![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
INFLAMMATION AND IMMUNOPHARMACOLOGY
ISIS Pharmaceuticals, Carlsbad, California
Received January 19, 2005; accepted May 23, 2005.
| Abstract |
|---|
|
|
|---|
Bacterial DNA contains a much higher percentage of the unmethylated dinucleotide motif CpG (Krieg, 2002
). Short pieces of bacterial DNA containing the mouse optimal motif "GACGTT" were shown to activate cells of the innate immune system in vitro and in vivo (Ashkar and Rosenthal, 2002
). The activation of the innate immune system observed in response to CpG DNA was very similar to the response observed for lipopolysaccharide, another bacterial component. Cells of the innate immune system detect the presence of pathogens through the recognition of pathogen-associated molecular patterns (Elward and Gasque, 2003
). A large proportion of these pathogen-associated molecular patterns are recognized by a specific subset of receptors present on some cells, the Toll-like receptors (TLRs) (Netea et al., 2004
). TLRs represent a family of type I transmembrane receptors present on multiple cell types (O'Neill, 2002
). Studies involving knockout animals and cell types not expressing specific TLRs proved that the recognition of CpG DNA was dependent on TLR9 (Hemmi et al., 2000
). The activation of TLR9 by unmethylated synthetic or bacterial CpG oligonucleotides has been shown to activate a signal transduction pathway involving the adaptor protein MyD88 and to result in the activation of MAPK family members and the nuclear factor-
B pathway (Akira and Hemmi, 2003
). Stimulation leads to the increased production of multiple cytokines [in particular, interferons, interleukin (IL)-6, and IL-12], tumor necrosis factor-
, chemokines, the increased expression of costimulatory molecules, and antigen presentation by antigen presenting cells (Rothenfusser et al., 2002
). Once activated, innate immune cells then activate adaptive immunity and potentiate a T-helper 1 type immune response (Ashkar and Rosenthal, 2002
). Oligonucleotides exploiting this process are being developed for use as adjuvants, in cancer therapy and asthma and autoimmune disease treatment (Krieg, 2004
; Vollmer et al., 2004a
).
Recently, research has also shown that oligonucleotides devoid of CpG motifs are capable of eliciting a proinflammatory response in vivo and in vitro, but the role of TLR9 in this process is still unclear (Vollmer et al., 2004c
). A recent study by Trevani et al. (2003
) suggested that both single- and double-stranded DNA can activate human neutrophils to produce IL-8 and shed L-selectin, regardless of CpG presence (Trevani et al., 2003
). These data suggest that there is either another cofactor(s) or receptor involved in the recognition of non-CpG-containing DNA sequences.
Although oligonucleotides intended for antisense applications are designed to minimize the proinflammatory effects of ASO administration, they do not entirely eliminate them (Henry et al., 2000
). In this study, we chose to characterize the proinflammatory effect initiated by a non-CpG-containing 2'-O-methoxyethyl (MOE)-modified oligonucleotide. To determine whether the induction of inflammatory changes by 2'-MOE oligonucleotide was TLR-dependent, we used mice deficient in the expression of TLR9 and MyD88. Administration of ASOs subcutaneously caused an increase in spleen and/or liver weight, increased mRNA for multiple proinflammatory genes, increased tissue levels of several chemokines/cytokines, and led to increased infiltrates in liver. To determine whether the proinflammatory effects of these ASOs could be observed in cells isolated from these animals, we differentiated bone marrow from these animals using GM-CSF and stimulated the cells in vitro with oligonucleotides. Treatment of differentiated bone marrow indicated that cells devoid of either TLR9 or MyD88 retained the ability to activate in response to non-CpG oligonucleotide. Activation of these cells was associated with increased phosphorylation of ERK1/2 and increased production of several proinflammatory genes at the mRNA and protein level as measured by RT-PCR and ELISA. These data suggest that, in vivo and in vitro, there exists a distinct alternate pathway for the recognition and inflammatory response to short, non-CpG-containing oligonucleotides.
| Materials and Methods |
|---|
|
|
|---|
Animals. C57/BL6 background wild-type animals were purchased from Charles River Labs (San Diego, CA). Breeding pairs for TLR9 KO and MyD88 KO mice in C57/BL6 background were graciously donated by Dr. H. Hemmi (Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan) and bred at Charles River Laboratories (San Diego, CA). All animals were maintained in a sterile vivarium environment and kept on a 12-h light/dark cycle. Food and water was available ad libitum. Treatment with phosphate-buffered saline or filter-sterilized ASO was done by subcutaneous injection two times per week for 3 weeks at either 4 or 50 mg/kg using ISIS 12449 (CpG optimal phosphorothioate oligonucleotide backbone, ACCGATAACGTTGCCGGTGACG), ISIS 116847 [non-CpG, 2'-O-methoxyethyl (five terminal residues in both 5' and 3' termini, bold) phosphorothioate backbone modified oligonucleotide, CTGCTAGCCTCTGGATTTGA]. After treatment duration, animals were sacrificed, organs weighed, and tissue samples for histology, RNA, and protein for analysis were collected. Blood was collected by cardiac puncture at the time of sacrifice and processed to plasma for cytokine/chemokines evaluation.
Differentiation of Bone Marrow. Bone marrow was isolated from the femurs and tibia of wild-type, TLR9 KO, and MyD88 KO animals, depleted of erythrocytes, and cultured in Stemspan media (Stem Cell Technologies Inc.) plus 5% heat-inactivated fetal bovine serum (Invitrogen, Carlsbad, CA), 100 U/ml penicillin, 100 µg/ml streptomycin, antimycotic, and recombinant GM-CSF (10 ng/ml) was added to the culture to stimulate differentiation into immature dendritic cells. Half of the medium was removed every 2 days and replaced with fresh medium for 8 days. On day 8, cells were treated with 100 µg/ml CpG optimal (ISIS 12449) or 100 µg/ml non-CpG ASO (ISIS 116847) diluted in fresh medium and added directly to cells for 1 to 4 h for MAPK activation and for 4 h for cytokine/chemokine production.
RNA Isolation and RT-PCR Analysis. Portions of liver from treated animals were stored in RNA later (Ambion, Austin, TX) at time of sacrifice. RNA from cell lines or tissue was isolated using QIAGEN RNA Easy kit (QIAGEN, Valencia, CA). RT-PCR was performed using custom RT-PCR kits from Invitrogen on an ABI Prism using the following conditions: 48°C for 30-min reverse transcription step and then 95° C for 55 s, 60°C for 1.5 min, and 70°C for 60 s. The primer probe sets used are detailed in Table 1.
|
Western Blot Analysis. Cells were counted and plated in 12-well dishes at 1 x 106 cells/ml. Cells were treated with ASO diluted in fresh media and incubated for 1 h to activate ERK1/2. Cells were then lysed in 1x cell lysis buffer (Cell Signaling Technology, Inc.). Protein concentration was normalized using Bradford assay (Bradford, 1976
). Normalized protein was placed in equal volume of 2x Laemmli's sample buffer plus 5%
-mercaptoethanol, boiled 5 min, and then separated by 10% SDS-polyacrylamide gel electrophoresis. The separated proteins were transferred to Immobilon polyvinylidene difluoride membrane (Invitrogen) and then Western blotted as per manufacturer's instructions.
Cytokine Analysis. Tissue lysate or cell culture media were collected after treatment (3-week dose for plasma and 4-h treatment for cell culture). Then, 50 µl of sample was used to analyze chemokine production using R&D Systems ELISA kits. Each sample was loaded in duplicate, and the experiment was performed in triplicate. The sample was incubated for 2 h at room temperature in 96-well plates coated with appropriate antibody. The plates were then washed four times with wash buffer provided and incubated for another 2 h at room temperature with horseradish peroxidase-conjugated secondary antibody. After this incubation, the plates were washed four times again and incubated with colorimetric reagent for 30 min, and plates were read in a 96-well plate reader at 450 nM using 550 nM as background correction. Liver tissue lysates were created by homogenizing 100 mg of tissue in 1 ml of phosphate-buffered saline with added protease inhibitors (Calbiochem, San Diego, CA). The homogenized tissue was subjected to two freeze thaw cycles, and the lysates were cleared by centrifugation at 15,000 rpm for 10 min at 4°C. The supernatant was then sent to Pierce Endogen (Rockford, IL) for analysis on their SearchLight Multiplex cytokine assay system.
Statistical Analysis. All data were analyzed using analysis of variance, and errors represent the standard deviation of all experiments. p values less than 0.05 are considered significant.
| Results |
|---|
|
|
|---|
|
Increase in Expression of Proinflammatory Cell Marker Expression in Response to Non-CpG ASO Is Relatively TLR9-Independent. Next, the mRNA levels of multiple proinflammatory cell surface markers in the livers of treated animals were evaluated to further characterize the cellular infiltrate. It has been well documented that the administration of CpG-containing oligonucleotides causes a significant increase in the mRNA levels of multiple costimulatory molecules and cell surface markers of inflammatory cells (Anders et al., 2004
). Since a significant increase in the presence of immune cell infiltrates in liver was observed, the expression levels of several cell surface markers indicative of monocytic cells were evaluated. In wild-type animals, 4 mg/kg ISIS 12449 caused a substantial increase in the levels of multiple genes in the liver such as CD11b, CD11c, CD86, and CD68 mRNA (Fig. 2). As expected, treatment of TLR9 KO and MyD88 KO mice with 4 mg/kg ISIS 12449 resulted in a near complete absence of proinflammatory response (Fig. 2). These data strengthen previous reports that TLR9 and MyD88 are crucial to the proinflammatory response initiated by CpG-containing oligonucleotides. ISIS 116847 (50 mg/kg) was also capable of increasing the mRNA levels of multiple genes in the livers of treated animals. As shown in Fig. 2, treatment with 50 mg/kg ISIS 116847 resulted in an increased detection of CD11b, CD11c, CD68, and a small increase in CD86 detected in the livers of treated animals, although at a lower level than CpG-optimal oligonucleotide. Contrary to the results obtained with ISIS 12449, TLR9 KO mice responded with increases in mRNA for all markers examined, although the absolute levels are slightly lower for CD11b and CD68, after treatment with 50 mg/kg ISIS 116847. Additionally, MyD88 KO animals also exhibited an increase in multiple mRNA levels, particularly CD11c, and a smaller increase in CD86, CD11b, and CD68 expression than wild type or TLR9 KO. This response could be partially explained by the importance of MyD88 to other signal transduction pathways, specifically IL-1, IL-18, or other TLR receptors. These data indicate that non-CpG oligonucleotide ISIS 116847 can induce an activation of the immune system regardless of the presence of efficient TLR signal transduction.
|
, and IL-10), and a sampling of chemokines involved in monocyte migration and activation. This analysis indicated that the proinflammatory effects caused by ISIS 116847 generally resulted in a predominantly chemokine-driven response that is significantly different from CpG optimal responses previously published. More specifically, ISIS 116847 increased IL-1
(2-fold), IL-18 (5-fold), RANTES (7- to 8-fold), MCP-1 (4-fold), MCP-5 (3-fold), MIP-1
(10-fold), and MIP-2 (2-fold). Of note was the absence of an increase in IL-6, which has been the hallmark of CpG oligonucleotide-induced proinflammatory effects. Examination of the cytokine profile in TLR9 KO mice showed a nearly identical pattern of cytokine/chemokine expression after 3 weeks of treatment, with the addition of an increase in IFN
and a loss of the 2-fold increase in MIP-2 (Fig. 3B). Moreover, MyD88 knockout animals exhibited an increase in several of the same cytokine/chemokines (IL-1
, IL-18, RANTES, MCP-1, and MIP-1
; Fig. 3C). The slight differences in MyD88 KO mice may be explained by the importance of this adaptor to multiple other signal transduction pathways, including alternate TLRs such as TLR3 and 7. The preceding experiment provided further evidence that the non-CpG oligonucleotide ISIS 116847 can induce an inflammatory response in the absence of TLR9 and MyD88, suggesting an alternate mechanism of activation.
|
Differentiated Bone Marrow from Wild-Type, TLR9 KO, and MyD88 KO Mice Is Activated in Response to Treatment with Non-CpG Oligonucleotide ISIS 116847. In vivo data from the previous experiments indicated that non-CpG-containing oligonucleotides could stimulate a proinflammatory response, but it was not clear whether this was through direct or indirect stimulation. It has been shown that CpG oligonucleotides directly stimulate macrophage/dendritic cells of the innate immune system. To examine the direct effects of non-CpG oligonucleotide administration on cells of the innate immune system, we isolated bone marrow from wild-type and knockout animals and differentiated the cells in vitro. These cells were differentiated into immature dendritic cells/granulocytes by culturing in the presence of the cytokine GM-CSF. After 4 h of treatment with either CpG-containing ISIS 12449 or non-CpG-containing oligonucleotide ISIS 116847, the conditioned media were isolated and analyzed for expression of the chemokine MIP-2. Treatment of wild-type bone marrow-derived cells with ISIS 12449 resulted in a significant (7-fold) increase in MIP-2 production compared with untreated cells (Fig. 4B). However, when bone marrow-derived cells from TLR9 knockout mice were treated with 100 µg/ml ISIS 12449, the resulting MIP-2 production was dramatically lower (<2-fold). This indicates that a significant portion of CpG PS ODN-induced MIP-2 production is driven through the TLR9 pathway, but it does suggest that at high doses, at least part of the response is due to a TLR9-independent pathway. The data shown in Fig. 4B indicate that treatment with non-CpG oligo results in a significant (2- to 3-fold) increase in MIP-2 production in wild-type bone marrow. Treatment of knockout bone marrow derived cells with 100 µg/ml ISIS 116847 similarly resulted in a 2- to 3-fold increase in MIP-2 production. These data indicate that non-CpG oligonucleotides can directly stimulate cells of the innate immune system and induce the activation of a proinflammatory response independent of TLR9 or MyD88 proteins and suggests that the response observed in vivo is indicative of immune activation and not a secondary response to cellular damage of the surrounding tissue.
|
| Discussion |
|---|
|
|
|---|
, IL-12, and IL-6) and strongly inducing antigen presentation (Krieg, 2002
Wild-type and knockout mouse models showed a similar pattern of cytokine/chemokine expression in liver tissue after treatment with non-CpG-containing oligos, suggesting the activation of an alternate pathway. Cytokine expression patterns were characterized by an increase in IL-1
, IL-18, RANTES, MCP-1, MCP-5, and MIP-1
. The pattern of cytokine/chemokines observed in response to ISIS 116847 were nearly identical in pattern regardless of TLR9 or MyD88 presence, but the magnitude of a few chemokine/cytokines such as MCP5 and IL-18 seemed to differ in MyD88 KO animals. This can be explained, at least in part, by the importance of MyD88 to multiple signal transduction pathways, such as IL-1, IL-18, and alternate TLRs, which may augment or have additional importance in the inflammatory response to non-CpG oligonucleotides. The levels of multiple cell surface markers in liver indicative of monocytic cells increased in knockout and wild-type mice.
Primary bone marrow was treated with GM-CSF to drive the formation of immature dendritic cells and granulocytes, thereby providing a model of similar cell types to those present in the tissue itself. In bone marrow-derived cells from knockout and wild-type mice, direct administration of non-CpG oligos caused the production of MIP-2 and activation of ERK1/2. In contrast, the cellular response to an optimal dose of CpG-containing oligonucleotide was significantly diminished in TLR9 knockout cells, consistent with previously published data (Yi et al., 2002
). Interestingly, the production of MIP-2 was still observed, at much lower levels (approximately 2-fold induction), from TLR9 and MyD88 bone marrow-derived cells treated with high concentrations (100 µg/ml CpG oligo and non-CpG-containing PS-ODNs; data not shown). This may suggest that the TLR9-independent mechanism is not unique to 2'-MOE-modified oligonucleotides. These data suggest that the proinflammatory effect caused by non-CpG oligonucleotides is through a direct or primary effect on immune cells and not through a secondary response to nonimmune cell damage.
The relative potency of proinflammatory change and the spectrum of cytokine/chemokines production induced by non-CpG oligonucleotides are very divergent from that known to occur with CpG-optimal oligos. Non-CpG oligo required
10-fold higher than the dose of CpG-optimal oligo to increase spleen weight, and the magnitude of spleen weight increase was markedly greater for CpG oligonucleotide. Splenomegaly induced by non-CpG oligonucleotide was relatively subtle (
2-fold increase). This pattern of higher concentrations and lower magnitude of response was also observed in the activation of isolated bone marrow-derived cells with non-CpG optimal oligos. Although both oligonucleotides stimulated ERK1/2 activation, the amount of chemokines produced was markedly greater for CpG-optimal oligonucleotides in wild-type cells. The pattern of cytokine/chemokine production previously reported in response to CpG oligonucleotides favors a T-helper 1 pattern typified by IFN
, IL-6, and IL-12. By comparison, high-dose non-CpG oligonucleotide responses are dominated by chemokines, and a notable absence of IL-6 and IFN
induction. This difference in cytokine production is consistent with a relatively mild increase in spleen weight for non-CpG oligonucleotides. The absence of an increase in spleen weight in MyD88 KO mice indicates the possibility that alternate TLRs may participate in the immune response to non-CpG-containing oligonucleotides. These relative differences suggest a different mechanism of action for CpG (TLR9) and non-CpG oligonucleotides.
Other TLR receptors have recently been implicated in the recognition of oligonucleotides, particularly RNA molecules (Heil et al., 2004
; Karikó et al., 2004b
). TLR3 has been hypothesized to interact with double-stranded RNA molecules and initiate a potent antiviral response (Doyle et al., 2003
; Karikó et al., 2004a
) and can also recognize endogenous mRNA molecules from dying cells or produced from RNA viruses (Karikó et al., 2004b
). TLR7, known to recognize nucleoside analogs such as R-848, has also been shown to be activated by mRNA molecules (Akira and Hemmi, 2003
). It is possible that either TLR3 or 7 may play a role in the recognition of non-CpG-containing antisense oligonucleotides. Studies using TLR7 ligands have shown that MyD88 is required to elicit a detectable inflammatory response (Matsushima et al., 2004
; Nishiya and DeFranco, 2004
). Our data suggest that some or most of the immune response to non-CpG-containing oligos is independent of MyD88, and therefore argues against involvement of TLR7. TLR3 also uses the adaptor protein MyD88, but it has been shown to signal through alternate TIR-domain-containing adaptors such as TRIF, leaving open the possibility that non-CpG-containing oligonucleotides are recognized by TLR3 (Takeda and Akira, 2004
). However, recent unpublished evidence from our laboratory suggests that TLR3-overexpressing HEK293 cells do not respond to non-CpG oligonucleotides. This evidence does not irrefutably discount alternate TLRs in the recognition of non-CpG oligos, but it provides the framework to suggest that other families of receptor molecules may play a role. It has been hypothesized that the scavenger receptors or alternate pattern recognition receptors may play an important role. This research provides several key points of evidence that illustrate a possible TLR9-independent mechanism for proinflammatory stimulation by non-CpG oligonucleotides. The activation of proinflammatory response in vivo is independent of TLR9 and MyD88, and isolated bone marrow-derived cells respond to non-CpG oligos in the absence of either TLR9 or MyD88. However, there did seem to be some reduction in the degree of proinflammatory response in MyD88 KO mice, which is possibly consistent with recent evidence suggesting that either TLR3 or 7 could play a role in the activation. Previously published work (Roberts et al., 2005
) suggests that at lower concentrations or doses, TLR9 may play an important role in the response to non-CpG-containing oligonucleotides, but the data presented in this article provide evidence that a majority of the response to non-CpG-containing 2'-MOE-modified oligonucleotides and possibly PS ODNs may be TLR9-independent. Future experiments will be directed at the discovery of alternate receptors and the importance of backbone modifications in TLR9-independent proinflammatory responses.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: ASO, antisense oligonucleotide; TLR, Toll-like receptor; IL, interleukin; MAPK, mitogen-activated protein kinase; MOE, methoxyethyl; MyD88, myeloid differentiation factor 88; GM-CSF, granulocyte macrophage-colony-stimulating factor; ERK, extracellular signal-regulated kinase; RT-PCR, reverse transcriptase-polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; MIP, migration inhibitory protein; KO, knockout; IFN, interferon; RANTES, regulated upon activation, normal T-cell expressed, and presumably secreted; MCP, monocyte chemoattractant protein; PS ODN, phosphorothioate-modified oligodeoxyribonucleotide.
Address correspondence to: Dr. Scott P. Henry, Department of Toxicology, ISIS Pharmaceuticals, 2292 Faraday Ave., Carlsbad, CA 92008. E-mail: shenry{at}isisph.com
| References |
|---|
|
|
|---|
Akira S and Hemmi H (2003) Recognition of pathogen-associated molecular patterns by TLR family. Immunology 85: 8595.
Anders H-J, Banas B, and Schlondorff D (2004) Signaling danger: Toll-like receptors and their potential roles in kidney disease. J Am Soc Nephrol 15: 854867.
Ashkar AA and Rosenthal KL (2002) Toll-like receptor 9, CpG DNA and innate immunity. Curr Mol Med 2: 545556.[CrossRef][Medline]
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254.[CrossRef][Medline]
Cowsert LM (1997) In vitro and in vivo activity of antisense inhibitors of ras: potential for clinical development. Anticancer Drug Des 12: 359371.[Medline]
Crooke ST (2004) Antisense strategies. Curr Mol Med 4: 465487.[CrossRef][Medline]
Doyle SE, O'Connell R, Vaidya SA, Chow EK, Yee K, and Cheng G (2003) Toll-like receptor 3 mediates a more potent antiviral response than Toll-like receptor 4. J Immunol 170: 35653571.
Elward K and Gasque P (2003) "Eat me" and "don't eat me" signals govern the innate immune response and tissue repair in the CNS: emphasis on the critical role of the complement system. Mol Immunol 40: 8594.[CrossRef][Medline]
Heil F, Hemmi H, Hochrein H, Ampenberger F, Kirschning C, Akira S, Lipford G, Wagner H, and Bauer S (2004) Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science (Wash DC) 303: 15261529.
Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, et al. (2000) A Toll-like receptor recognizes bacterial DNA. Nature (Lond) 408: 740745.[CrossRef][Medline]
Henry SP, Stecker K, Brooks D, Monteith D, Conklin B, and Bennett CF (2000) Chemically modified oligonucleotides exhibit decreased immune stimulation in mice. J Pharmacol Exp Ther 292: 468479.
Jiang ZH and Koganty RR (2003) Synthetic vaccines: the role of adjuvants in immune targeting. Curr Med Chem 10: 14231439.[CrossRef][Medline]
Karikó K, Bhuyan P, Capodici J, and Weissman D (2004a) Small interfering RNAs mediate sequence-independent gene suppression and induce immune activation by signaling through toll-like receptor 3. J Immunol 172: 65456549.
Karikó K, Ni H, Capodici J, Lamphier M, and Weissman D (2004b) mRNA is an endogenous ligand for Toll-like receptor 3. J Biol Chem 279: 1254212550.
Krieg AM (2002) CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 20: 709760.[CrossRef][Medline]
Krieg AM (2004) Antitumor applications of stimulating toll-like receptor 9 with CpG oligodeoxynucleotides. Curr Oncol Rep 6: 8895.[Medline]
Matsushima H, Yamada N, Matsue H, and Shimada S (2004) TLR3-, TLR7- and TLR-9-mediated production of proinflammatory cytokines and chemokines from murine connective tissue type skin-derived mast cells but not from bone marrow-derived mast cells. J Immunol 173: 531541.
Molne L, Collins VL, and Tarkowski A (2003) Inflammatogenic properties of bacterial DNA following cutaneous exposure. J Investig Dermatol 121: 294299.[CrossRef][Medline]
Mutwiri G, Pontarollo R, Babiuk S, Griebel P, van Drunen Littel-van den Hurk S, Mena A, Tsang C, Alcon V, Nichani A, Ioannou X, et al. (2003) Biological activity of immunostimulatory CpG DNA motifs in domestic animals. Vet Immunol Immunopathol 91: 89103.[CrossRef][Medline]
Netea MG, van der Graaf C, Van der Meer JW, and Kullberg BJ (2004) Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system. J Leukoc Biol 75: 749755.
Nishiya T and DeFranco AL (2004) Ligand-regulated chimeric receptor approach reveals distinctive subcellular localization and signaling properties of the Toll-like receptors. J Biol Chem 279: 1900819017.
O'Neill LA (2002) Signal transduction pathways activated by the IL-1 receptor/toll-like receptor superfamily. Curr Top Microbiol Immunol 270: 4761.[Medline]
Roberts TL, Sweet MJ, Hume DA, and Stacey KJ (2005) Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides. J Immunol 174: 605608.
Rothenfusser S, Tuma E, Endres S, and Hartmann G (2002) Plasmacytoid dendritic cells: the key to CpG. Hum Immunol 63: 11111119.[CrossRef][Medline]
Schwarz K, Storni T, Manolova V, Didierlaurent A, Sirard J-C, Rothlisberger P, and Bachmann MF (2003) Role of Toll-like receptors in costimulating cytotoxic T cell responses. Eur J Immunol 33: 14651470.[CrossRef][Medline]
Takeda K and Akira S (2001) Roles of Toll-like receptors in innate immune responses. Genes Cells 6: 733742.[Abstract]
Takeda K and Akira S (2004) TLR signaling pathways. Semin Immunol 16: 39.[CrossRef][Medline]
Trevani AS, Chorny A, Salamone G, Vermeulen M, Gamberale R, Schettini J, Raiden S, and Geffner J (2003) Bacterial DNA activates human neutrophils by a CpG-independent pathway. Eur J Immunol 33: 31643174.[CrossRef][Medline]
Vollmer J, Rankin R, Hartmann H, Jurk M, Samulowitz U, Wader T, Janosch A, Schetter C, and Krieg AM (2004a) Immunopharmacology of CpG oligodeoxynucleotides and ribavirin. Antimicrob Agents Chemother 48: 23142317.
Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht M, Wader T, Tluk S, Liu M, Davis HL, et al. (2004b) Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol 34: 251262.[CrossRef][Medline]
Vollmer J, Weeratna RD, Jurk M, Samulowitz U, McCluskie MJ, Payette P, Davis HL, Schetter C, and Krieg AM (2004c) Oligodeoxynucleotides lacking CpG dinucleotides mediate Toll-like receptor 9 dependent T helper type 2 biased immune stimulation. Immunology 113: 212223.[CrossRef][Medline]
Yacyshyn B, Bowen-Yacyshyn MB, and Shanahan W (1999) The clinical experience of antisense therapy to ICAM-1 in Crohn's disease. Curr Opin Mol Ther 1: 332335.[Medline]
Yi A-K, Yoon J-G, Yeo S-J, Hong S-C, English BK, and Krieg AM (2002) Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response. J Immunol 168: 47114720.
Zhao H, Hemmi H, Akira S, Cheng SH, Scheule RK, and Yew NS (2004) Contribution of Toll-like receptor 9 signaling to the acute inflammatory response to nonviral vectors. Mol Ther 9: 241248.[Medline]
This article has been cited by other articles:
![]() |
M. A. Merrell, J. M. Ilvesaro, N. Lehtonen, T. Sorsa, B. Gehrs, E. Rosenthal, D. Chen, B. Shackley, K. W. Harris, and K. S. Selander Toll-Like Receptor 9 Agonists Promote Cellular Invasion by Increasing Matrix Metalloproteinase Activity Mol. Cancer Res., July 1, 2006; 4(7): 437 - 447. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||