QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.105.085399v1 314/2/789    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Masuyama, A. Articles by Watanabe, Y. Search for Related Content PubMed PubMed Citation Articles by Masuyama, A. Articles by Watanabe, Y.

ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION

Role of N-Terminal Amino Acids in the Absorption-Enhancing Effects of the C-Terminal Fragment of Clostridium perfringens Enterotoxin

Department of Pharmaceutics and Biopharmaceutics, Showa Pharmaceutical University (A.M., M.K., H.S., A.T., M.H., M.F., Y.W.), Machida, Tokyo, Japan; Project III, National Institute of Biomedical Innovation (H.M.), Osaka, Japan; and Department of Bacterial Toxinology, Research Institute for Microbial Diseases, Osaka University (Y.H.), Osaka, Japan

Received February 24, 2005; accepted April 14, 2005.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
We recently found that a polypeptide, the C-terminal of Clostridium perfringens enterotoxin (C-CPE), was a novel type of drug absorption enhancer. The C-terminal of C-CPE is thought to play a role in the binding of C-CPE to its receptor, claudin-4; however, the function of the N-terminal of C-CPE is unclear. In the present study, we evaluated the role of the N-terminal domain of C-CPE in jejunal absorption and claudin-4 binding. The treatment of rat jejunum with C-CPE resulted in enhanced absorption of dextran, with a molecular weight of 4000 Da. However, treatment with C-CPE220, which lacks the 36 N-terminal amino acids of C-CPE, did not enhance jejunal absorption. C-CPE had affinity for claudin-4 in rat jejunum lysates and Caco-2 lysates, but C-CPE220 did not. Interaction of C-CPE with the recombinant extracellular domain 2 of human claudin-4 (EC2hCld-4), which is the putative binding site for C-CPE, was observed, but C-CPE220 had no affinity for EC2hCld-4. To investigate the effect of C-CPE220 on the barrier function of tight junctions, we measured transepithelial electric resistance (TER) in C-CPE- or C-CPE220-treated Caco-2 monolayer cells. Although C-CPE decreased TER in Caco-2 monolayer cells, C-CPE220 did not disrupt the barrier function of tight junctions. Together, these results indicate that the 36 N-terminal amino acids of C-CPE may be necessary for the enhanced absorption mediated by C-CPE and play a partial role in binding to claudin-4.

Clostridium perfringens enterotoxin (CPE), a single polypeptide with a molecular weight of 35 kDa, is the causative agent of symptoms associated with Clostridium perfringens food poisoning in humans (McClane et al., 1988). CPE produced in the intestinal tract during sporulation injures intestinal epithelial cells and causes fluid accumulation in the intestinal cavity, which results in diarrhea (Stark and Duncan, 1971). This effect of CPE is caused by the binding of COOH terminus fragment (C-CPE) to its receptors, an unknown 45- to 50-kDa protein and the 23-kDa protein (CPE-R), which consists of 209 amino acids and contains four putative transmembrane domains (McClane and Chakrabarti, 2004). After C-CPE binds to CPE-R, pores form on the mucosal membrane; these pores cause massive changes in small molecule permeability, osmotic cell ballooning, and cytolysis (McClane, 1984; Wieckowski et al., 1994; Katahira et al., 1997). Recently, the CPE-R was identified as claudin-4, a member of the claudin multigene family (Sonoda et al., 1999). Functional domain mapping of the full-length 319 amino acid CPE protein proved that the CPE290 to CPE319 C-CPE is sufficient for high-affinity binding to the target cell receptor; however, C-CPE is incapable of initiating cytolysis (Kokai-Kun and McClane, 1996, 1997a,b). C-CPE inhibited the barrier function of claudin-4 in MDCK monolayer cells (Sonoda et al., 1999). We found that C-CPE enhanced drug absorption in rat jejunum without any cytotoxic effects. The drug absorption ability was enhanced 400-fold compared with that of a clinically used enhancer (Kondoh et al., 2005). Thus, C-CPE has the potential to be a useful component of drug delivery systems. Functional domain mapping of C-CPE on modulation of claudin-4 is very useful. Although we found that the interaction of C-CPE with claudin-4 via its C-terminal region was responsible for enhanced drug absorption, the detail functional domain of C-CPE to affect TJs is unclear.

In the present study, we evaluated the ability of an NH₂-terminal region of C-CPE to affect TJ barriers and interact with claudin-4. The deletion of 36 amino acids in the N-terminal of C-CPE resulted in decreased affinity for claudin-4 and attenuated TJ modulation. Thus, the 36 amino acids in the N-terminal of C-CPE are necessary for enhanced drug absorption.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Animals. Male Wistar rats, weighing 250 to 280 g, were purchased from Japan Laboratory Animals, Inc. (Tokyo, Japan). The rats were cared for according to the guidelines of the ethics committee of Showa Pharmaceutical University, Machida, Tokyo, Japan. The rats were maintained in a room at 23 ± 1.5°C with a 12-h light/dark cycle and were allowed free access to standard rodent chow and water. After their arrival, the rats were given at least 1 week to adapt before the experiments began.

Cell Cultures. Human intestinal epithelial cell line Caco-2 cells are maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum in a 5% CO₂ atmosphere at 37°C. For experiments monitoring the effects of C-CPE on TJ permeability, the cells were seeded Transwell on polycarbonate filter cell culture chamber inserts (6.5-mm diameter, 0.03 cm² area, 0.45-µm pore diameter; Costar Europe, Badhoevedorp, The Netherlands). The cells were used for experiments 14 to 21 days after seeding. Passages 60 through 65 were used.

Preparation of 30-Amino Acid Polypeptide. A polypeptide corresponding to 30 amino acids from the C-terminal of C-CPE (NH₂-SLDAGQYVLVMKANSSYSGNYPYSILFQKF-OH) was obtained from Bio-Synthesis (Lewisville, TX). The purity of the peptide was >95%. The peptide was dissolved in phosphate-buffered saline (PBS) buffer and stored at -80°C before use.

Preparation of His-Fused C-CPE220 and C-CPE. To generate histidine-tagged C-CPE220, which lacks the 36 N-terminal amino acids of C-CPE, we used pETH₁₀PER as a template (Katahira et al., 1997). The template was subjected to polymerase chain reaction using the following oligonucleotides: ctcgaggctggtaatttatatgattgg (sense primer for C-CPE220; the underline indicates XhoI site), ctcgagagatgtgttttaacagttcca (sense primer for C-CPE; the underline indicates XhoI site), and ggatcctaaaatttttgaaataatattga (common antisense primer; the underline indicates BamHI site). The resultant fragments of C-CPE220 and C-CPE were subcloned into pGEMTT-Easy vector (Promega, Madison, WI). The sequences of the fragments were confirmed. C-CPE220 was prepared as follows: pGEMTT-Easy vector with C-CPE220 was digested with XhoI/BamHI, and the resultant XhoI-BamHI fragment was inserted into the identical site of pET16b vector. The pET16b plasmid with C-CPE220 was transduced into Escherichia coli BL21 (DE3), and the production of C-CPE was stimulated by the addition of isopropyl--D-thiogalactopyranoside. The cells were harvested and lysed in buffer A [200 mM phosphate (pH 7.5) and 500 mM NaCl] containing 8 M urea. The lysates were centrifuged, and the resultant supernatant was incubated with Ni-NTA resin (Invitrogen, Carlsbad, CA). C-CPE220 and C-CPE were eluted in a gradient of 0 to 500 mM imidazole in buffer A. The purification of C-CPE220 and C-CPE was confirmed by SDS-PAGE and Western blotting with a His-tagged antibody (Merck, Darmstadt, Germany) (Fig. 3).

View larger version (34K): [in this window] [in a new window]   Fig. 3. Purification of C-CPE220. Recombinant C-CPEs were prepared as described in Materials and Methods. His-tagged C-CPE and C-CPE220 were subjected to SDS-PAGE, followed by staining with Coomassie Brilliant Blue (CBB), and immunoblot analysis using anti-His-tagged antibody was also performed. WB, Western blot.

Interaction of Claudin-4 and C-CPEs. To investigate the interactions between claudin-4 and C-CPEs, we used lysates of rat jejunum and Caco-2, in which claudin-4 protein was expressed (Rahner et al., 2001; Singh et al., 2001). Rat mucosa of the corresponding region of the jejunum used in the in situ loop assay was collected with a scraper and washed twice with ice-cold PBS. The mucosa and Caco-2 were lysed in PBS containing 1% protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO). The concentrations of protein were determined with a commercially available protein assay kit using bovine serum albumin as a protein standard (Pierce, Rockford, IL). After 30 min of incubation of C-CPEs and the lysates at 37°C, nickel beads were incubated with the mixture for an additional 3 h at 4°C. Then, the beads were washed with the lysis buffer, and the complexes that were bound to the beads were solubilized in SDS sample buffer. The complexes were subjected to SDS-PAGE followed by Western blotting for anti-His Ab and anti-claudin-4 Ab (Zymed Laboratories, South San Francisco, CA). Ab-reacted bands were detected using horseradish peroxidase-labeled secondary Ab and enhanced chemiluminescence reagents (Amersham Biosciences Inc., Piscataway, NJ).

Preparation of Glutathione S-Transferase (GST)-Fused EC2hCld-4. To subclone the extracellular domain 2 of human claudin-4 (EC2hCld-4) (141–210 aa), we used a human placenta cDNA library (TaKaRa, Shiga, Japan) as a template. The template was subjected to polymerase chain reaction using gaattccacaacatcatccaagacttctac (the underline indicates EcoRI site) as the sense primer and aagcttacacgtagttgctggcagc (the underline indicates HindIII site) as the antisense primer. The resultant fragments of EC2hCld-4 were subcloned into pGEMTT vector (Promega). The sequences of the fragments were confirmed. The EcoRI-NotI site of pGEMTT-Easy vector with EC2hCld-4 was inserted into the corresponding site of pGEX4T-1 plasmid (Amersham Biosciences Inc.). The GST-fused EC2hCld-4 (GST/EC2hCld-4) was prepared as described previously (Frangioni and Neel, 1993). Briefly, pGEX4T-1 plasmid with EC2hCld-4 was introduced into the E. coli BL21 (DE3) strain, and expression of the GST/EC2hCld-4 was induced with isopropyl -D-thiogalactopyranoside. The E. coli cells were harvested and lysed in STE buffer [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1 mM EDTA] containing 100 µg/ml lysozyme, 5 mM dithiothreitol, and 1.5% N-lauroylsarcosine. The lysates were centrifuged, and 2% Triton X-100 was added to the supernatant. The supernatant was reacted with glutathione-agarose beads, and the beads were washed with STE buffer. GST/EC2hCld-4 was eluted from the glutathione-agarose beads with STE buffer containing 50 mM glutathione. The solvent of the elutions was exchanged into PBS by dialysis (Amersham Biosciences Inc.). The purification of GST/EChCld-4 was confirmed by SDS-PAGE followed by staining with Coomassie Brilliant Blue and by Western blotting with a GST-tagged antibody (data not shown).

Enzyme-Linked Immunosorbent Assay. Immunoplates (NUNC A/S, Roskilde, Denmark) were coated with 10 µg/ml GST or GST/EC2hCld-4 in 50 mM bicarbonate buffer. After washing the wells with T-TBS (20 mM Tris-HCl pH 7.4, 40 mM NaCl, and 0.05% Tween 20), the wells were blocked with 1% gelatin in TBS (20 mM Tris-HCl, pH 7.4, and 40 mM NaCl) for 2 h at room temperature, and then C-CPEs were added to the wells at the indicated concentrations. After 2 h of incubation at room temperature, the wells were washed once with T-TBS and incubated with anti-His tagged antibody (Novagen) for 2 h at room temperature. Then, the wells were washed with T-TBS followed by 2 h of incubation with horseradish peroxidase-labeled antibody at room temperature. After washing with T-TBS three times and then with distilled water, 3,3', 5,5'-tetramethylbenzidine was used as a substrate for the labeled antibody. After 10 min of incubation, the color development was terminated by addition of 2 N H₂SO₄. The reaction product was detected by spectrometry at 450 nm. The background reactivity due to nonspecific binding of secondary antibodies was subtracted from the reactivity observed in the presence of primary antibodies.

View larger version (12K): [in this window] [in a new window]   Fig. 1. Schematic representation of C-CPEs and 30-aa peptides used in this study. C-CPE is the C-terminal fragment from amino acid 184 to amino acid 319 of CPE. C-CPE220 does not contain the 36 N-terminal amino acids of C-CPE. The 30-aa peptide consists of only the putative binding region of CPE (Hanna et al., 1991).

View larger version (18K): [in this window] [in a new window]   Fig. 2. Effect of receptor-binding domain of CPE on jejunal absorption. Rat jejunum was treated with vehicle or 30-aa peptide. At the indicated point, blood was collected from the jugular vein, and the FD-4 levels in the plasma were measured with a fluorometer (A). The AUC between 0 and 4 h after the treatment was calculated (B). Data are representative of at least three independent experiments. *, significant difference from the vehicle-treated group (p < 0.05). Data are means ± S.E. (n = 4).

View larger version (25K): [in this window] [in a new window]   Fig. 4. Effects of C-CPE220 on jejunal absorption in rats. A and B, modulation of rat jejunal absorption of dextran by C-CPE. The effect of C-CPE220 on absorption was assayed by in situ loop assay using rat jejunum. After treatment of rat jejunum with C-CPE or C-CPE220 (0.1 and 0.2 mg/ml), time course changes in plasma FD-4 levels were measured at the indicated periods (A). The AUC value between 0 and 4 h after the treatment was calculated by the trapezoidal method (B). Data are representative of three independent experiments. *, significantly different from the vehicle-treated group (p < 0.05). Data are means ± S.E. (n = 4). C, interaction of C-CPE220 and claudin-4 in a lysate of rat jejunum. Ten micrograms of C-CPE or C-CPE220 was incubated with the lysate of rat jejunum (200 µg of protein) for 30 min at 37°C. Ni-NTA resin was added, and the mixture was incubated for an additional 3 h at 4°C. Then the samples were centrifuged, and the resultant supernatant fraction (Sup) was prepared. The precipitated resin was washed with the buffer for pull down. The resultant precipitated fraction containing resin (Ppt) was prepared. The Sup and Ppt fractions were subjected to SDS-PAGE followed by immunoblotting using anti-His tagged antibody or anti-claudin-4 antibody. Data are representative of four independent experiments.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Effects of the N-Terminal Region of C-CPE on the Interaction with Claudin-4. The functional domain of CPE has been investigated (Horiguchi et al., 1986, 1987; Hanna et al., 1991, 1992), and the 30 amino acids at the carboxyl terminal (corresponding to CPE289–319) were speculated to be responsible for the binding of CPE to its receptor (Hanna et al., 1991). C-CPE is the C-terminal fragment of CPE that corresponds to CPE184 to CPE319 (Katahira et al., 1997). We first investigated whether the putative binding region of C-CPE, the 30-aa polypeptide identical to CPE289 to CPE319 (Fig. 1), can modulate jejunal absorption of FD-4. As indicated in Fig. 2, A and B, treatment with C-CPE (0.1 mg/ml) resulted in 12.5-fold increased absorption of FD-4 compared with the vehicle-treated group. However, the 30-aa peptide did not modulate absorption of FD-4 at 0.2 mg/ml. These data indicate that the 30-aa peptide was not enough to modulate absorption. So we next evaluated the involvement of the N-terminal region of C-CPE in the interaction of C-CPE and claudin-4. For this purpose, we prepared recombinant His-tagged C-CPE and C-CPE220, in which the 36 N-terminal amino acids are deleted (Fig. 3). We tried to prepare histidine-fused C-CPE255 and -290, which lacks the 71 N-terminal amino acids and 105 N-terminal amino acids, respectively, but we had no success to prepare them. Therefore, we analyzed effects of C-CPE220 and the synthetic 30-aa polypeptides corresponding to C-CPE290. The molecular weights of the recombinant C-CPEs were confirmed to be the theoretical values (C-CPE, 18 kDa; C-CPE220, 13.8 kDa).

Effects of C-CPE220 on Jejunal Absorption. Since C-CPE has been reported to influence epithelial barrier function in epithelial monolayer cells and enhance the absorption of dextran with a molecular weight of 4000 Da in rat jejunum (Sonoda et al., 1999; Kondoh et al., 2005), we analyzed the effects of C-CPE220 on epithelial barrier function and dextran absorption. To evaluate the effect of C-CPE220 on jejunal absorption in rats, we performed in situ loop assays in rat jejunum, as described previously (Kondoh et al., 2005). Figure 4A shows time course changes in typical plasma FD-4 levels after treatment of the jejunum with C-CPE or C-CPE220. Treatment with C-CPE resulted in absorption of dextran with a molecular weight of 4000 Da. The AUC_0–4 values in the C-CPE-treated group are 5.3-fold compared with vehicle treatment [AUC_0–4 = 2.11 ± 0.25 µg · h/ml in vehicle-treated group; AUC_0–4 = 11.14 ± 2.30 µg · h/ml in C-CPE (0.1 mg/ml)-treated group] (Fig. 4B). However, treatment with C-CPE220 did not elevate the absorption of dextran [AUC_0–4 = 2.05 ± 0.10 µg · h/ml in C-CPE220 (0.1 mg/ml)-treated group]. These data indicate that the 36 amino acids at the N-terminal of C-CPE might be responsible for enhanced absorption in rat jejunum. To evaluate the interaction between C-CPE220 and claudin-4 in the lysates of rat jejunum, C-CPE or C-CPE220 was incubated with a lysate of rat jejunum, followed by precipitation of the C-CPEs with nickel resin. Interaction between C-CPE220 and claudin-4 was not observed in rat jejunal lysate (Fig. 4C). These data indicate that the 36 amino acids at the N-terminal of C-CPE may play a role in the absorption-enhancing effects of C-CPE.

Effects of C-CPE220 on Tight-Junction Permeability in Caco-2 Monolayer. We investigated whether treatment with C-CPE220 resulted in modulation of tight-junction permeability in Caco-2 monolayer, which is a popular model for determination of effects on permeability of tight junction in human intestinal mucosa. At first, we evaluated the binding of C-CPE220 to claudin-4 in Caco-2 lysate. Comparing the claudin-4 levels in the supernatant fraction and the precipitated fraction, we found that the precipitated levels of claudin-4 by treatment with C-CPE220 were less than those by treatment with C-CPE (Fig. 5A). Since C-CPE interacted with claudin-4 via the extracellular domain 2 of claudin (Fujita et al., 2000), we evaluated the interaction of the extracellular domain 2 of claudin-4 (EC2hCld-4) and C-CPEs by enzyme-linked immunosorbent assay using glutathione-S transferase-fused EC2hCld-4 (GST/EC2hCld-4). As shown in Fig. 5B, C-CPE interacted with EC2hCld-4 in a dose-dependent manner (12.5–25 µg/ml). Interaction between C-CPE220 and EC2hCld-4 was not observed at 25 µg/ml. Next, we investigated the effect of C-CPE220 on tight-junction barriers in Caco-2 monolayer. Confluent Caco-2 monolayers grown on Transwell were incubated with C-CPEs or 30-aa peptides, and the tight-junction barrier was determined by measurement of TER. Incubation with C-CPE induced a time- and dose-dependent fall in TER. Significant fall (from 591 ± 20 · cm² to 497 ± 22 · cm²) in TER was observed at 3 h of treatment of C-CPE (10 µg/ml) (data not shown). As shown in Fig. 5C, the TER in the monolayers was reduced from 591 ± 20 · cm² to 240 ± 20 · cm² after 18 h of C-CPE treatment at 10 µg/ml. However, incubation with C-CPE220 did not alter TER as well as vehicle, even at 10 µg/ml. The 30-aa polypeptides treatment also did not modulate TER. These data indicate that the 36 amino acids at the N-terminal of C-CPE might play a role in disruption of tight-junction barriers and interact with claudin.

View larger version (35K): [in this window] [in a new window]   Fig. 5. Effects of C-CPE220 on tight-junction permeability in Caco-2 monolayer cells. A, interaction of C-CPE220 and claudin-4 in Caco-2 lysate. Ten micrograms of C-CPE or C-CPE220 was incubated with Caco-2 lysate (10 µg protein) for 30 min at 37°C. Ni-NTA resin was added, and then the mixture was incubated for an additional3hat 4°C. Then the samples were centrifuged, and the resultant supernatant fraction (Sup) was prepared. The precipitated resin was washed with the buffer for pull down. The resultant precipitated fraction containing resin (Ppt) was prepared. The Sup and Ppt fractions were subjected to SDS-PAGE followed by immunoblotting using anti-His-tagged antibody and anti-claudin-4 antibody. Data are representative of four independent experiments. B, interaction of C-CPEs and EC2hCld-4. The immunoplate was coated with GST or GST/EC2hCld-4 (10 µg/ml). After blocking the wells, the wells were treated with C-CPEs at the indicated concentration for 2 h at room temperature. The wells were washed, and anti-His-tagged Ab was added to the wells. After an additional 2 h of incubation at room temperature, the wells were washed and incubated with the peroxidase-labeled Ab for 2 h at room temperature. Finally, a substrate for peroxidase was added, and the resultant product was visualized. *, significantly different from the GST-coated values (p < 0.05). Data are means ± S.D. (n = 4). The data are representative of three independent experiments. C, effect of C-CPEs on tight-junction permeability in Caco-2 monolayers. Caco-2 cells were seeded onto Transwell. When the transepithelial resistance was stable, we added vehicle, C-CPEs, or 30-aa peptides to the basal side at the indicated concentration. TER values were monitored at 0 and 18 h after the addition of C-CPEs by an electrode. Data are representative of three independent experiments. *, significantly different from the value at 0 h (p < 0.05). Data are means ± S.E. (n = 4).

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
C-CPE is a potent inhibitor of the barrier function of claudin-4 (Sonoda et al., 1999). We previously found that treatment of rat jejunum with C-CPE resulted in enhanced absorption of drugs with molecular weights of up to 20,000 Da (Kondoh et al., 2005). In the present study, we evaluated the involvement of the N-terminal domain of C-CPE in the absorption-enhancing effect of C-CPE. We found that the 36 amino acids in the N-terminal region of C-CPE are involved in the absorption-enhancing effects of C-CPE.

Hanna et al. (1991) reported that the receptor-binding region of CPE was localized to the 30 C-terminal amino acids. Our group found that the interaction of C-CPE and claudin-4 was responsible for the absorption-enhancing effect of C-CPE (Kondoh et al., 2005). Based on these reports, we speculated that the N-terminal region of C-CPE would play a role in absorption, and the C-terminal region of C-CPE would be responsible for interaction with claudin-4. In fact, a putative binding domain of C-CPE to its receptor did not modulate absorption of FD-4. Deletion of the N-terminal region of C-CPE resulted in the loss of absorption enhancement; however, the N-terminal region-truncated C-CPE did not bind to claudin-4. Our data indicate that the 36 N-terminal amino acids are involved in the ability of C-CPE to enhance absorption and to interact with claudin-4. Although C-CPE220 contained the 30 C-terminal amino acids of C-CPE, C-CPE220 did not interact with claudin-4. These results are contradictory to a previous report (Hanna et al., 1991).

One possible explanation for this contradiction is that there may be two receptor-binding sites of C-CPE: the N-terminal region and C-terminal region of C-CPE. In fact, we previously found that deletion of the 30 C-terminal amino acids of C-CPE resulted in the loss of binding to claudin-4 and absorption enhancement (Kondoh et al., 2005). Whether one receptor-binding region affects the other receptor region is an important issue, and we are preparing a wide array of constructs of C-CPE. Another possible explanation for this contradiction is the difference in the assay systems that were used to determine receptor binding. Hanna et al. (1991) evaluated the binding of CPE and the 30 C-terminal amino acids to their receptor by binding them to rabbit intestinal brush border membranes. To assess the binding of C-CPE and N-terminal region-deleted C-CPE to claudin-4 in the present study, we performed precipitation assays of lysates of rat jejunum and Caco-2 cells. We used affinity resin for the fused protein and an enzyme-linked immunosorbent assay using GST-fused EC2hCld-4, which is a putative binding site of claudin to C-CPE (Fujita et al., 2000). Thus, we assessed a direct interaction between C-CPE and claudin-4 using lysates of rat jejunum, Caco-2, and GST/EC2hCld-4.

Katahira and his colleague found that a receptor for CPE is a calculated molecular mass of 22 kDa (claudin-4) and determined that the receptor claudin-4 was the receptor for CPE by Scatchard plot analysis (Katahira et al., 1997; Sonoda et al., 1999). McClane and Chakrabarti (2004) have reported that, in addition to the claudin family, there may be an unknown 45- to 50-kDa protein that is a receptor for CPE. It is an unsettled question whether the 45- to 50-kDa receptor is the receptor, which regulates absorption-enhancing activity of C-CPE.

In the present study, we tried to clarify functional domain mapping of C-CPE in its absorption-enhancing and claudin-4-binding properties by mutagenesis studies. The 3-D structures of CPE and C-CPE have not yet been solved, but a structural analysis of the 3-D structure of C-CPE is very important. In this point, our present and previous results will be useful for the future analysis about the structure-activity relationship of C-CPE. As mentioned in the Introduction, if we modulate the binding region of C-CPE to claudin-5 (not claudin-4), we can create a potent modulator of the blood-brain barrier. In this respect, the present finding that the 36 N-terminal amino acids of C-CPE are responsible for drug absorption may be helpful. Thus, modulation of the N-terminal region of C-CPE will make it possible to generate a novel targeting molecule for another claudin family protein.

In summary, we found that the 36 N-terminal amino acids of C-CPE are responsible for drug absorption and interaction with claudin-4. The present data indicate that we can establish a novel molecule for a drug delivery system by modulation of the N-terminal domain and C-terminal domain of C-CPE. Thus, our findings may be useful for the future development of tissue-specific drug delivery systems.

	Acknowledgements

 
We thank N. Koizumi and C. Ebihara for useful discussion.

	Footnotes

 
This study is partly supported by a grant-in-aid from the Ministry of Education, Culture, Sports, Science and Technology (Japan).

Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.105.085399.

ABBREVIATIONS: TJ, tight junction; CPE, Clostridium perfringens enterotoxin; C-CPE, C-terminal fragment of Clostridium perfringens enterotoxin; CPE-R, Clostridium perfringens enterotoxin receptor; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; FD-4, fluorescein isothiocyanate-dextran with a molecular mass of 4000 Da; AUC_0–4, area under the plasma concentration-time curve from 0 to 4 h; Ab, antibody; GST, glutathione S-transferase; EC2hCld-4, extracellular domain 2 of human claudin-4; aa, amino acid; TER, transepithelial electric resistance; AUC, the area under the plasma concentration-time curve; Ni-NTA, nickel-nitrilotriacetic acid.

¹ These authors equally contributed to this work.

Address correspondence to: Dr. Masuo Kondoh, Department of Pharmaceutics and Biopharmaceutics, Showa Pharmaceutical University, Machida, Tokyo 194-8543, Japan. E-mail: masuo{at}ac.shoyaku.ac.jp

	References

Top Abstract Materials and Methods Results Discussion References

 

Anderson JM and Van Itallie CM (1995) Tight junctions and the molecular basis for regulation of paracellular permeability. Am J Physiol 269: G467-G475.

Balda MS, Whitney JA, Flores C, Gonzalez S, Cereijido M, and Matter K (1996) Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. J Cell Biol 134: 1031-1049.[Abstract/Free Full Text]

Chen YH, Merzdorf C, Paul DL, and Goodenough DA (1997) COOH terminus of occludin is required for tight junction barrier in early Xenopus embryos. J Cell Biol 138: 891-899.[Abstract/Free Full Text]

Frangioni JV and Neel BG (1993) Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal Biochem 210: 179-187.[CrossRef][Medline]

Fujita K, Katahira J, Horiguchi Y, Sonoda N, Furuse M, and Tsukita S (2000) Clostridium perfringens enterotoxin binds to the second extracellular loop of claudin-3, a tight junction integral membrane protein. FEBS Lett 476: 258-261.[CrossRef][Medline]

Furuse M, Fujita K, Hiiragi T, Fujimoto K, and Tsukita S (1998) Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin. J Cell Biol 141: 1539-1550.[Abstract/Free Full Text]

Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, Noda T, Kubo A, and Tsukita S (2002) Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell Biol 156: 1099-1111.[Abstract/Free Full Text]

Furuse M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, Tsukita S, and Tsukita S (1993) Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol 123: 1777-1788.[Abstract/Free Full Text]

Furuse M, Sasaki H, and Tsukita S (1999) Manner of interaction of heterogeneous claudin species within and between tight junction strands. J Cell Biol 147: 891-903.[Abstract/Free Full Text]

Gumbiner BM (1993) Breaking through the tight junction barrier. J Cell Biol 123: 1631-1633.[Free Full Text]

Hanna PC, Mietzner TA, Schoolnik GK, and McClane BA (1991) Localization of the receptor-binding region of Clostridium perfringens enterotoxin utilizing cloned toxin fragments and synthetic peptides. J Biol Chem 266: 11037-11043.[Abstract/Free Full Text]

Hanna PC, Wieckowski EU, Mietzner TA, and McClane BA (1992) Mapping of functional regions of Clostridium perfringens type A enterotoxin. Infect Immun 60: 2110-2114.[Abstract/Free Full Text]

Heiskala M, Peterson PA, and Yang Y (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2: 93-98.[Medline]

Horiguchi Y, Akai T, and Sakaguchi G (1987) Isolation and function of a Clostridium perfringens enterotoxin fragment. Infect Immun 55: 2912-2915.[Abstract/Free Full Text]

Horiguchi Y, Uemura T, Kamata Y, Kozaki S, and Sakaguchi G (1986) Production and characterization of monoclonal antibodies to Clostridium perfringens enterotoxin. Infect Immun 52: 31-35.[Abstract/Free Full Text]

Katahira J, Inoue N, Horiguchi Y, Matsuda M, and Sugimoto N (1997) Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J Cell Biol 136: 1239-1247.[Abstract/Free Full Text]

Kokai-Kun JF and McClane BA (1996) Evidence that a region(s) of the Clostridium perfringens enterotoxin molecule remains exposed on the external surface of the mammalian plasma membrane when the toxin is sequestered in small or large complexes. Infect Immun 64: 1020-1025.[Abstract]

Kokai-Kun JF and McClane BA (1997a) Deletion analysis of the Clostridium perfringens enterotoxin. Infect Immun 65: 1014-1022.[Abstract]

Kokai-Kun JF and McClane BA (1997b) Determination of functional regions of Clostridium perfringens enterotoxin through deletion analysis. Clin Infect Dis 25 (Suppl 2): S165-S167.

Kondoh M, Masuyama A, Takahashi A, Asano N, Mizuguchi H, Koizumi N, Fujii M, Hayakawa T, Horiguchi Y, and Watanabe Y (2005) A novel strategy for the enhancement of drug absorption using a claudin modulator. Mol Pharmacol 67: 749-756.[Abstract/Free Full Text]

Martin-Padura I, Lostaglio S, Schneemann M, Williams L, Romano M, Fruscella P, Panzeri C, Stoppacciaro A, Ruco L, Villa A, et al. (1998) Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J Cell Biol 142: 117-127.[Abstract/Free Full Text]

McClane BA (1984) Osmotic stabilizers differentially inhibit permeability alterations induced in Vero cells by Clostridium perfringens enterotoxin. Biochim Biophys Acta 777: 99-106.[Medline]

McClane BA and Chakrabarti G (2004) New insights into the cytotoxic mechanisms of Clostridium perfringens enterotoxin. Anaerobe 10: 107-114.

McClane BA, Wnek AP, Hulkower KI, and Hanna PC (1988) Divalent cation involvement in the action of Clostridium perfringens type A enterotoxin. J Biol Chem 263: 2423-2435.[Abstract/Free Full Text]

Nitta T, Hata M, Gotoh S, Seo Y, Sasaki H, Hashimoto N, Furuse M, and Tsukita S (2003) Size-selective loosening of the blood-brain barrier in claudin-5-deficient mice. J Cell Biol 161: 653-660.[Abstract/Free Full Text]

Rahner C, Mitic LL, and Anderson JM (2001) Heterogeneity in expression and subcellular localization of claudin-2, 3, 4, and 5 in the rat liver, pancreas and gut. Gastroenterology 120: 411-422.[CrossRef][Medline]

Saitou M, Fujimoto K, Doi Y, Itoh M, Fujimoto T, Furuse M, Takano H, Noda T, and Tsukita S (1998) Occludin-deficient embryonic stem cells can differentiate into polarized epithelial cells bearing tight junctions. J Cell Biol 141: 397-408.[Abstract/Free Full Text]

Singh U, Mitic LL, Wieckowski EU, Anderson JM, and McClane BA (2001) Comparative biochemical and immunocytochemical studies reveal differences in the effects of Clostridium perfringens enterotoxin on polarized Caco-2 cells versus Vero cells. J Biol Chem 276: 33402-33412.[Abstract/Free Full Text]

Sonoda N, Furuse M, Sasaki H, Yonemura S, Katahira J, Horiguchi Y, and Tsukita S (1999) Clostridium perfringens enterotoxin fragment removes specific claudins from tight junction strands: Evidence for direct involvement of claudins in tight junction barrier. J Cell Biol 147: 195-204.[Abstract/Free Full Text]

Stark RL and Duncan CL (1971) Biological characteristics of Clostridium perfringens type A enterotoxin. Infect Immun 4: 89-96.[Abstract/Free Full Text]

Tsukita S and Furuse M (2000) Pores in the wall: claudins constitute tight junction strands containing aqueous pores. J Cell Biol 149: 13-16.[Abstract/Free Full Text]

Tsukita S, Furuse M, and Itoh M (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol 2: 285-293.[CrossRef][Medline]

Wieckowski EU, Wnek AP, and McClane BA (1994) Evidence that an approximately 50 kDa mammalian plasma membrane protein with receptor-like properties mediates the amphiphilicity of specifically bound Clostridium perfringens enterotoxin. J Biol Chem 269: 10838-10848.[Abstract/Free Full Text]

This article has been cited by other articles:

				L. Winkler, C. Gehring, A. Wenzel, S. L. Muller, C. Piehl, G. Krause, I. E. Blasig, and J. Piontek Molecular Determinants of the Interaction between Clostridium perfringens Enterotoxin Fragments and Claudin-3 J. Biol. Chem., July 10, 2009; 284(28): 18863 - 18872. [Abstract] [Full Text] [PDF]

				J. Ling, H. Liao, R. Clark, M. S. M. Wong, and D. D. Lo Structural Constraints for the Binding of Short Peptides to Claudin-4 Revealed by Surface Plasmon Resonance J. Biol. Chem., November 7, 2008; 283(45): 30585 - 30595. [Abstract] [Full Text] [PDF]

				J. G. Smedley III, J. Saputo, J. C. Parker, M. E. Fernandez-Miyakawa, S. L. Robertson, B. A. McClane, and F. A. Uzal Noncytotoxic Clostridium perfringens Enterotoxin (CPE) Variants Localize CPE Intestinal Binding and Demonstrate a Relationship between CPE-Induced Cytotoxicity and Enterotoxicity Infect. Immun., August 1, 2008; 76(8): 3793 - 3800. [Abstract] [Full Text] [PDF]

				C. Ebihara, M. Kondoh, N. Hasuike, M. Harada, H. Mizuguchi, Y. Horiguchi, M. Fujii, and Y. Watanabe Preparation of a Claudin-Targeting Molecule Using a C-Terminal Fragment of Clostridium perfringens Enterotoxin J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 255 - 260. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.105.085399v1 314/2/789    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Masuyama, A. Articles by Watanabe, Y. Search for Related Content PubMed PubMed Citation Articles by Masuyama, A. Articles by Watanabe, Y.