![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR AND MOLECULAR
3-Adrenoceptor Associated with Differential G Protein Coupling
Department of Pharmacology, Monash University, Victoria, Australia (M.S., D.S.H., T.H., B.A.E., R.J.S.); Department of Physiology, Wenner-Gren Institute, Arrhenius Laboratories F3, Stockholm University, Stockholm, Sweden (D.S.H., T.B.); and Department of Neurochemistry and Neurotoxicology, Arrhenius Laboratories for Natural Sciences, Stockholm University, Stockholm, Sweden (A.F., U.L.)
Received June 28, 2005; accepted September 2, 2005.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
3-adrenoceptor transcripts produces an additional receptor isoform (3b-adrenoceptor) with a C terminus comprising 17 amino acids distinct from the 13 in the known receptor (3a-adrenoceptor). We have shown that the 3b-adrenoceptor couples to both Gs and Gi, whereas the 3a-adrenoceptor couples only to Gs. To define the regions involved in this differential G protein coupling, we have compared wild-type, truncated, and mutant 3-adrenoceptors. In Chinese hamster ovary cells expressing 3-adrenoceptors truncated at the splicing point, cAMP accumulation with CL316243
[GenBank]
[(R,R)-5-[2-[[2-(3-chlorophenyl)-2-hydroxyethyl]-amino]-propyl]1,3-benzodioxole-2,2-dicarboxylate] increased by 59% following pretreatment with pertussis toxin, suggesting that the C-terminal region of the 3a-adrenoceptor inhibits coupling to Gi. We next utilized the cell-penetrating peptide Transportan 10 (Tp10) to introduce peptides comprising the different C-terminal tail fragments into cells expressing 3a-adrenoceptor, 3b-adrenoceptor, and the truncated 3-adrenoceptor. Treatment with 3a-Tp10 (1 µM) caused cAMP responses to CL316243
[GenBank]
in the 3a-adrenoceptor to become pertussis toxin-sensitive and display a 30% increase over control, whereas the other peptides did not affect any receptor. Mutation at a potential tyrosine phosphorylation site (Tyr392Ala 3a-adrenoceptor) did not alter responses or pertussis toxin sensitivity relative to the parent receptor. Surprisingly, a Ser388Ala/Ser389Ala mutant 3b-adrenoceptor became unresponsive to CL316243
[GenBank]
while retaining an extracellular acidification rate response to SR59230A [3-(2-ethylphenoxy)-1-[(1,S)-1,2,3,4-tetrahydronapth-1-ylamino]-2S-2-propanol oxalate]. Our findings suggest that the 3a-adrenoceptor cannot couple to Gi because of conformational changes induced by a protein(s) that interacts with residues in the C-terminal tail or because this protein(s) affects the intracellular localization of the 3a-adrenoceptor.
), 
1A-adrenoceptor (Hirasawa et al., 1995; Chang et al., 1998), serotonin 5-HT4 (Gerald et al., 1995) and 5-HT7 receptors (Krobert et al., 2001), and the somatostatin SRIF1A receptor (Vanetti et al., 1993). Although many splice variants share similar pharmacology, some show marked differences in signaling properties. For instance, four splice variants of the EP3 receptor couple to different subsets of G proteins (Namba et al., 1993), and 5-HT4 splice variants display differential G protein coupling (Pindon et al., 2002) and levels of constitutive activity (Claeysen et al., 1999).
The mouse 3-adrenoceptor gene contains two introns, both of which undergo alternate splicing (van Spronsen et al., 1993; Granneman and Lahners, 1995; Evans et al., 1999; Hutchinson et al., 2002). One alternately spliced mRNA encodes the 3b-adrenoceptor, with a C-terminal tail (-SSLL-REPRHLYTCLGYP) differing from that found in the 3a-adrenoceptor (-RFDGYEGARPFPT). The 3a-adrenoceptor tail contains a putative tyrosine phosphorylation site and the 3b-adrenoceptor tail a putative PKC phosphorylation site (Blom et al., 1999). Our previous studies have shown that although the splice variants display no significant pharmacological differences in binding affinity of [125I]cyanopindolol or in affinity of competitors for this binding, they do show differences in signaling properties (Hutchinson et al., 2002). Functional studies in Chinese hamster ovary (CHO-K1) cells expressing either the 3a- or the 3b-adrenoceptor were carried out to examine extracellular acidification rate (ECAR), cAMP accumulation, and Erk1/2 phosphorylation responses. ECAR responses to all 3-adrenoceptor agonists tested were greater in cells expressing 3a-adrenoceptor compared with 3b-adrenoceptor expressed at the same level. Pretreatment of cells expressing 3b-adrenoceptor but not those expressing 3a-adrenoceptor with pertussis toxin caused an increase in maximal ECAR and cAMP responses. Erk1/2 responses were unaffected by this treatment. The results suggested that in CHO-K1 cells, the 3b-adrenoceptor couples to both Gs and Gi, whereas the 3a-adrenoceptor couples solely to Gs. The increase in Erk1/2 phosphorylation following receptor activation was not dependent upon coupling of the receptors to Gi or the generation of cAMP (Hutchinson et al., 2002). However, activated 3-adrenoceptors can bind c-Src directly via four motifs (PXXP) present in the third intracellular loop and the C terminus (Cao et al., 2000). Mutation of the proline residues in these motifs prevents both c-Src binding and Erk1/2 phosphorylation. In 3a-or 3b-adrenoceptor CHO-K1 cells, Erk1/2 phosphorylation is inhibited by the c-Src inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (Hutchinson et al., 2002).
To define the residues involved in differential G protein coupling of the 3a-adrenoceptor and 3b-adrenoceptor isoforms, we generated receptors mutated at key sites in the splice regions and truncated receptors lacking either of the splice regions. To examine this further, we generated cell-penetrating peptides (CPPs) to introduce the spliced C termini into cells expressing each of the 3a- and 3b-adrenoceptors and truncated receptor. The different C termini of the 3a- and 3b-adrenoceptors (p3a and p3b, respectively) were covalently linked to a transport peptide, Transportan 10 (Tp10) (Pooga et al., 1998) via a disulfide bridge. Tp10 is a CPP used as a carrier for bioactive cargo (Pooga et al., 1998).
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
3a- and 3b-Adrenoceptors and Receptor Mutants in CHO-K1 Cells. Plasmids (pcDNA3.1+) carrying the coding region for each of the 3a- and 3b-adrenoceptors were as previously described (Hutchinson et al., 2002). Four mutants were created to examine the potential importance of residues in the C terminus for G protein coupling. A construct for expression of the truncated mouse 3-adrenoceptor was made by replacing a 570-bp XhoI /XbaI fragment from the 3a-adrenoceptor plasmid with a 524-bp PCR fragment generated using the primers mb3.TF (5' CGTCTATGCTCGAGTGTTCGTTGTGG 3') and mb3.TR (5' CCGCTCTAGACCCCTATCTGTTGAGC 3') (restriction sites underlined). The Tyr392Ala 3a-adrenoceptor mutant was made in the same way, by inserting a 561-bp PCR fragment generated using the forward primer mb3.TF and a reverse primer, 5' CGGTTCTAGACCCTTCACGTGGGAAACGGACGCGCACCTTCAGCGCCATC 3' containing an XbaI site. All PCR reactions were carried out as described before (Hutchinson et al., 2002), using Platinum Pfx High Fidelity DNA polymerase (Invitrogen, Carlsbad, CA). The 3b-adrenoceptor mutant was made by QuikChange mutagenesis (Stratagene, La Jolla, CA). Primers for this Ser388,389Ala mutant were: forward, 5' CCACCGCTCAACGCTGCCCTTCTTCGGGAACCC 3'; and reverse, 5' GGGTTCCCGAAGAAGGGCAGCGTTGAGCGGTGG 3'. The complete insert and junctions with pcDNA3.1 were checked for each of the 3-adrenoceptor constructs by DNA sequencing on both strands (Micromon, Monash University, Victoria, Australia). CHO-K1 cells were grown in a 50:50 Dulbecco's modified Eagle's medium/Ham's F12 medium supplemented with 10% (v/v) fetal bovine serum, glutamine (2 mM), penicillin (100 units/ml), and streptomycin (100 µg/ml) at 37°C with 5% CO2. Transfections were performed using Lipofectamine and the transfected cells selected in media containing 800 µg/ml Geneticin (G418), then maintained in media containing 400 µg/ml G418. Clonal cell lines were obtained by limiting dilution of mixed cell populations and were expanded and analyzed by a single-point [125I]cyanopindolol (800 pM) binding screen. Suitable clones were grown further for a full saturation binding analysis. The clonal cell lines chosen for further characterization were maintained under 5% CO2 at 37°C and passaged every 3 to 4 days. In experiments where cells were pretreated with specific agents, concentration and time of treatment are indicated with the data.
Peptide Synthesis. All peptides (see Table 3) were assembled on an ABI 433 synthesizer using low-load 4-methylbenzhydrylamine resin, N-{{2-[(triisopropylsilyl)oxy]benzyl}oxy}carbonyl-protected amino acids, and N,N'-dicyclohexylcarbodiimide/1-hydroxybenzotriazole activation. The p3b sequence contains a thiol group on the endogenous Cys residue that could easily be used to construct disulfides; however, it was necessary to add an N-terminal cysteine residue in the p3a sequence. Prior to cleavage an orthogonal fmoc group on Lys7 in the Tp10 sequence was removed, and N-{{2-[(triisopropylsilyl)oxy]-benzyl}oxy}carbonyl-Cys(NPyS) was added using O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate/1-hydroxybenzotriazole activation. The peptides were then cleaved with hydrofluoric acid containing 10% paracreosol for Tp10-N-Cys(NPyS) and 10% paracreosol/parathiocreosole for the others, followed by ether extraction and lyophilization. The peptides were then purified on a reversed phase C18 high-performance liquid chromatography column (Dionex, Sunnyvale, CA), and the mass was confirmed by matrix-assisted laser desorption ionization/time of flight mass spectrometry (Applied Biosystems, Foster City, CA). The constructs were obtained by dissolving the peptides in degassed ddH2O containing 0.1% tri-fluoroacetic acid and mixing them at 1:1.2 ratio (slight excess of the thiol-containing peptide) overnight at room temperature. The final constructs were purified by semipreparative high-performance liquid chromatography as above.
|
Radioligand Binding Assay. Cell membranes were prepared as described earlier (Hutchinson et al., 2002), and saturation-binding experiments were performed as described earlier (Hutchinson et al., 2002). Briefly, homogenate (10–20 µg of protein) was incubated with [125I]cyanopindolol (100–2000 pM) for 60 min at room temperature in the absence or presence of (–)-alprenolol (1 mM) to define nonspecific binding. Reactions were terminated by rapid filtration through GF/C filters presoaked for 30 min in 0.5% (v/v) polyethylenimine using a Packard Cell Harvester and radioactivity measured using a Packard Top Count. Experiments were performed in duplicate with n referring to the number of different membrane homogenate samples used.
cAMP Accumulation Studies. Cells (1 x 104 per well) were grown in 96-well plates in Dulbecco's modified Eagle's medium/Ham's F-12 medium containing 0.5% (v/v) fetal bovine serum for 2 days. On the day of experiment, media was aspirated and appropriate drugs diluted in stimulation buffer (1 mg ml–1 BSA, 0.5 mM IBMX, and 0.5 M Hepes, pH 7.4, in Hanks' balanced salt solution) added in a final volume of 100 µl. After 30 min of incubation at 37°C, media were removed and 100 µl of lysis buffer [1 mg ml–1 BSA, 0.3% (v/v) Tween 20, 0.5 M Hepes, and 0.5 mM IBMX, pH 7.4] added. Samples were rapidly frozen at –70°C to lyse cells prior to measurement of cAMP.
To examine the effect of pertussis toxin, cells were treated with toxin (100 ng ml–1) for 16 h before stimulation with appropriate drugs. The effects of CPPs based on the C terminus of the 3a- and 3b-adrenoceptors were examined by addition of 1 µM of peptide for 30 min prior to stimulation of cells with CL316243
[GenBank]
for 30 min. In experiments to examine the possible coupling of the Ser388,389Ala 3b-adrenoceptor mutant to Gi, cells were treated with CL316243
[GenBank]
for 30 min followed by treatment with forskolin (10 µM) for 30 min.
cAMP accumulation was measured utilizing the cAMP -Screen Kit (PerkinElmer Life and Analytical Sciences, Boston, MA). Samples were thawed, and cAMP standards (10 pM to 1 µM) were prepared in detection buffer [0.4% (v/v) Hanks' balanced salt solution, 3 mM Hepes, 0.2% (v/v) Tween 20, and 0.1% (v/v) BSA, pH 7.4], and 5 ml of unknown samples or cAMP standards was transferred into a white 384-well plate. Five microliters of acceptor beads (anti-cAMP acceptor beads diluted in detection buffer) was aliquoted to each well and incubated for 30 min in the dark. Fifteen microliters of donor beads (streptavidin donor beads diluted in detection buffer and 1 M biotinylated cAMP) solution was added to each well, and the plate was sealed and incubated in the dark overnight. cAMP accumulation was detected utilizing the Fusion microplate reader (PerkinElmer Life and Analytical Sciences). All results are expressed as the percentage of the forskolin response (10 µM) in a given experiment.
Cytosensor Microphysiometer Studies. The cytosensor microphysiometer (Molecular Devices, Sunnyvale, CA) was used to measure 3-adrenoceptor-mediated increases in ECAR as previously described (Hutchinson et al., 2002, 2005a). Briefly, CHO-K1 cells expressing the 3-adrenoceptor were seeded into 12-mm transwell inserts (Corning Life Sciences, Acton, MA) at 5 x 105 cells per cup and left to adhere overnight. On the day of experiment, cells were equilibrated for 2 h, and cumulative concentration-response curves to CL316243
[GenBank]
or SR59230A were constructed in paired sister cells with cells exposed to each concentration of drug for 14 min. All drugs were diluted in modified RPMI 1640. All results are expressed as a percentage of the maximal response to SR59230A in a given experiment.
Data Analysis. All results are expressed as a mean ± S.E.M. of n. Data were analyzed using nonlinear curve fitting (GraphPad Prism version 4.0, GraphPad Software Inc., San Diego, CA) to obtain pEC50 values (cytosensor microphysiometer and cAMP experiments) or using a one-site fit to obtain Kd and Bmax values (saturation experiments). Statistical significance was determined using two-way analysis of variance tests or Student's t test. Probability values less than or equal to 0.05 were considered significant.
Drugs and Reagents. CL316243 [GenBank] was kindly supplied by Dr. T. Nash (Wyeth-Ayerst, Princeton, NJ). Drugs and reagents were purchased as follows: G418 from CalBiochem (San Diego, CA); [125I]cyanopindolol (2200 Ci mmol–1) from PerkinElmer Life and Analytical Sciences; pertussis toxin from Invitrogen; (–)-alprenolol, bacitracin, IBMX, polyethylenimine, and SR59230A from Sigma-Aldrich (St. Louis, MO); and aprotinin, leupeptin, and pepstatin A from MP Biomedicals (Irvine, CA). All cell culture media and supplements were obtained from Trace Biosciences (Castle Hill, NSW, Australia). Antibodies were obtained from Cell Signaling Technology Inc. (Beverly, MA). All other drugs and reagents were of analytical grade.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
3-adrenoceptor are shown in Table 1. All of the receptors studied had similar pKd values, indicating that modifications to the C terminus of either the 3a- or 3b-adrenoceptor had little or no effect on receptor affinity (Fig. 1). Several clones were selected for each receptor to allow comparison at similar expression levels. In addition to the previously characterized 3a- and 3b-adrenoceptors (Hutchinson et al., 2002), saturation characteristics were determined for the truncated 3-adrenoceptor, the Ser388,389Ala 3b-adrenoceptor, and the Tyr392Ala 3a-adrenoceptor. Although expression levels for the Ser388,389Ala 3b-adrenoceptor mutant were somewhat lower than for the other 3-adrenoceptor variants, it is known from previous studies (Hutchinson et al., 2002) that the G protein-coupling properties of the receptors are retained over a wide range of expression levels.
|
|
Determination of the Role of the C Terminus. cAMP responses to CL316243
[GenBank]
in CHO-K1 cells expressing 3a-adrenoceptors were unaffected by pretreatment of cells with pertussis toxin (100 ng ml–1, 16 h; Fig. 2A; Table 2), whereas responses in cells expressing 3b-adrenoceptor increased some 33% following pretreatment with pertussis toxin (P < 0.0001; Fig. 2B; Table 2), confirming our previous results (Hutchinson et al., 2002). The pEC50 values for CL316243
[GenBank]
at the 3a- and 3b-adrenoceptors were not significantly different and were not altered significantly by pertussis toxin pretreatment (Table 2). The truncated 3-adrenoceptor that lacks the C-terminal tail of either the 3a- or 3b-adrenoceptor splice variants behaved similarly to the 3b-adrenoceptor (Fig. 1) and displayed pertussis toxin sensitivity (Fig. 2C; Table 2). The maximal response to CL316243
[GenBank]
was increased some 59% by pertussis toxin pretreatment (P < 0.0001; Table 2). This suggested that rather than the 3b-adrenoceptor containing a motif that enables coupling to Gi, the C terminus of the 3a-adrenoceptor contains a motif that disables coupling to the inhibitory G protein. It should be noted that the responses observed here and in subsequent experiments result from 3-adrenoceptor activation because although CHO-K1 cells endogenously express low levels of 2-adrenoceptors (http://www.tumor-gene.org/GPCR/gpcr.html), CL316243
[GenBank]
is a highly selective 3-adrenoceptor agonist with antagonist actions at 1- and 2-adrenoceptor.
|
|
The Effects of Cell-Penetrating Peptides Based on the C Terminus of the 3-Adrenoceptor Splice Variants. CHO-K1 cells expressing 3a-, 3b-, or the truncated 3-adrenoceptor were treated with a number of different peptides as indicated in Table 3. For all cell lines, the control treatment with the peptides p3a and p3b produced no significant alteration in basal cAMP production or in responses to CL316243
[GenBank]
(10 nM), both in the presence or absence of pertussis toxin (Fig. 3) compared with cells not treated with the peptides (the 3a-adrenoceptor was still pertussis toxin insensitive, and the 3b-adrenoceptor or truncated 3-adrenoceptor were still pertussis toxin sensitive). Thus, the 3a- and 3b-adrenoceptor C-terminal tails alone are unlikely to penetrate cells and also have no discernible effect on the ability of any of the 3-adrenoceptors to produce a cAMP response.
|
3a-adrenoceptor with the peptide Tp10-p3a (1 µM) caused the cAMP response to CL316243
[GenBank]
to become pertussis toxin sensitive and display a 30% increase over control (P < 0.05; Fig. 3A). The same peptide had no effect on the pertussis toxin sensitivity of the 3b- (Fig. 3B) or the truncated 3-adrenoceptor (Fig. 3C). The other corresponding peptide, Tp10-p3b (1 µM), did not significantly affect responses of either of the pertussis toxin-sensitive receptors (3b- and truncated 3-adrenoceptor) or the response of the 3a-adrenoceptor (Fig. 3). Neither Tp10-p3a nor Tp10-p3b had any effect on basal cAMP levels (Fig. 3).
The Effect of Mutations in the C Terminus of 3a- and 3b-Adrenoceptors on Signaling Properties. We generated a Tyr392Ala mutant 3a-adrenoceptor to examine the possibility that phosphorylation of the 3a-adrenoceptor tail contributes to its capacity to interfere with Gi coupling. In cells expressing this receptor, CL316243
[GenBank]
increased cAMP levels with pEC50 values similar to the wild-type 3a-adrenoceptor (Fig. 4). There were no significant changes in the cAMP response between cells treated with vehicle and those with pertussis toxin (Fig. 4; Table 2). Thus, the Tyr392Ala mutant of the 3a-adrenoceptor behaves like the parent receptor and was not examined further for agonist-induced phosphorylation. A 3b-adrenoceptor mutant (Ser388,389Ala) was used to determine whether this putative phosphorylation site played a role in determining the type of G protein coupling. Surprisingly, although this mutant displayed similar binding characteristics (pKd) to the wild-type receptors and the other mutants (Table 1), it was not capable of stimulating cAMP accumulation in response to CL316243
[GenBank]
(Fig. 5A). We also asked if this mutant could still couple to Gi by examining its ability to inhibit cAMP production in response to forskolin (10 µM). CL316243
[GenBank]
had no effect at any concentration tested on cAMP accumulation following stimulation by forskolin (Fig. 5A). On the other hand, this receptor retained an ability to mediate a cytosensor response to SR59230A that must be independent of coupling to Gs or Gi (Fig. 5B). SR59230A displayed similar potency at the Ser388,389Ala 3b-adrenoceptor (pEC50 6.81) and the wild-type 3b-adrenoceptor (pEC50 6.88), but with a reduced maximal response (53.8%) (Fig. 5B). In contrast, there was virtually no ECAR response to stimulation of the Ser388,389Ala 3b-adrenoceptor with CL316243
[GenBank]
compared with the wild-type 3b-adrenoceptor (Fig. 5B).
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
2-adrenoceptor, structural determinants for Gs coupling reside in the second and third intracellular loops and in helix 8, located in the proximal C-terminal tail (O'Dowd et al., 1988; Cheung et al., 1989). These regions are well conserved between the three -adrenoceptors, suggesting that all subtypes share common determinants for coupling to Gs. In contrast, the -adrenoceptors all have the capacity for Gi coupling, but the amino acid determinants and cell type dependence vary. When expressed in CHO-K1 or HEK 293 cells, both the 1- and 2-adrenoceptors undergo agonist-dependent phosphorylation and a consequent increase in Gi coupling (Martin et al., 2004). In cardiac myocytes, on the other hand, interaction with Gi accompanies receptor endocytosis. Interaction of the 2-adrenoceptor with Gi is dependent on a functional PDZ motif at the receptor C terminus (DSLL; Xiang and Kobilka, 2003), whereas the 1-adrenoceptor C-terminal PDZ motif (ESKV) prevents receptor internalization and Gi coupling (Xiang et al., 2002). Neither the 3a- nor the 3b-adrenoceptor has a known consensus PDZ motif at the C terminus, although our findings indicate that this region in the 3a-adrenoceptor is important for protein-protein interactions.
Coupling of the 3-adrenoceptor to Gi and resultant inhibition of cAMP accumulation has been reported in primary white and brown adipocytes and in 3T3-F442A adipocytes that express endogenous 3-adrenoceptors (Chaudhry et al., 1994; Soeder et al., 1999; Lindquist et al., 2000). Gi coupling has also been implicated in 3-adrenoceptor mediated phosphorylation of Erk1/2, although findings vary. Pretreatment of mouse 3T3-F442A and C3H10T1/2 adipocytes with pertussis toxin inhibits 3-adrenoceptor-mediated Erk1/2 phosphorylation (Soeder et al., 1999; Cao et al., 2000), whereas mouse 3T3-L1 adipocytes are not pertussis toxin-sensitive (Mizuno et al., 2000). In primary cultures of mouse brown adipocytes, Erk1/2 phosphorylation occurs exclusively via Gs activated pathways (Lindquist et al., 2000). Pertussis toxin inhibits Erk1/2 phosphorylation in CHO-K1 and HEK 293 cells expressing the human 3-adrenoceptor (Gerhardt et al., 1999; Soeder et al., 1999) but not in CHO-K1 cells expressing the mouse 3-adrenoceptor (Hutchinson et al., 2002). These inconsistencies indicate that the predominant Erk1/2 phosphorylation pathway is particularly receptor- and cell type-dependent.
The discovery of introns in the 3-adrenoceptor gene (Granneman et al., 1992) sparked a search for multiple mRNAs encoding functional 3-adrenoceptors (Granneman et al., 1992, 1993; Bensaid et al., 1993). We found two splice variants of the mouse 3-adrenoceptor (Evans et al., 1999) that have different properties, the 3b-adrenoceptor coupling to Gs and Gi, but the 3a-adrenoceptor coupling only to Gs (Hutchinson et al., 2002). To define the residues involved in this differential coupling, we generated truncated receptors lacking either splice region. CL316243
[GenBank]
-stimulated cAMP accumulation in cells expressing the truncated 3-adrenoceptor was increased 59% by pretreatment with pertussis toxin, indicating that like the 3b-adrenoceptor, this receptor is able to couple to Gi. Hence, the lack of Gi coupling displayed by the 3a-adrenoceptor must be due to interference by the C-terminal tail. This could happen in three ways: amino acid(s) in the unique C terminus undergo intramolecular interaction with residues in the Gi-coupling domains, amino acid(s) in the C terminus bind to a separate protein or complex that causes steric hindrance or a conformational change that favors coupling to Gs over Gi, or binding of a protein or complex results in localization of the receptor to a cellular compartment where it cannot couple to Gi.
We sought to distinguish intramolecular from intermolecular interactions by using peptides corresponding to the unique 3a- and 3b-adrenoceptor C termini. To deliver these peptides, the different C termini were linked via a disulfide bridge to the transport peptide Tp10, a deletion analog of transportan (Pooga et al., 1998). Transportan was originally made as a chimera of the neuropeptide Galanin(1–12) and the wasp venom mastoparan. Although mastoparan is a G protein activator (Higashijima et al., 1988), transportan is much less active than mastoparan, and Tp10 is inactive (Soomets et al., 2000). These tools were used to examine the responses of CHO-K1 cells expressing 3a-adrenoceptor, 3b-adrenoceptor, and the truncated 3-adrenoceptor to the 3-adrenoceptor agonist CL316243
[GenBank]
.
When Tp10-p3 conjugates enter the cell, the reductive environment reduces the disulfide bond within minutes, releasing the C-terminal peptides and also Tp10 as monomers (Hallbrink et al., 2001). Treatment of cells with the disulfide construct Tp10-p3a caused the cAMP responses to CL316243
[GenBank]
in the 3a-adrenoceptor to become pertussis toxin sensitive and display a 30% increase over control. The corresponding Tp10-p3b peptide had no significant effect on responses to CL316243
[GenBank]
by any of the 3-adrenoceptors. In particular, Tp10-p3b did not cause the 3a-adrenoceptor response to become pertussis toxin-sensitive, indicating that the Tp10 peptide per se does not affect G protein coupling. The observed effect of the Tp10-p3a peptide on the pertussis toxin sensitivity of the 3a-adrenoceptor also demonstrates that the introduction of an N-terminal cysteine in the conjugated p3a does not impair the ability of this peptide to alter signaling by the 3a-adrenoceptor. Furthermore, it does not cause the peptide to affect signaling by the 3b-adrenoceptor or the truncated 3-adrenoceptor.
Intramolecular binding within the 3a-adrenoceptor can be ruled out by our finding that the Tp10-p3a peptide restored the ability of this receptor to couple to Gi. If the peptide were competing with the C terminus for binding to site(s) within the receptor, it would suppress the Gi interaction rather than enhance it. Thus, our data are consistent with the view that the Tp10-p3a peptide competes with the endogenous 3a-adrenoceptor C terminus for binding of a separate protein or complex. It seems unlikely that this binding causes steric hindrance to interactions with Gi but not Gs because the amino acids involved in G protein coupling are thought to be within common intracellular domains, namely the second and third loops and the proximal C-terminal tail (O'Dowd et al., 1988; Marin et al., 2000). It is possible, though, that binding of other proteins to the 3a-adrenoceptor produces an allosteric effect, promoting a receptor conformation that has low affinity for Gi but unchanged affinity for Gs. An alternative hypothesis is that binding of protein(s) such as caveolin or other scaffolding proteins to the 3a-adrenoceptor C terminus localizes the receptor to membrane microdomains or intracellular compartments where it cannot couple to Gi. By analogy, the binding of proteins to the 1-adrenoceptor C-terminal PDZ motif prevents internalization of the receptor and Gi coupling in cardiac myocytes (Xiang et al., 2002).
To examine sites in the C-terminal tail that might inhibit or modulate Gi coupling, we asked whether signaling is altered by mutation of amino acids that constitute putative phosphorylation sites. The affinity of -adrenoceptor ligands for the mutant receptors was unaltered, consistent with their identical sequences in the transmembrane domains that form the 3-adrenoceptor ligand-binding pocket (Guan et al., 1995; Granneman et al., 1998; Gros et al., 1998). The 3a-adrenoceptor C-terminal tail has a Tyr residue that may represent a target site for protein tyrosine kinases (Pinna and Ruzzene, 1996). We hypothesized that phosphorylation of the 3a-adrenoceptor C-terminal tail may facilitate the protein interactions deduced from our CPP experiments. However, the mutant Tyr392Ala receptor still lacked the capacity for Gi coupling. Thus, the identity of C-terminal amino acids conferring the 3a-adrenoceptor phenotype remains unknown because there are no other consensus phosphorylation sites or currently recognized motifs present.
We also examined a mutant 3b-adrenoceptor in which Ser388 and Ser 389 were mutated to Ala residues. Serine and threonine residues in the C-terminal tail are determinants for desensitization of GPCRs (Hausdorff et al., 1991). Unlike the 3a-adrenoceptor tail, the 3b-adrenoceptor tail contains two serine residues that hypothetically form part of a PKC consensus site, (R/K)1–3-(X)0–2-S/T(X)0–2-(R/K)1–3. Surprisingly, the Ser388,389Ala 3b-adrenoceptor was unable to couple to Gs or Gi, indicating a significant conformational change in this receptor relative to the wild-type 3b-adrenoceptor. It also displayed virtually no response to CL 316243 in the cytosensor. This is not, however, a dead receptor because it produced an ECAR response to SR59230A with similar potency to the wild-type receptor. The ECAR response is mediated by 3-adrenoceptors and antagonized by the neutral antagonist bupranolol and provides further evidence that SR59230A can activate cell signaling distinct from the Gs-cAMP pathway (Hutchinson et al., 2005a). Our recent studies indicate that changes in ECAR in response to CL316243
[GenBank]
are mediated by cAMP but those to SR59230A may in addition involve p38 MAP kinase (Hutchinson et al., 2005b).
In conclusion, our results indicate that both the 3a- and 3b-adrenoceptors are inherently capable of coupling to Gs and Gi but that the 3a-adrenoceptor is restrained from coupling to Gi by interaction of residues in the C terminus with other protein(s). The difference between 3a- and 3b-adrenoceptor signaling cannot be altered by mutation of a residue potentially involved in Tyr phosphorylation (Tyr392 3a-adrenoceptor). Competition for proteins interacting with the 3a-adrenoceptor by an internalized p3a-peptide allows coupling of the 3a-adrenoceptor to Gi as seen for the 3b- or truncated 3-adrenoceptor. The use of cell-permeable peptides corresponding to a particular receptor domain has provided a valuable approach to distinguishing between intra- and intermolecular interactions.
|
Footnotes |
|---|
ABBREVIATIONS: GPCR, G protein-coupled receptor; 5-HT, 5-hydroxytryptamine; PKC, protein kinase C; CHO-K1, Chinese hamster ovary; ECAR, extracellular acidification rate; CPP, cell-penetrating peptide; Tp10, Transportan 10; PCR, polymerase chain reaction; BSA, bovine serum albumin; IBMX, 3-isobutyl-1-methylxanthine; CL316243 [GenBank] , (R,R)-5-[2-[[2-(3-chlorophenyl)-2-hydroxyethyl]-amino]-propyl]1,3-benzodioxole-2,2-di-carboxylate; SR59230A, 3-(2-ethylphenoxy)-1-[(1,S)-1,2,3,4-tetrahydronapth-1-ylamino]-2S-2-propanol oxalate.
Address correspondence to: Roger J. Summers, Department of Pharmacology, P.O. Box 13E, Monash University, Victoria 3800, Australia. E-mail: roger.summers{at}med.monash.edu.au
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Bensaid M, Kaghad M, Rodriguez M, Le FG, and Caput D (1993) The rat beta 3-adrenergic receptor gene contains an intron. FEBS Lett 318: 223–226.[CrossRef][Medline]
Blom N, Gammeltoft S, and Brunak S (1999) Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294: 1351–1362.[CrossRef][Medline]
Cao W, Luttrell LM, Medvedev AV, Pierce KL, Daniel KW, Dixon TM, Lefkowitz RJ, and Collins S (2000) Direct binding of activated c-Src to the beta 3-adrenergic receptor is required for MAP kinase activation. J Biol Chem 275: 38131–38134.
Chang DJ, Chang TK, Yamanishi SS, Salazar FH, Kosaka AH, Khare R, Bhakta S, Jasper JR, Shieh IS, Lesnick JD, et al. (1998) Molecular cloning, genomic characterization and expression of novel human alpha1A-adrenoceptor isoforms. FEBS Lett 422: 279–283.[CrossRef][Medline]
Chaudhry A, Mackenzie RG, Georgic LM, and Granneman JG (1994) Differential interaction of beta1- and beta3-adrenergic receptors with g(i) in rat adipocytes. Cell Signal 6: 457–465.[CrossRef][Medline]
Cheung AH, Sigal IS, Dixon RA, and Strader CD (1989) Agonist-promoted sequestration of the beta 2-adrenergic receptor requires regions involved in functional coupling with Gs. Mol Pharmacol 35: 132–138.[Abstract]
Claeysen S, Sebben M, Becamel C, Bockaert J, and Dumuis A (1999) Novel brain-specific 5-HT4 receptor splice variants show marked constitutive activity: role of the C-terminal intracellular domain. Mol Pharmacol 55: 910–920.
Evans BA, Papaioannou M, Hamilton S, and Summers RJ (1999) Alternative splicing generates two isoforms of the beta3-adrenoceptor which are differentially expressed in mouse tissues. Br J Pharmacol 127: 1525–1542.[CrossRef][Medline]
Gerald C, Adham N, Kao HT, Olsen MA, Laz TM, Schechter LE, Bard JA, Vaysse PJ, Hartig PR, Branchek TA, et al. (1995) The 5-HT4 receptor: molecular cloning and pharmacological characterization of two splice variants. EMBO (Eur Mol Biol Organ) J 14: 2806–2815.[Medline]
Gerhardt CC, Gros J, Strosberg AD, and Issad T (1999) Stimulation of the extracellular signal-regulated kinase 1/2 pathway by human beta-3 adrenergic receptor: new pharmacological profile and mechanism of activation. Mol Pharmacol 55: 255–262.
Granneman JG and Lahners KN (1995) Regulation of mouse beta(3)-adrenergic receptor gene expression and mRNA splice variants in adipocytes. Am J Physiol 37: C1040–C1044.
Granneman JG, Lahners KN, and Chaudhry A (1993) Characterization of the human beta 3-adrenergic receptor gene. Mol Pharmacol 44: 264–270.[Abstract]
Granneman JG, Lahners KN, and Rao DD (1992) Rodent and human beta 3-adrenergic receptor genes contain an intron within the protein-coding block. Mol Pharmacol 42: 964–970.[Abstract]
Granneman JG, Lahners KN, and Zhai Y (1998) Agonist interactions with chimeric and mutant beta1- and beta3-adrenergic receptors: involvement of the seventh transmembrane region in conferring subtype specificity. Mol Pharmacol 53: 856–861.
Gros J, Manning BS, Pietri-Rouxel F, Guillaume JL, Drumare MF, and Strosberg AD (1998) Site-directed mutagenesis of the human beta3-adrenoceptor-transmembrane residues involved in ligand binding and signal transduction. Eur J Biochem 251: 590–596.[Medline]
Guan XM, Amend A, and Strader CD (1995) Determination of structural domains for G protein coupling and ligand binding in beta3-adrenergic receptor. Mol Pharmacol 48: 492–498.[Abstract]
Hallbrink M, Floren A, Elmquist A, Pooga M, Bartfai T, and Langel U (2001) Cargo delivery kinetics of cell-penetrating peptides. Biochim Biophys Acta 1515: 101–109.[Medline]
Hausdorff WP, Campbell PT, Ostrowski J, Yu SS, Caron MG, and Lefkowitz RJ (1991) A small region of the beta-adrenergic receptor is selectively involved in its rapid regulation. Proc Natl Acad Sci USA 88: 2979–2983.
Higashijima T, Uzu S, Nakajima T, and Ross EM (1988) Mastoparan, a peptide toxin from wasp venom, mimics receptors by activating GTP-binding regulatory proteins (G proteins). J Biol Chem 263: 6491–6494.
Hirasawa A, Shibata K, Horie K, Takei Y, Obika K, Tanaka T, Muramoto N, Takagaki K, Yano J, and Tsujimoto G (1995) Cloning, functional expression and tissue distribution of human alpha 1c-adrenoceptor splice variants. FEBS Lett 363: 256–260.[CrossRef][Medline]
Hutchinson DS, Bengtsson T, Evans BA, and Summers RJ (2002) Mouse beta- 3a and beta 3b-adrenoceptors expressed in Chinese hamster ovary cells display identical pharmacology but utilize distinct signalling pathways. Br J Pharmacol 135: 1903–1914.[CrossRef][Medline]
Hutchinson DS, Sato M, Evans BA, Christopoulos A, and Summers RJ (2005a) Evidence for pleiotropic signalling at the mouse 3-adrenoceptor revealed by SR59230A [3-(2-ethylphenoxy)-1-[(1,5)-1,2,3,4-tetrahydronapth-1-ylamino]-2S-2-propanol oxalate]. J Pharmacol Exp Ther 312: 1064–1074.
Hutchinson DS, Sato M, Evans BA, Christopoulos A, and Summers RJ (2005b) Signalling pathways activated by SR59230A in CHO-K1 cells stably expressing the mouse B3-adrenoceptor, in Proceedings of the 4th British Pharmacological Society Focused Meeting on Cell Signalling; 2005 Apr 11–12; Leicester, UK. P071.
Krobert KA, Bach T, Syversveen T, Kvingedal AM, and Levy FO (2001) The cloned human 5-HT7 receptor splice variants: a comparative characterization of their pharmacology, function and distribution. Naunyn-Schmiedeberg's Arch Pharmacol 363: 620–632.[CrossRef][Medline]
Lindquist JM, Fredriksson JM, Rehnmark S, Cannon B, and Nedergaard J (2000) Beta 3- and alpha1-adrenergic Erk1/2 activation is Srcbut not Gi-mediated in Brown adipocytes. J Biol Chem 275: 22670–22677.
Marin EP, Krishna AG, Zvyaga TA, Isele J, Siebert F, and Sakmar TP (2000) The amino terminus of the fourth cytoplasmic loop of rhodopsin modulates rhodopsintransducin interaction. J Biol Chem 275: 1930–1936.
Martin NP, Whalen EJ, Zamah MA, Pierce KL, and Lefkowitz RJ (2004) PKA-mediated phosphorylation of the beta1-adrenergic receptor promotes Gs/Gi switching. Cell Signal 16: 1397–1403.[CrossRef][Medline]
Mizuno K, Kanda Y, Kuroki Y, and Watanabe Y (2000) The stimulation of beta(3)-adrenoceptor causes phosphorylation of extracellular signal-regulated kinases 1 and 2 through a G(s)-but not G(i)-dependent pathway in 3T3–L1 adipocytes. Eur J Pharmacol 404: 63–68.[CrossRef][Medline]
Namba T, Sugimoto Y, Negishi M, Irie A, Ushikubi F, Kakizuka A, Ito S, Ichikawa A, and Narumiya S (1993) Alternative splicing of C-terminal tail of prostaglandin E receptor subtype EP3 determines G-protein specificity. Nature (Lond) 365: 166–170.[CrossRef][Medline]
O'Dowd BF, Hnatowich M, Regan JW, Leader WM, Caron MG, and Lefkowitz RJ (1988) Site-directed mutagenesis of the cytoplasmic domains of the human beta 2-adrenergic receptor: localization of regions involved in G protein-receptor coupling. J Biol Chem 263: 15985–15992.
Pindon A, van Hecke G, van Gompel P, Lesage AS, Leysen JEE, and Jurzak M (2002) Differences in signal transduction of two 5-HT4 receptor splice variants: compound specificity and dual coupling with Gs and Gi/o-proteins. Mol Pharmacol 61: 85–96.
Pinna LA and Ruzzene M (1996) How do protein kinases recognize their substrates? Biochim Biophys Acta 1314: 191–225.[Medline]
Pooga M, Hallbrink M, Zorko M, and Langel U (1998) Cell penetration by transportan. FASEB J 12: 67–77.
Soeder KJ, Snedden SK, Cao W, Della Rocca GJ, Daniel KW, Luttrell LM, and Collins S (1999) The beta3-adrenergic receptor activates mitogen-activated protein kinase in adipocytes through a Gi-dependent mechanism. J Biol Chem 274: 12017–12022.
Soomets U, Lindgren M, Gallet X, Hallbrink M, Elmquist A, Balaspiri L, Zorko M, Pooga M, Brasseur R, and Langel U (2000) Deletion analogues of transportan. Biochim Biophys Acta 1467: 165–176.[Medline]
Vanetti M, Vogt G, and Hollt V (1993) The two isoforms of the mouse somatostatin receptor (mSSTR2A and mSSTR2B) differ in coupling efficiency to adenylate cyclase and in agonist-induced receptor desensitization. FEBS Lett 331: 260–266.[CrossRef][Medline]
van Spronsen A, Nahmias C, Krief S, Briend SM, Strosberg AD, and Emorine LJ (1993) The promoter and intron/exon structure of the human and mouse beta 3-adrenergic-receptor genes. Eur J Biochem 213: 1117–1124.[Medline]
Xiang Y, Devic E, and Kobilka B (2002) The PDZ binding motif of the beta 1 adrenergic receptor modulates receptor trafficking and signaling in cardiac myocytes. J Biol Chem 277: 33783–33790.
Xiang Y and Kobilka B (2003) The PDZ-binding motif of the beta2-adrenoceptor is essential for physiologic signaling and trafficking in cardiac myocytes. Proc Natl Acad Sci USA 100: 10776–10781.
This article has been cited by other articles:
|
|
 |
|
  M. Sato, T. Horinouchi, D. S. Hutchinson, B. A. Evans, and R. J. Summers Ligand-Directed Signaling at the beta3-Adrenoceptor Produced by 3-(2-Ethylphenoxy)-1-[(1,S)-1,2,3,4-tetrahydronapth-1-ylamino]-2S-2-propanol oxalate (SR59230A) Relative to Receptor Agonists Mol. Pharmacol., November 1, 2007; 72(5): 1359 - 1368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. He, A. Dibas, T. Yorio, and G. Prasanna Parallel Signaling Pathways in Endothelin-1-Induced Proliferation of U373MG Astrocytoma Cells Experimental Biology and Medicine, March 1, 2007; 232(3): 370 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. S. Dallner, E. Chernogubova, K. A. Brolinson, and T. Bengtsson {beta}3-Adrenergic Receptors Stimulate Glucose Uptake in Brown Adipocytes by Two Mechanisms Independently of Glucose Transporter 4 Translocation Endocrinology, December 1, 2006; 147(12): 5730 - 5739. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. R. Lenard, V. Prpic, A. W. Adamson, R. C. Rogers, and T. W. Gettys Differential coupling of beta3A- and beta3B-adrenergic receptors to endogenous and chimeric G{alpha}s and G{alpha}i Am J Physiol Endocrinol Metab, October 1, 2006; 291(4): E704 - E715. [Abstract] [Full Text] [PDF] |
