![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION
Is a Potent Agonist of the Aryl Hydrocarbon Receptor
Department of Molecular and Biomedical Pharmacology, University of Kentucky Medical Center, Lexington, Kentucky
Received January 27, 2005; accepted April 18, 2005.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
, a small molecule that inhibits p53-dependent apoptosis through an undetermined mechanism. In this study, we have used a number of molecular approaches to test the hypothesis that pifithrin- acts as an aryl hydrocarbon receptor (AhR) agonist and, in this manner, inhibits the actions of p53. Toward this end, we have found that pifithrin- is a potent AhR agonist as determined by its ability to bind the AhR, induce formation of its DNA binding complex, activate reporter activity, and up-regulate the classic AhR target gene CYP1A1. However, examination of its ability to inhibit p53-mediated gene activation and apoptosis revealed that these actions occurred via an AhR-independent manner. The significance of this study is based on the fact that activation of the AhR is typically associated with an increase in phase I and phase II metabolizing enzymes and adverse biological events such as tumor promotion that may contribute to untoward effects of pifithrin-. Hence, this work will aid in the future design of more specific members of this important class of p53 inhibitors for use in a clinical setting.
). Although the lack of functional p53 expression is associated with the development of cancers, its up-regulation of the intrinsic apoptotic pathway is implicated in the cell death that occurs during the progression of a number of neurodegenerative diseases, such as Alzheimer's and Parkinson's disease (Waldmeier, 2003) and during chemo- and radiotherapies in the normal tissue surrounding the tumors (Gudkov and Komarova, 2003).
Given the therapeutic potential of p53 inhibitors, a chemical screen was used to identify pifithrin- ([2-(2-imino-4,5,6,7-tetrahydrobenzothiazol-3-yl)-1-p-tolyethanone] hydrobromide) as an effective inhibitor of p53-mediated gene activation and apoptosis that was capable of protecting mice from lethal genotoxic stress elicited by gamma irradiation (Komarov et al., 1999). Further developments in the design of p53 inhibitors have identified a series of pifithrin- analogs that display potent neuroprotective effects and show promise in their potential as therapeutic agents to be used to reduce or prevent neurodegeneration and protect the cancer patient from the dehabilitating effects that occur during current chemo- and radiotherapies (Zhu et al., 2002). In addition to its promise as a clinical tool, pifithrin- has also proven to be effective in the laboratory using a variety of cell types and apoptotic-inducing agents to characterize p53-mediated events (Lorenzo et al., 2000; Zhu et al., 2002; Kaji et al., 2003; Schafer et al., 2003; Chramostova et al., 2004; Wang et al., 2004).
An important consideration of all clinical and laboratory tools is the specificity with which the therapeutic agent interacts with its intended target. With this in mind, we noted the structural similarities between pifithrin- and ligands of the aryl hydrocarbon receptor (AhR; Fig. 1), as well as recent observations that ligand activation of the AhR can inhibit apoptosis (Schrenk et al., 2004) and senescence (Ray and Swanson, 2003, 2004), two p53-mediated events, and questioned whether pifithrin- may act as an AhR agonist.
|
). This basic helix-loop-helix period, ARNT, single-minded homology domain protein is a ligand-activated receptor that resides in the cytoplasm as part of a chaperone complex that includes two HSP90 molecules, the immunophilin-like protein ARA9/XAP2/AIP and the cochaperone p23 (reviewed in Denison and Nagy, 2003). Once activated, this complex translocates into the nucleus and dissociates, allowing the AhR to dimerize with its DNA-binding partner ARNT. Gene regulation that ensues following the recognition of the AhR/ARNT heterodimer to the dioxin response elements (DREs) (i.e., TNGCGTG) has been best characterized using the target gene CYP1A1 (Whitlock, 1999). In addition to drug/xenobiotic metabolism, the AhR is increasingly implicated in roles that include crosstalk with other nuclear transcription factors, such as the estrogen receptor (Safe and Wormke, 2003) and NF-
B (Tian et al., 2002), regulation of the cell cycle (Puga et al., 2002), senescence (Ray and Swanson, 2004), and embryonic processes such as the development of the hepatic vascular architecture (Lahvis et al., 2004). Thus, ligand-induced activation of the AhR/ARNT pathway has the potential to alter myriad events that have important toxicological and pharmacological endpoints.
In this report, we have characterized pifithrin- as a potent AhR agonist. However, the ability of pifithrin- to inhibit p53 gene activation and p53-mediated apoptosis does not appear to require its interaction with the AhR. Thus, whereas the AhR does not appear to be involved in the desired effects of pifthrin-, it is likely to initiate many possible side effects, including alterations in drug metabolism, which may be associated with the clinical use of this drug.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-Naphthoflavone was purchased from Sigma-Aldrich (St. Louis, MO). Pifithrin- was purchased from both Sigma-Aldrich and Tocris Cookson Inc. (Ellisville, MO). Pifithrin- from the two companies induced similar luciferase activities when analyzed in the CYP1A1-luc/HepG2 cells. [3H]TCDD was obtained from ChemSyn Laboratories (Lenexa, KS). Apigenin, kaempferol, and all other chemicals were obtained from Sigma-Aldrich.
Cell Culture and Treatment. Hepa-1 (i.e., Hepa-1c1c7) and the AhR- and ARNT-deficient Hepa-1c1c7 cell lines AhR-D and ARNT-D (also referred to as LA-I and LA-II), were generated by Dr. James P. Whitlock, Jr. (Stanford University, Stanford, CA) as previously described (Miller et al., 1983). The human hepatoma cell line HepG2 was obtained from Dr. Christopher A. Bradfield (University of Wisconsin, Madison, WI). The HaCaT cell line was obtained from Dr. Mitch Denning (Loyola University, Chicago, IL). All cells were maintained in Dulbecco's modified Eagle's media with glucose and glutamine (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum and 100 units/ml penicillin-streptomycin (Invitrogen, Carlsbad, CA) at 37°C and 5% CO2.
Oligonucleotides. The oligonucleotides that contained either the consensus DRE (Swanson et al., 1995) or mutated sequence were purchased from Integrated DNA Technologies (Coralville, IA) and are: HIS 17, TCGAGCTGGGGGCATTGCGTGACATAC; HIS 18, TCGAGGTATGTCACGCAATGCCCCCAGC; HIS 108, TCGAGCTGGGGGCATTGATTGACATAC; and HIS 109, TCGAGGTATGCAATCAATGCCCCCAGC.
Plasmids. The conDRE/Luc and mutant DRE/Luc were generated via inserting two copies of the corresponding annealed oligonucleotides, HIS 17/18 or HIS 108/109, into the pGL3-Promoter vector (Promega, Madison, WI). The luciferase reporter plasmid that contains the human CYP1A1 gene promoter (–1612 to +292), pLUC1A1, was obtained from Dr. Robert Tukey (University of California, San Diego, La Jolla, CA). The human and murine AhR plasmids phuAhR and pmuAhR and human ARNT plasmid phuA-RNT were obtained from Dr. Christopher A. Bradfield (Dolwick et al., 1993a,b). The plasmids bearing the wild-type and mutated forms of p53 were obtained from Dr. Dan Tai (College of Pharmacy, University of Kentucky, Lexington, KY). The luciferase plasmid containing p53 response elements (pp53-TA-luc) was obtained from BD Biosciences Clontech (Palo Alto, CA).
Real-Time PCR. The level of CYP1A1 mRNA was measured by real-time PCR following reverse-transcription of mRNA. Cells were plated for 48 h and then treated for 4 h with the appropriate drug(s). Total RNA was collected using Trizol reagent (Invitrogen). One microgram of RNA was primed with random hexamers to synthesize cDNA using the Omniscript RT kit (QIAGEN, Valencia, CA) as per the manufacturer's guidelines. Real-time PCR amplification was carried out using the Mx3000P Real-Time PCR System (Stratagene, La Jolla, CA) and its associated Brilliant SYBR Green QPCR master mix (Stratagene), using 1/80 of the reverse transcription reaction as template. After an initial 10 min at 95°C, cycling parameters were as follows: 95°C for 30 s, 55°C for 1 min, and 72°C for 1 min for 40 cycles. Cycle threshold values were assigned using the manufacturer's defaults, and background fluorescence was corrected for by the use of a supplied reference dye. Sample loading was controlled by normalizing all values to glyceraldehyde-3-phosphate dehydrogenase. Specificity of the CYP1A1 and glyceraldehyde-3-phosphate dehydrogenase primer pairs was confirmed by the use of disassociation (melting curve) profiles available with this system. Primer sequences can be supplied upon request.
Western Blot Analysis. Western blot analysis was performed as previously described (Ray and Swanson, 2003). Total cellular extracts were prepared from cells by homogenization in F-buffer (10 mM Tris, 50 mM NaCl, 30 mM sodium pyrophosphate, 50 mM NaF, 5 µM ZnCl2, 0.1 mM Na3VO4, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 5 units/ml 2-macroglobulin, 2.5 units/ml pepstatin A, 2.5 units/ml leupeptin, 150 µM benzamidine, and 2.8 µg/ml aprotinin; pH 7.05) in a Kontes Duall 1-ml tissue grinder (Fisher, Pittsburgh, PA). Homogenates were centrifuged at 14,000 RPM at 4°C for 10 min, the supernatant removed, and protein concentrations were determined using BCA Protein Assay Reagents (Pierce, Rockford, IL). Sample buffer was added to the aliquots (50 µg total protein) and applied to a 10% SDS-polyacrylamide gel and subjected to Western blotting procedures using the rabbit anti-CYP1A1 antibody (H-70; Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-p21 antibody (556431; BD Biosciences Pharmingen, San Diego, CA), mouse anti-p53 antibody (3076; Abcam, Cambridge, MA), or rabbit anti--actin antibody (A-2668, Sigma-Aldrich) as primary antibodies and the corresponding anti-species IgG-horseradish peroxidase (Sigma-Aldrich) as the secondary antibodies.
Transient Transfections. Transient transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. After an overnight incubation, the cells were treated with the indicated chemicals for either 18 or 24 h. The Firefly and Renilla luciferase activities were determined with a TR 717 Microplate Luminometer from Applied Biosystems (Foster City, CA), using either the Luciferase Assay System kit or the Dual-Glo Luciferase kit from Promega according to the manufacturer's protocol.
Electromobility Shift Assay. The electromobility shift assays (EMSAs) were performed as previously described (Heid et al., 2000). Nuclear lysates were prepared from HepG2 cells that had been treated for 1 h with the indicated compounds using the NucBuster Protein Extraction Kit from EMD Biosciences (San Diego, CA). Samples were 6 µg each, and the consensus DRE (annealed HIS 17/18) was used as the probe. For supershift analysis, the appropriate samples were incubated for 10 min at room temperature with 2 µgof mouse anti-AhR (RPT1; Abcam), 0.2 µg of goat anti-ARNT (sc-8076; Santa Cruz Biotechnology), or 2 µg of anti-rabbit IgG (SigmaAldrich) following the addition of the probe.
In vitro synthesized AhR and ARNT were synthesized using the pmuAhR and phuARNT plasmids and the TNT Coupled Reticulocyte Lysate System from Promega according to the manufacturer's protocol. The AhR and ARNT proteins (2.5 µl of each reaction) were incubated in MENG (25 mM MOPS, 1 mM EDTA, 3.8 mM NaN3, and 10% glycerol, pH 7.5) buffer containing the indicated ligands at a final volume of 16.5 µl. The mixtures were incubated at 30°C for 2 h. The KCl concentration was adjusted to 120 mM, 45 ng of poly-dIdC was added, and the mixture was incubated for 15 min at room temperature. The EMSA samples were then analyzed via gel separation as described above.
Ligand Binding Assays. The ligand binding competition assays were performed essentially as previously described (Denison et al., 1986). Cytosolic cell extracts from Hepa-1 cells were generated by the resuspension of the cell pellets in HEDG buffer [25 mM Hepes, 1 mM EDTA, 1 mM dithiothreitol, and 10% (v/v) glycerol, pH 7.5] containing 0.4 mM leupeptin, 4 mg/ml aprotinin, and 0.3 mM phenylmethylsulfonyl fluoride, homogenization, and centrifugation at 100,000g for 45 min. Aliquots of the supernatant (120 µg) were incubated at room temperature for 2 h with the indicated concentrations of pifithrin- in the presence of 3 nM [3H]TCDD in HEDG buffer. After incubation on ice with hydroxyapatite for 30 min, HEDG buffer with 0.5% Tween 80 was added. The samples were centrifuged, washed twice, resuspended in 0.2 ml of scintillation fluid, and subjected to scintillation counting. Nonspecific binding was determined using a 150-fold molar excess of TCDF and subtracted from the total binding to obtain the specific binding. The specific binding is reported relative to [3H]TCDD alone.
Analysis of Apoptosis. The analysis of apoptosis was conducted using the Cell Death Detection ELISAPLUS kit from Roche (Indianapolis, IN) according to the manufacturer's protocol. After washing twice with phosphate-buffered saline, the cells were treated with 30 J/m2 ultraviolet light (254 nm) using an FLX-20M ultraviolet light source from Enprotech (New York City, NY). Complete media that contained either 0.1% DMSO or 10 µM pifithrin- was then added. After a 24-h incubation, apoptosis was determined by measuring horseradish peroxidase enzymatic activity via spectrophotometric determination. The data were analyzed using one-way analysis of variance and Tukey's Multiple Comparison Test analyses using the GraphPad Prism 3.0 software (GraphPad Software Inc., San Diego, CA).
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Induces CYP1A1 Protein Levels and Promoter Activity. A classic marker of activation of the AhR pathway is up-regulation of CYP1A1, a xenobiotic metabolizing enzyme that contains dioxin response elements recognized by the AhR and its DNA binding partner, ARNT (aryl hydrocarbon receptor nuclear translocator) (Whitlock, 1999). Thus, as a first test of whether pifithrin- may function as an AhR agonist, we questioned whether it was capable of up-regulating CYP1A1. As shown in Fig. 2A, increasing doses of either TCDD, the prototypical AhR agonist, or pifithrin- resulted in corresponding increases in the CYP1A1 mRNA levels. However, analysis of the EC50 values generated from these experiments revealed that the potency of pifithrin- is considerably less than that of TCDD (i.e., 1.1 x 10–6 versus 8.7 x 10–11 for pifithrin- and TCDD, respectively). Furthermore, a 24-h treatment of either murine (Hepa-1) or human (HepG2) hepatoma cells with 10 µM pifithrin- was sufficient to induce CYP1A1 protein expression to a level comparable with that induced with 1 nM TCDD.
|
As a first step in determining the role of the AhR in eliciting the actions of pifithrin-, we determined whether cotreatment with known AhR antagonists (Lu et al., 1995; Henry et al., 1999; Allen et al., 2001; Zhang et al., 2003) would inhibit the ability of pifithrin- to induce CYP1A1 mRNA levels. As shown in Fig. 3, the AhR antagonists MNF, apigenin, and kaempferol inhibited induction of CYP1A1 mRNA levels by both TCDD and pifithrin-. Given that some actions of the AhR are thought to occur in an ARNT-independent manner, we also questioned whether induction of CYP1A1 mRNA required ARNT (Fig. 3B). The idea that the ability of pifithrin- to regulate CYP1A1 mRNA levels requires formation of the AhR/ARNT heterodimer is supported by its induction of CYP1A1 mRNA in the wild-type Hepa-1 cells but not in those lacking expression of ARNT. Similarly, a role of the DRE in eliciting these actions of pifithrin- is indicated by the ability of pifithrin- to induce reporter activity of constructs regulated by either the CYP1A1 promoter that contains multiple DREs or a consensus DRE but not by that containing mutated DREs (Fig. 3C).
|
Induces DNA Binding of the AhR/ARNT Heterodimer. Our next objective was to determine whether the ability of pifithrin- to activate gene transactivation was associated with an increase in the formation of the AhR/ARNT DNA binding complex. Toward this end, we analyzed DNA binding of nuclear extracts prepared from HepG2 cells incubated with DMSO, TCDD, or pifithrin- (Fig. 4A). Using the consensus DRE as the probe (conDRE), treatment with either TCDD (Fig. 4A, lane 2) or pifithrin- (Fig. 4A, lane 8) was found to result in an increase in the formation of a DNA/protein complex. Specificity of this complex was determined by competitive displacement with unlabeled oligonucleotides that contained the consensus DRE (Fig. 4A, lanes 3 and 9) but not with that containing a mutated DRE (Fig. 4A, lanes 4 and 10). The presence of both the AhR and ARNT proteins in the protein/DNA binding complexes induced by either TCDD or pifithrin- was demonstrated using supershift analysis. Incubation with either the anti-AhR antibody (Fig. 4A, lanes 5 and 11) or anti-ARNT antibody (Fig. 4A, lanes 6 and 12), but not the nonspecific IgG antibody (Fig. 4A, lanes 7 and 13), shifted the formation of the respective DNA binding complexes.
|
We next questioned whether pifithrin- is able to directly activate DNA-binding by AhR and ARNT by performing additional EMSA analysis using in vitro transcribed and translated AhR and ARNT (Fig. 4B). Incubation of the murine AhR protein with pifithrin-, -naphthoflavone, or TCDD induced formation of the AhR/ARNT DNA binding complex. As we have previously observed (H. I. Swanson, unpublished results), -naphthoflavone appears to be a more potent AhR agonist in this assay as compared with TCDD, presumably due to the high lipophilic nature of TCDD that may allow it to be sequestered by the rabbit reticulocyte lysate.
Pifithrin- Competitively Displaces [3H]TCDD-Specific Binding. To determine whether pifithrin- directly activated the AhR via an interaction with its ligand-binding domain, we performed ligand-binding assays using cytosolic extracts prepared from Hepa-1 cells. As shown in Fig. 5, increasing concentrations of pifithrin- decreased the specific binding of [3H]TCDD. The relative binding affinity of pifithrin- to AhR was determined to be 1.56 x 10–7 M.
|
Inhibits p53-Dependent Gene Regulation and Apoptosis in an AhR-Independent Manner. We then hypothesized that the ability of pifithrin- to inhibit p53-mediated gene regulation, and p53-mediated apoptosis requires the AhR. Toward this end, we first performed reporter assays using a luciferase reporter that is regulated by p53-response elements. To ensure that the observed effects were specific to activation of p53, the values obtained from the cells transfected by the wild-type p53 expression plasmid were normalized to those transfected with that containing a mutated form of p53. Our initial data performed using varying concentrations of pifithrin- indicated that a concentration of 1 x 10–5 was optimal for inhibiting p53-regulated reporter activity (data not shown). As shown in Fig. 6A, pifithrin-, but not TCDD or the AhR antagonist MNF, inhibited p53-mediated reporter activity. Furthermore, cotreatment with both MNF and pifithrin- yielded results similar to that of pifithrin- alone, indicating that the AhR does not play a role in this action of pifithrin-. Additional experiments performed in a cell line that lacks expression of the AhR (AhR-D) indicated that the ability of pifithrin- to inhibit p53-mediated induction of p21 levels following exposure to ultraviolet light was not compromised by the absence of the AhR (Fig. 6B).
|
Finally, we sought to determine whether the ability of pifithrin- to inhibit p53-dependent apoptosis requires the AhR/ARNT signaling pathway (Fig. 6C). Treatment with ultraviolet light resulted in an approximately 10-fold increase in apoptosis in the Hepa-1 cells. The addition of pifithrin- immediately following exposure to ultraviolet light inhibited the induction of apoptosis within all three cells lines in a manner that was significantly enhanced within the AhR-D and ARNT-D cells, 55 and 48%, respectively, as compared with 33% in wild-type Hepa-1 cells.
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
is a potent AhR agonist that is capable of up-regulating AhR target genes, such as CYP1A1. We also report that pifithrin- inhibits the p53 pathway via an AhR-independent mechanism. The AhR signaling pathway has been associated with many events including alterations in cell viability, oxidative stress, and crosstalk with other transcription factors such as nuclear factor B, retinoblastoma protein, and the estrogen receptor (Nebert et al., 2000; Carlson and Perdew, 2002; Puga et al., 2002; Tian et al., 2002). Thus, pifithrin-, via its activation of the AhR, has the potential of impacting on a number of p53-independent pathways.
Like many drugs in the early stages of development, two problems currently hinder further progress of this exciting new class of therapeutics: 1) the unknown mechanism(s) by which pifithrin- and its analogs inhibit p53, and 2) the uncertainty as to whether the actions of these small molecules are specific to p53 inhibition. From the data available thus far, it appears that the inhibitory actions of pifithrin- occur at a step subsequent to nuclear translocation of p53 (Murphy et al., 2004). A more controversial issue pertains to the specificity of the actions of pifithrin-. Although it was previously found that the actions of pifithrin- include suppression of the heat shock transcription factor and glucocorticoid signaling pathways (Komarova et al., 2003), these findings have been recently challenged by others (Murphy et al., 2004) who have failed to detect inhibition of either glucocorticoid-mediated gene induction or the function of the chaperone machinery by pifithrin-. In fact, because pifithrin- has been shown to alter glucocorticoid signaling as well as the heat shock response (Komarova et al., 2003), it is possible that pifithrin activation of AhR may play a role in mediating these effects of pifithrin-. An additional putative role that the AhR may play in the actions of pifithrin- is in the ability of pifithrin- to induce NF-B activity in neurons (Culmsee et al., 2003) and is based on the observations that in some cell types, ligand activation of the AhR can enhance the NF-B pathway (Sulentic et al., 2004).
With respect to the potency of pifithrin- as an AhR agonist (i.e., an EC50 of 1 x 10–6 M), pifithrin- is to be considered a moderate AhR agonist that would exert activities similar to that of the indole-derived pigment indigo but less than that of agonists such as TCDD and 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (Song et al., 2002; Denison and Nagy, 2003). The concentrations of pifithrin- used in the current study to induce the CYP1A1 protein levels and CYP1A1 promoter activities (
10 µM; Figs. 2 and 3), induce formation of the AhR/ARNT DNA binding complex (Fig. 4), and displace TCDD-specific binding (Fig. 5) are similar to those doses typically used to inhibit p53-associated events, i.e., 10 to 30 µM (Komarov et al., 1999; Chramostova et al., 2004). Thus, in studies in which pifithrin- is commonly used to inhibit p53, it can be expected that the AhR/ARNT pathway will also be up-regulated.
Another aspect that should be considered is whether the presence of the AhR signaling pathway may decrease the efficacy of pifithrin- by enhancing its clearance via an increase in its metabolism. This possibility is supported by the data shown in Fig. 6C. Here, the ability of pifithrin- to inhibit ultraviolet light-induced apoptosis was significantly greater in cells that lacked either the AhR or ARNT as compared with that observed in the parental cell line. At this time, it is not know whether drug/xenobiotic metabolizing genes that are regulated by the AhR pathway, such as CYP1A1 or CYP1B1, are capable of metabolizing pifithrin-.
In summary, we have demonstrated that pifithrin- activates the AhR signaling pathway, a pathway that mediates many clinically relevant effects including tumor promotion and altered responses to drugs and xenobiotics through changes in metabolism. Future studies performed using pifithrin- and new drugs formulated to similarly inhibit p53 should take this effect into consideration within experimental design and data interpretation.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: AhR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon receptor nuclear translocator; DRE, dioxin response element; NF-B, nuclear factor B; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; TCDF, 2,3,7,8-tetrachlorodibenzo-p-furan; MNF, 3'-methoxy-4'-nitroflavone; DMSO, dimethyl sulfoxide; conDRE, consensus DRE; PCR, polymerase chain reaction; EMSA, electromobility shift assay; MOPS, 3-(N-morpholino)propanesulfonic acid.
Address correspondence to: Dr. Hollie I. Swanson, UKMC MS-305, 800 Rose St., Lexington, KY 40536-0084. E-mail: hswan{at}uky.edu
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Allen SW, Mueller L, Williams SN, Quattrochi LC, and Raucy J (2001) The use of a high-volume screening procedure to assess the effects of dietary flavonoids on human cyp1a1 expression. Drug Metab Dispos 29: 1074–1079.
Carlson DB and Perdew GH (2002) A dynamic role of the Ah receptor in cell signaling? Insights from a diverse group of Ah receptor interacting proteins. J Biochem Mol Toxicol 16: 317–325.[CrossRef][Medline]
Chramostova K, Vondracek J, Sindlerova L, Vojtesek B, Kozubik A, and Machala M (2004) Polycyclic aromatic hydrocarbons modulate cell proliferation in rat hepatic epithelial stem-like WB-F433 cells. Toxicol Appl Pharmacol 196: 136–148.[CrossRef][Medline]
Culmsee C, Siewe J, Junker V, Retiounskaia M, Schwarz S, Camandola S, El-Metainy S, Behnke H, Mattson MP, and Krieglstein J (2003) Reciprocal inhibition of p53 and nuclear factor-B transcriptional activities determines cell survival or death in neurons. J Neurosci 23: 8586–8595.
Denison MS and Nagy SR (2003) Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol 43: 309–334.[CrossRef][Medline]
Denison MS, Vella LM, and Okey AB (1986) Hepatic Ah receptor for 2,3,7,8-tetrachlorodibenzo-p-dioxin. Partial stabilization by molybdate. J Biol Chem 261: 10189–10195.
Dolwick KM, Schmidt JV, Carver LA, Swanson HI, and Bradfield CA (1993a) Cloning and expression of a human Ah receptor cDNA. Mol Pharmacol 44: 911–917.[Abstract]
Dolwick KM, Swanson HI, and Bradfield CA (1993b) In vitro analysis of Ah receptor domains involved in ligand-activated DNA recognition. Proc Natl Acad Sci USA 90: 8566–8570.
Gudkov AV and Komarova EA (2003) The role of p53 in determining sensitivity to radiotherapy. Nat Rev Cancer 3: 117–129.[CrossRef][Medline]
Guengerich PF, Martin MV, McCormick WA, Nguyen LP, Glover E, and Bradfield CA (2004) Aryl hydrocarbon receptor response to indigoids in vitro and in vivo. Arch Biochem Biophys 423: 309–316.[CrossRef][Medline]
Heid SE, Pollenz RS, and Swanson HI (2000) Role of heat shock protein 90 dissociation in mediating agonist-induced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57: 82–92.
Henry EC, Kende AS, Rucci G, Totleben MJ, Willey JJ, Dertinger SD, Pollenz RS, Jones JP, and Gasiewicz TA (1999) Flavone antagonists bind competitively with 2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) to the aryl hydrocarbon receptor but inhibit nuclear uptake and transformation. Mol Pharmacol 55: 716–725.
Hofseth LJ, Hussain SP, and Harris CC (2004) p53: 25 years after its discovery. Trends Pharmacol Sci 25: 177–181.[CrossRef][Medline]
Kaji A, Zhang Y, Nomura M, Bode AM, Ma WY, She QB, and Dong Z (2003) Pifithrin-alpha promotes p53-mediated apoptosis in JB6 cells. Mol Carcinog 37: 138–148.[CrossRef][Medline]
Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, Coon JS, Chernov MV, and Gudkov AV (1999) A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science (Wash DC) 285: 1733–1737.
Komarova EA, Neznanov N, Komarov PG, Chernov MV, Wang K, and Gudkov AV (2003) p53 inhibitor pifithrin alpha can suppress heat shock and glucocorticoid signaling pathways. J Biol Chem 278: 15465–15468.
Lahvis GP, Pyzalski RW, Glover E, Pitot HC, McElwee MK, and Bradfield CA (2004) The aryl hydrocarbon receptor is required for developmental closure of the ductus venosus in the neonatal mouse. Mol Pharmacol 67: 714–720.
Lorenzo E, Ruiz-Ruiz C, Quesada AJ, Hernandez G, Rodriguez A, Lopez-Rivas A, and Redondo JM (2000) Doxorubicin induces apoptosis and CD95 gene expression in human primary endothelial cells through a p53-dependent mechanism. J Biol Chem 277: 10883–10892.
Lu YF, Santostefano M, Cunningham BD, Threadgill MD, and Safe S (1995) Identification of 3'-methoxy-4'-nitroflavone as a pure aryl hydrocarbon (Ah) receptor antagonist and evidence for more than one form of the nuclear Ah receptor in MCF-7human breast cancer cells. Arch Biochem Biophys 316: 470–477.[CrossRef][Medline]
Miller AG, Israel ID, and Whitlock JP Jr (1983) Biochemical and genetic analysis of variant mouse hepatoma cells defective in the induction of benzo (a) pyrene-metabolzing enzyme activity. J Biol Chem 258: 3523–3527.
Murphy PJ, Galigniana MD, Morishima Y, Harrell JM, Kwok RP, Ljungman M, and Pratt WB (2004) Pifithrin-alpha inhibits p53 signaling after interaction of the tumor suppressor protein with hsp90 and its nuclear translocation. J Biol Chem 279: 30195–30201.
Nebert DW, Roe AL, Dieter MZ, Solis WA, Yang Y, and Dalton TP (2000) Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control and apoptosis. Biochem Pharmacol 59: 65–85.[CrossRef][Medline]
Puga A, Xia Y, and Elferink C (2002) Role of the aryl hydrocarbon receptor in cell cycle regulation. Chem Biol Interact 141: 117–130.[CrossRef][Medline]
Ray SS and Swanson HI (2003) Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin. Toxicol Appl Pharmacol 192: 131–145.[CrossRef][Medline]
Ray SS and Swanson HI (2004) Dioxin-induced immortalization of normal human keratinocytes and silencing of p53 and p16INK4a. J Biol Chem 279: 27187–27193.
Rushmore TH and Kong A-NT (2002) Pharmacogenomics, regulation and signaling pathways of phase I and phase II drug metabolizing enzymes. Curr Drug Metab 3: 481–490.[CrossRef][Medline]
Safe S and Wormke M (2003) Inhibitory aryl hydrocarbon receptor-estrogen receptor alpha cross-talk and mechanisms of action. Chem Res Toxicol 16: 807–816.[Medline]
Schafer T, Scheurer C, Roemer K, Menger MD, and Vollmar B (2003) Inhibition of p53 protects liver tissue against endotoxin-induced apoptotic and necrotic cell death. FASEB J 17: 660–667.
Schrenk D, Schmitz HJ, Bohnenberger S, Wagner B, and Worner W (2004) Tumor promoters as inhibitors of apoptosis in rat hepatocytes. Toxicol Lett 149: 43–50.[CrossRef][Medline]
Song J, Clagett-Dame M, Peterson RE, Hahn ME, Westler WM, Sicinski RR, and DeLuca HF (2002) A ligand for the aryl hydrocarbon receptor isolated from lung. Proc Natl Acad Sci USA 99: 14694–14699.
Sulentic CE, Kang JS, Na YJ, and Kaminski NE (2004) Interactions at a dioxin responsive element (DRE) and an overlapping B site within the hs4 domain of the 3' immunoglobulin heavy chain enhancer. Toxicology 200: 235–246.[CrossRef][Medline]
Swanson HI, Chan WK, and Bradfield CA (1995) DNA binding specificities and pairing rules of the Ah receptor, ARNT and SIM proteins. J Biol Chem 270: 26292–26302.
Tian Y, Rabson AB, and Gallo MA (2002) Ah receptor and NF-kappaB interactions: mechanisms and physiological implications. Chem Biol Interact 141: 97–115.[CrossRef][Medline]
Waldmeier PC (2003) Prospects for antiapoptotic drug therapy of neurodegenerative diseases. Prog Neuropsychopharmacol Biol Psychiatry 27: 303–321.[CrossRef][Medline]
Wang S, Konorev EA, Kotamraju S, Joseph J, Kalivendi S, and Kalyanaraman B (2004) Doxorubicin induces apoptosis in normal and tumor cells via distinctly different mechanisms: Intermediacy of H2O2- and p53-dependent pathways. J Biol Chem 279: 25535–25543.
Whitlock JP Jr (1999) Induction of cytochrome P4501A1. Annu Rev Pharmacol Toxicol 39: 103–125.[CrossRef][Medline]
Zhang S, Qin C, and Safe SH (2003) Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context. Environ Health Perspect 111: 1877–1882.[Medline]
Zhu X, Yu QS, Cutler RG, Culmsee CW, Holloway HW, Lahiri DK, Mattson MP, and Greig NH (2002) Novel p53 inactivators with neuroprotective action: synthesis and pharmacological evaluation of 2-imino-2,3,4,5,6,7-hexahydrobenzothiazole and 2-imino-2,3,4,5,6,7-hexahydrobenzoxazole derivatives. J Med Chem 45: 5090–5097.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  N. Ishimaru, A. Takagi, M. Kohashi, A. Yamada, R. Arakaki, J. Kanno, and Y. Hayashi Neonatal Exposure to Low-Dose 2,3,7,8-Tetrachlorodibenzo-p-Dioxin Causes Autoimmunity Due to the Disruption of T Cell Tolerance J. Immunol., May 15, 2009; 182(10): 6576 - 6586. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-M. SU, P. LIN, C.-K. WANG, and H. CHANG Overexpression of Cytochrome P450 1B1 in Advanced Non-small Cell Lung Cancer: A Potential Therapeutic Target Anticancer Res, February 1, 2009; 29(2): 509 - 515. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Grimes, K. N. Erwin, H. A. Stadt, G. L. Hunter, H. A. Gefroh, H.-J. Tsai, and M. L. Kirby PCB126 Exposure Disrupts ZebraFish Ventricular and Branchial but Not Early Neural Crest Development Toxicol. Sci., November 1, 2008; 106(1): 193 - 205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Puppala, H. Lee, K. B. Kim, and H. I. Swanson Development of an Aryl Hydrocarbon Receptor Antagonist Using the Proteolysis-Targeting Chimeric Molecules Approach: A Potential Tool for Chemoprevention Mol. Pharmacol., April 1, 2008; 73(4): 1064 - 1071. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Puppala, C.G. Gairola, and H.I. Swanson Identification of kaempferol as an inhibitor of cigarette smoke-induced activation of the aryl hydrocarbon receptor and cell transformation Carcinogenesis, March 1, 2007; 28(3): 639 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Wu, L. Zhang, M. S. Hoagland, and H. I. Swanson Lack of the Aryl Hydrocarbon Receptor Leads to Impaired Activation of AKT/Protein Kinase B and Enhanced Sensitivity to Apoptosis Induced via the Intrinsic Pathway J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 448 - 457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wehbe, R. Henson, M. Lang, F. Meng, and T. Patel Pifithrin-{alpha} Enhances Chemosensitivity by a p38 Mitogen-Activated Protein Kinase-Dependent Modulation of the Eukaryotic Initiation Factor 4E in Malignant Cholangiocytes J. Pharmacol. Exp. Ther., December 1, 2006; 319(3): 1153 - 1161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Sparfel, J. Van Grevenynghe, M. Le Vee, C. Aninat, and O. Fardel Potent inhibition of carcinogen-bioactivating cytochrome P450 1B1 by the p53 inhibitor pifithrin {alpha} Carcinogenesis, March 1, 2006; 27(3): 656 - 663. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
