and metastatic potential of pancreatic cancer. Cancer Res 63: 6265-6271.
Michl P, Buchholz M, Rolke M, Kunsch S, Lohr M, McClane B, Tsukita S, Leder G, Adler G, and Gress TM (2001) Claudin-4: a new target for pancreatic cancer treatment using Clostridium perfringens enterotoxin. Gastroenterology 121: 678-684.[CrossRef][Medline]
Michl P and Gress TM (2004) Bacteria and bacterial toxins as therapeutic agents for solid tumors. Curr Cancer Drug Targets 4: 689-702.[CrossRef][Medline]
Morita K, Furuse M, Fujimoto K, and Tsukita S (1999a) Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands. Proc Natl Acad Sci USA 96: 511-516.
Morita K, Sasaki H, Furuse M, and Tsukita S (1999b) Endothelial claudin: claudin-5/TMVCF constitutes tight junction strands in endothelial cells. J Cell Biol 147: 185-194.
Offner S, Hekele A, Teichmann U, Weinberger S, Gross S, Kufer P, Itin C, Baeuerle PA, and Kohleisen B (2005) Epithelial tight junction proteins as potential antibody targets for pancarcinoma therapy. Cancer Immnunol Immunother 54: 431-445.
Ogata M, Chaudhary VK, Pastan I, and FitzGerald DJ (1990) Processing of Pseudomonas exotoxin by a cellular protease results in the generation of a 37,000-Da toxin fragment that is translocated to the cytosol. J Biol Chem 265: 20678-20685.
Rangel LB, Agarwal R, D'Souza T, Pizer ES, Alo PL, Lancaster WD, Gregoire L, Schwartz DR, Cho KR, and Morin PJ (2003) Tight junction proteins claudin-3 and claudin-4 are frequently overexpressed in ovarian cancer but not in ovarian cystadenomas. Clin Cancer Res 9: 2567-2575.
Santin AD, Cane S, Bellone S, Palmieri M, Siegel ER, Thomas M, Roman JJ, Burnett A, Cannon MJ, and Pecorelli S (2005) Treatment of chemotherapy-resistant human ovarian cancer xenografts in C. B-17/SCID mice by intraperitoneal administration of Clostridium perfringens enterotoxin. Cancer Res 65: 4334-4342.
Schneeberger EE and Lynch RD (2004) The tight junction: a multifunctional complex. Am J Physiol 286: C1213-C1228.
Siegall CB, FitzGerald DJ, and Pastan I (1990) Cytotoxicity of IL6-PE40 and derivatives on tumor cells expressing a range of interleukin 6 receptor levels. J Biol Chem 265: 16318-16323.
Sonoda N, Furuse M, Sasaki H, Yonemura S, Katahira J, Horiguchi Y, and Tsukita S (1999) Clostridium perfringens enterotoxin fragment removes specific claudins from tight junction strands: evidence for direct involvement of claudins in tight junction barrier. J Cell Biol 147: 195-204.
Steffens MG, Boerman OC, Oosterwijk-Wakka JC, Oosterhof GO, Witjes JA, Koenders EB, Oyen WJ, Buijs WC, Debruyne FM, Corstens FH, et al. (1997) Targeting of renal cell carcinoma with iodine-131-labeled chimeric monoclonal antibody G250. J Clin Oncol 15: 1529-1537.[Abstract]
Takahashi A, Kondoh M, Masuyama A, Fujii M, Mizuguchi H, Horiguchi Y, and Watanabe Y (2005) Role of C-terminal regions of the C-terminal fragment of Clostridium perfringens enterotoxin in its interaction with claudin-4. J Control Release, in press.
Theuer CP, FitzGerald DJ, and Pastan I (1992) A recombinant form of Pseudomonas exotoxin directed at the epidermal growth factor receptor that is cytotoxic without requiring proteolytic processing. J Biol Chem 267: 16872-16877.
Tsukita S, Furuse M, and Itoh M (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol 2: 285-293.[CrossRef][Medline]
Vermeer PD, Einwalter LA, Moninger TO, Rokhlina T, Kern JA, Zabner J, and Welsh MJ (2003) Segregation of receptor and ligand regulates activation of epithelial growth factor receptor. Nature (Lond) 422: 322-326.[CrossRef][Medline]
Wodarz A (2000) Tumor suppressors: linking cell polarity and growth control. Curr Biol 10: R624-R626.[CrossRef][Medline]
Yamamoto Y, Tsutsumi Y, Yoshioka Y, Nishibata T, Kobayashi K, Okamoto T, Mukai Y, Shimizu T, Nakagawa S, Nagata S, et al. (2003) Site-specific PEGylation of a lysine-deficient TNF-alpha with full activity. Nat Biotechnol 21: 546-552.[CrossRef][Medline]
Yarden Y and Sliwkowski MX (2001) Untangling the ErbB signaling network. Nat Rev Mol Cell Biol 2: 127-137.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  L. Winkler, C. Gehring, A. Wenzel, S. L. Muller, C. Piehl, G. Krause, I. E. Blasig, and J. Piontek Molecular Determinants of the Interaction between Clostridium perfringens Enterotoxin Fragments and Claudin-3 J. Biol. Chem., July 10, 2009; 284(28): 18863 - 18872. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Van Itallie, L. Betts, J. G. Smedley III, B. A. McClane, and J. M. Anderson Structure of the Claudin-binding Domain of Clostridium perfringens Enterotoxin J. Biol. Chem., January 4, 2008; 283(1): 268 - 274. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
