|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CARDIOVASCULAR
Department of Medicine, Columbia University, New York, New York
Received for publication
November 6, 2004
Accepted
January 20, 2005.
| Abstract |
|---|
|
|
|---|
, PPAR
, or a PPAR
/
agonist would alter cardiac function by modulating lipid uptake by the heart. hLpLGPI mice were administered rosiglitazone (10 mg/kg/day), fenofibrate (100 mg/kg/day), or DRF2655, an alkoxy propanoic acid analog (10 mg/kg/day), for 16 days. Rosiglitazone reduced plasma triglyceride (TG) from 107.63 ± 6.98 to 77.61 ± 3.98 mg/dl, whereas fenofibrate had no effect. DRF2655 reduced TG to 33.17 ± 4.12 mg/dl. Rosiglitazone and DRF2655 decreased heart TG and total cholesterol; fenofibrate had no effect. Molecular markers for cardiac dysfunction, atrial natriuretic factor, brain natriuretic peptide, and tumor necrosis factor-
were decreased with rosiglitazone and increased with fenofibrate. Echocardiographic measurements showed reduced fractional shortening and increased left ventricular systolic dimension with fenofibrate. No changes in these parameters were observed with rosiglitazone or DRF2655 treatment. Muscle-specific carnitine palmitoyltransferase-1 and fatty acid transporter protein-1 gene expression were increased with fenofibrate and DRF2655 treatment; no change in expression of these genes was noted with rosiglitazone treatment. Rosiglitazone and DRF2655 reduced TG uptake by the heart, and fenofibrate treatment increased fatty acid uptake. Thus, in a lipotoxic cardiomyopathy mouse model, a PPAR
agonist reduced cardiac lipid and markers of cardiomyopathy, whereas an agonist of PPAR
did not improve cardiac lipids and worsened heart function. These changes were paralleled by alterations in heart lipid uptake. Overall, PPAR activators exhibit differential effects in this model of lipotoxic dilated cardiomyopathy.
,
/
, and
(Schoonjans et al., 1997
is highly expressed in liver, heart, and skeletal muscle; PPAR
is predominantly present in adipose tissue; and PPAR
is ubiquitously expressed. PPAR
plays a critical role in the regulation of cardiac lipid metabolism (Francis et al., 2003
exerts its effects on cardiac metabolism and function is not understood, mainly because drugs affecting PPARs have major metabolic actions on liver, adipose, and skeletal muscle that might secondarily alter lipid delivery to the heart (Kelly, 2003
Lipid accumulation in the heart has been implicated as the cause of dilated cardiomyopathy in some genetic disorders of lipid oxidation, and in obesity and diabetes. Cardiomyopathy occurs in animals with altered cardiac lipid metabolism. Zucker diabetic fatty rats have reduced cardiac function associated with deposition of fat in cardiomyocytes (Zhou et al., 2000
). Cardiac-specific overexpression of acyl-CoA synthetase in mouse hearts leads to increased free fatty acid (FFA) uptake and triglyceride (TG) accumulation in cardiomyocytes, apoptosis, cardiac hypertrophy, decreased systolic function, and premature death (Chiu et al., 2001
). Overexpression of PPAR
in cardiomyocytes increases myocardial lipid stores, up-regulates
-oxidation genes, and causes dilated cardiomyopathy (Finck et al., 2002
).
Lipoprotein lipase (LpL) is the major enzyme responsible for hydrolysis of TG contained in circulating lipoproteins (Goldberg, 1996
). Of all the tissues, the most robust LpL expression is in cardiac muscle (Semenkovich et al., 1989
; Preiss-Landl et al., 2002
). Although fatty acid accumulation by the heart can occur via uptake of FFA associated with albumin, it is likely that LpL-generated FFAs are the primary source of heart lipids (Augustus et al., 2003
; Teusink et al., 2003
). Most actions of LpL on circulating lipoproteins occur in the capillaries. However, by creating mice that overexpress LpL anchored to the cardiomyocyte surface via a glycosylphosphatidylinositol (GPI) anchor (hLpLGPI), we showed that cardiomyocyte cell surface LpL can mediate cardiac lipid uptake and lead to dilated cardiomyopathy (Yagyu et al., 2003
). These mice have an approximately 4-fold increase in LpL mRNA and activity compared with wild-type mice.
In the present report, we used hLpLGPI mice to assess the effects of PPAR agonists on lipid accumulation and cardiac function. hLpLGPI mice were treated with a PPAR
- or PPAR
-specific agonist. In addition, a dual agonist of PPAR
/
was used. The effects of these drugs on plasma and heart lipids, cardiac function, and heart lipid uptake were determined.
| Materials and Methods |
|---|
|
|
|---|
/
agonist DRF2655, an alkoxy propanoic acid analog (Vikramadithyan et al., 2003Plasma and Heart Lipids. Blood from overnight fasted mice was collected from the retro-orbital sinus for the measurement of plasma TG, total cholesterol (TC), and FFA. To measure tissue lipids, hearts were perfused with PBS and homogenized in ice-cold 1 M NaCl. Lipids were extracted by Folch method. The dried lipids were solubilized in PBS containing 1% Triton X-100. Plasma and heart TG, TC, and FFA levels were measured enzymatically by using kits from Wako Pure Chemicals USA (Richmond, VA).
Histology. Neutral lipids were assessed in hearts from overnight fasted mice perfused with PBS and embedded in Tissue-Tek Optimal Cutting Temperature compound (Sakura Finetek Europe, Zoeterwoude, The Netherlands). Midventricular sections of myocardium (6 µm in thickness) were stained with Oil Red O and counterstained with hematoxylin.
Echocardiographic Analysis. Two-dimensional echocardiographic analysis was done using Sonos 5500 (Philips Medical Systems, Andover, MA) in conscious young and old mice after treatment with the PPAR agonists (Takuma et al., 2001
). The echocardiographic images were recorded in a digital format and were analyzed off-line by a single observer blinded to the murine genotype (Kocher et al., 2001
; Wang et al., 2002
)
Cardiac Gene Expression by Northern Blot. Total RNA from the ventricles was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA). RNA (10 µg) was separated on a 1% agarose gel containing formaldehyde and transferred to nylon filter (Hybond-N+) for Northern blotting. We used the following probes: human lipoprotein lipase (hLpL), mouse lipoprotein lipase, atrial natriuretic factor (ANF), and brain natriuretic peptide (BNP). Results are normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Quantitative Real-Time PCR for Cardiac Glucose and Lipid Metabolism and Cardiac Function Genes. Total RNA was isolated from hearts of control and treated mice using RNeasy mini kit (QIAGEN, Valencia, CA). The mRNA levels for mCPT1, FATP-1, CD36, ACO, GLUT4, and TNF
were determined by SYBR Green and/or TaqMan (Applied Biosystems, Foster City, CA) real-time PCR using 10 ng of total RNA. The primer sequences are as follows: mCPT1: (S) 5'-TACAACCCTGACGATG-3', (AS) 5'-GGTACGAGTTCTCGAT-3'; CD36: (S) 5'-CAGTCGGAGACATGCT-3', (AS) 5'-CTCGGGGTCCTGAGTT-3'; FATP: (S): 5'-GCGTTTTCCGAAAGGG-3', (AS) 5'-CGAGCATAGGATGCAAG-3'; GLUT4: (S) 5'-CTGGCACTTCCACTGAAC-3', (AS) 5'-GGAGACTGATGCGCTC-3'; TNF
: (S) 5'-CACAGAAAGCATGATCCG-3', (AS) 5'-GGCTACAGGCTTGTCAC-3'; ACO: (probe) 5'-6-FAMd (AGATTGGGACCCACAAGCCT CTGCC)BHQ-13', (S) 5'-d(GCCTTTGTTGTCCCTATCCGT-)-3', (AS) 5'-d(CGATATCCC CAACAGTGATGC)-3'; and mB-Actin: (probe) 5'-CAL Orange d(CACTGCCGCATCCTCTTCCT CCC)-3', (S) 5'-d(AGAGGGAAATCGTGCGTGAC)-3', (AS) 5'-d(CAATAGTGACCTGGCC GT)-3'. Real-time PCR standard curves were constructed by using serial dilutions of mouse total RNA isolated from heart. Cycling parameters for mCPT1, CD36, GLUT4, FATP-1, and TNF
were one cycle at 95°C for 10 min, 40 cycles at 95°C for 30 s, 40 cycles at 60°C for 40 s, and 40 cycles at 72°C for 30 s; ACO cycling parameters were one cycle at 50°C for 2 min, one cycle at 95°C for 10 min, 40 cycles at 95°C for 15 s, and one cycle at 60°C for 1 min. Values obtained were normalized to mouse
-actin.
Uptake of TG and Palmitate. FFA turnover used [1-14C]palmitate (PerkinElmer Life and Analytical Sciences, Boston, MA) complexed to 6% FFA free bovine serum albumin as described previously (Coburn et al., 2000
). TG-labeled emulsion was prepared as described by van Bennekum et al. (1999
). Then, 20% Intralipid (Kabi Pharmacia Inc., Stockholm, Sweden) was diluted in sterile PBS to a final 10% concentration, labeled with 60 µCi of [3H]triolein (Amersham Biosciences Inc., Piscataway, NJ), and sonicated three times for 20 s at a power level of 40 W to incorporate the triolein. Labeled FFA was injected simultaneously with TG-labeled Intralipid particles.
Statistics. Statistical analyses were done by unpaired t test or analysis of variance. All data are expressed as mean ± S.E.M., with a statistically significant difference defined as a value of P < 0.05.
| Results |
|---|
|
|
|---|
|
Changes in heart lipids paralleled the alterations in plasma lipoproteins. Rosiglitazone reduced TG by 41%, but TC was unchanged. Fenofibrate did not change either lipid. DRF2655 led to a striking reduction in cardiac lipids; both lipid analysis (Fig. 1B) and histological assessment by Oil Red O showed similar results (Fig. 1C). DRF2655 reduced heart TG by 73% and cholesterol by 51%.
Effects of PPAR Agonists on Body and Tissue Weights. We next assessed how the PPAR agonists affected general metabolism. Neither rosiglitazone nor fenofibrate led to a significant change in body weight during the 16-day treatment (Fig. 2A). In contrast, DRF2655-treated mice had a 16% decrease in body weight. The body weight lowering might be due to potent PPAR
(or PPAR
) activation (Vikramadithyan et al., 2003
). DRF2655 treatment had no effect on food consumption. Both fenofibrate and DRF2655 reduced epididymal fat deposits (Fig. 2B); the decrease was 66% with the dual agonist and 28% with fenofibrate. Both these compounds also caused significant hepatomegaly; as has been reported previously, this is due to peroxisome proliferation (Cornwell et al., 2004
). Rosiglitazone did not change fat or liver weight.
|
Cardiac Function in PPAR Agonist-Treated Mice. Young hLpLGPI mice do not have echocardiographic evidence of cardiomyopathy, although they have an increase in cardiac lipid and expression of heart failure markers.(Yagyu et al., 2003
) During the 2-week treatment, animals receiving fenofibrate, but not rosiglitazone, had a deterioration of heart function (Fig. 3, A and B). Fractional shortening decreased from 57 to 43%, and left ventricular systolic diameter (LVD) increased from 0.1 to 0.14 cm. In agreement with the cardiac markers, DRF2655 did not change heart function enough to be detected by echocardiography.
|
Expression of Genes for Heart Failure. We assessed whether PPAR agonists affected the expression of markers for heart failure in young mice. Rosiglitazone treatment reduced the expression of ventricular ANF and BNP (Fig. 4A). In contrast, fenofibrate treatment increased the levels of each marker (Fig. 4B). Despite the marked decrease in plasma and cardiac lipid, the dual agonist also increased ANF and BNP (Fig. 4C); however, these gene changes were less than those seen with fenofibrate.
|
Expression of TNF
, another heart failure marker was assessed in the control and treated hearts (Fig. 4D). Fenofibrate treatment increased TNF
expression about 2-fold compared with the untreated mice. Rosiglitazone treatment showed a trend to decreased expression, whereas DRF2655 treatment did not alter TNF
levels. Therefore, the changes in cardiac genes suggested that the PPAR
agonist treatment was deleterious.
Expression of Cardiac Glucose and Lipid Metabolism Genes. Genes involved in cardiac glucose and lipid metabolism were assessed by quantitative real-time PCR (Fig. 5). As expected, PPAR
agonistic drugs induced CPT1 mRNA, whereas rosiglitazone did not. Similarly, another PPAR
target gene, FATP-1, was significantly increased with fenofibrate and DRF2655 treatment. Rosiglitazone treatment showed an increased trend; however, it was not significant. No significant changes were found in CD36, ACO, and GLUT4 mRNA levels.
|
We assessed the effects of treatment on expression of human and mouse LpL in the heart. Not surprisingly, human LpL expression driven by the MHC promoter was not altered by treatment with any of the three agonists (data not shown). In contrast, DRF2655, but not the other drugs, induced mouse LpL expression (Fig. 5B).
Effects of PPAR Agonists on Cardiac Lipid Uptake. At this point, we had two unresolved issues. 1) Two treatments, fenofibrate and DRF2655, increased CPT1 equivalently, but only fenofibrate led to a deterioration in heart function. 2) Two treatments, rosiglitazone and DRF2655, reduced heart lipid content, but only rosiglitazone reduced expression of ANF and BNP. We therefore questioned whether expression of genes involved in lipid uptake and uptake of lipids themselves were both required to increase toxicity. Therefore, we next assessed whether these three drugs altered heart uptake of circulating plasma TG or FFA by simultaneously injecting labeled TG-Intralipid and palmitate. The uptake of each tracer was calculated using the plasma concentrations. Rosiglitazone treated mice had significantly less TG-Intralipid tracer taken up by heart (Fig. 6A). Animals treated with DRF2655 showed a similar trend in the TG uptake as that of rosiglitazone. Muscle and liver also had reduced TG uptake; however, adipose uptake of TG was not altered. Neither rosiglitazone nor DRF2655-treated mice had a significant change in FFA uptake by the heart (Fig. 6B). However, FFA uptake by adipose was increased.
|
In contrast, mice treated with fenofibrate had greater uptake of lipids into the heart than did control mice, or mice treated with the other two compounds. Cardiac TG-Intralipid uptake was not significantly increased; however, FFA uptake increased 62% (Fig. 6). There were no significant differences in lipid uptake by skeletal muscle and adipose. Liver FFA and TG uptake were slightly reduced. Thus, only fenofibrate led to greater lipid delivery to the heart.
Effects of PPAR Agonists on Older Mice. We next treated 9-month-old hLpLGPI mice with an established cardiomyopathy with DRF2655 for 1 month. A lower dose (3 mg/kg/day) of DRF2655 was used for the long-term study as the compound is known to be a highly potent activator of PPAR
and PPAR
(Vikramadithyan et al., 2003
). At this dose, there was a 51% reduction in plasma TG (from 129.75 ± 5.76 to 63.00 ± 7.43 mg/dl) and 22% reduction in FFA (from 0.39 ± 0.02 to 0.31 ± 0.05 mM).
Compared with similarly aged wild-type mice, hLpLGPI mice had 54% reduction in cardiac fractional shortening (52.32 ± 2.37, wild type versus 23.85 ± 5.77%, hLpLGPI) that continued to deteriorate (48.59 ± 2.04, wild type versus 12.88 ± 4.36%, hLpLGPI) during the 1-month study. DRF2655 totally arrested the deterioration of fractional shortening (24.98 ± 2.42%, day 0 versus 32.74 ± 3.85%, day 30; Fig. 7A). In addition, the increase in LVDs (0.125 ± 0.009 cm, wild type versus 0.293 ± 0.034 cm, hLpLGPI) in the hLpLGPI mice was prevented by the dual agonist (0.262 ± 0.018 cm, day 0 versus 0.240 ± 0.02 cm, day 30; Fig. 7B). No significant change in ANF or BNP was found with this treatment (data not shown).
|
We also treated older mice with rosiglitazone or fenofibrate. As was found in younger animals, rosiglitazone reduced expression of heart failure markers. However, no echocardiographic effects of either treatment were evident (data not shown). The reason for less response to both rosiglitazone and fenofibrate in these older mice could be because these mice already had a deteriorated cardiac function that could not have been improved or deteriorated any further, unless a very potent PPAR transactivation agent such as DRF2655 was used.
| Discussion |
|---|
|
|
|---|
activation reduced plasma and cardiac lipids. 2) Along with reduced heart lipid, rosiglitazone reduced heart failure markers. In contrast, fenofibrate increased ANF, BNP, and TNF
and led to reduced ejection fraction. DRF2655 had an intermediate effect. 3) A lower dose of DRF2655 reduced plasma TG in older mice and prevented deterioration of cardiac function. 4) Rosiglitazone and DRF2655 reduced cardiac uptake of TG; fenofibrate increased cardiac uptake of FFA.
PPARs have tissue-specific effects on gene expression and also secondary effects due to global changes in metabolism. Fenofibrate lowers plasma TG in hypercholesterolemic and hypertriglyceridemic animals, but it had no effect in mice with normal TG levels (Olivier et al., 1988
). Since hLpLGPI mice have normal TG levels, as expected, fenofibrate did not alter fasting plasma lipids in our study. Other more potent agents do reduce TG in mice; however, their use would have complicated our ability to dissect the cardiac and systemic actions of PPAR
activation (Ye et al., 2001
). Moreover, fenofibrate is a commonly used clinical drug, and unlike some other agents, it does not have significant PPAR
actions (Lehmann et al., 1997
).
PPAR
agonists produce small reductions in plasma TG and increase HDL in humans (Diamant and Heine, 2003
). Rosiglitazone also reduces plasma TG in mice, as was found in our study. In comparison, DRF2655 is a more potent agent, and it led to greater plasma TG reductions in rodents (Vikramadithyan et al., 2003
). These effects on plasma lipoproteins could be due to either stronger PPAR
or
actions, both of which have been shown using a luciferase reporter assay and in vivo experiments (Vikramadithyan et al., 2003
).
Cardiac lipids were reduced only with agents having PPAR
activity. Both rosiglitazone and DRF2655 reduced heart lipids in young mice. Although the drugs could have a direct effect on the myocardium, we suspected that the changes reflected reduced accumulation of plasma lipids. By performing kinetic studies, we showed that both of these drugs decreased cardiac TG and fatty acid uptake. In part, the reduced heart uptake may have resulted from uptake by other tissues, especially adipose. It has been reported by other investigators as well that rosiglitazone increases fatty acid uptake into adipose tissue while lowering the uptake in skeletal muscle and liver (Ye et al., 2004
). One of the main reasons for this could be that rosiglitazone activates PPAR
, the transcription factor predominantly expressed in adipose tissue, whereas the expression level in skeletal muscle and liver is relatively very little. Although muscle acts as a lipid sink, the reduced uptake of lipids in skeletal muscle could be an indirect effect of rosiglitazone in this tissue, which has also been demonstrated in muscle-specific PPAR
knockout mice (Hevener et al., 2003
; Norris et al., 2003
).
In our model, PPAR
activation by fenofibrate led to increased heart failure markers and decreased cardiac function. PPAR
activation could lead to increased reactive oxygen species production. Our genetic and lipid uptake data showing increased expression of cardiac fatty acid oxidation genes, increased fatty acid uptake, and no change in cardiac lipids are consistent with greater oxidation in the fenofibrate-treated mouse hearts. In many ways, this observation confirms that found in cardiac PPAR
transgenic mice, and as hypothesized by others, may be due to the generation of toxic oxidation products due to excess FFA metabolism in the peroxisome (Finck et al., 2003
). In a rat model of pressure-overloaded cardiac hypertrophy, PPAR
agonists prevented substrate switching to glucose and resulted in severe depression of cardiac power and efficiency in the hypertrophied heart (Young et al., 2001
). A very recent report by Sharma et al. (2004
) showed that intramyocardial lipid accumulation and up-regulation of PPAR
-regulated transcripts in failing human heart resembles the lipotoxic rat heart. The pathway responsible for increased FFA uptake in the hearts of fenofibrate-treated mice is unclear. CD36, a known cardiac FFA transporter, did not change, but another potential transporter, FATP-1, was induced.
The observed increase in cardiac CPT1 expression in both fenofibrate- and DRF2655-treated mice could have allowed greater mitochondrial oxidation of the acquired FFA. However, only fenofibrate led to worsening of cardiac function. This led us to conclude that increased expression of FFA oxidation pathway genes only affects heart function if it is coupled with greater lipid uptake. Whether the toxicity is then due to oxidation products or accumulation of lipid intermediates is unknown. Mice overexpressing LpL in the heart only develop cardiomyopathy when bred with PPAR
knockout mice, animals that have reduced FFA oxidation (Nohammer et al., 2003
). In this model, toxicity is associated with reduced FFA oxidation.
Rosiglitazone reduced ANF and BNP in the hLpLGPI model. PPAR
agonists are beneficial in leptin-deficient lipotoxicity (Zhou et al., 2000
). Either the drugs have a direct effect on the heart or their actions are secondary to more global metabolic effects. When new models are created with specific overexpression or deletion of PPAR
in the heart, this issue can be addressed in genetic experiments. PPAR
expression is low in heart relative to adipose tissue but similar to expression in skeletal muscle (Desvergne and Wahli, 1999
). PPAR
agonists induce insulin-mediated glucose uptake into skeletal muscle and heart; increased glucose uptake could have improved heart function in the hLpLGPI mice (Hevener et al., 2003
; Muurling et al., 2003
). However, the cardiomyopathy in the hLpLGPI mice is clearly associated with excess uptake of plasma lipid and not an intrinsic metabolic defect of cardiomyocytes. For that reason, it is logical that rosiglitazone reduction of cardiac lipid uptake should lower the cardiac levels of toxic metabolites and ameliorate the cardiomyopathy. In this context, Listenberger et al. (2003
) have shown that palmitate, but not oleic acid, is toxic to cells and have suggested that accumulation of nonesterified lipids causes lipoapoptosis.
Cardiac lipid uptake was a better marker for the beneficial effects of PPAR agents than was cardiac lipid content. Although DRF2655 reduced cardiac lipid uptake in young mice, it did not do this as well as rosiglitazone. Beneficial effects of DRF2655 might have been counterbalanced by negative PPAR
effects. In older mice, when we reduced the amount of drug used such that the beneficial actions were not overwhelmed by the toxic effects of PPAR
activation, cardiomyopathy was improved.
In contrast to the reported effects of PPAR agonists in young mice with developing disease, the same doses of fenofibrate and rosiglitazone did not affect cardiac function and did not alter gene expression in older mice (data not shown). Therefore, once disease is established, it seems that the response to PPAR agonist therapy differs.
In summary, our study illustrates a pharmacological approach toward understanding lipotoxicity. Because cardiac FFA oxidation is already induced by the presence of the hLpLGPI transgene, further PPAR
activation may lead to greater cardiac dysfunction due to accumulation of additional lipids. PPAR
agonists have beneficial effects, perhaps because they reduce plasma TG and route more TG and FFA to adipose, and less to the heart. Although models may differ, our data suggest that PPAR agents have great potential both for good and harm in this form of cardiomyopathy. Most importantly, our data suggest that their effects on heart function may reflect changes in overall body metabolism and plasma lipid levels and not direct actions on the myocardium. It should be noted that the actions of PPAR agonists in humans differ from those in mice; this is most evident in the observed effects on lipoprotein profiles. Moreover, the pathogenesis of cardiomyopathy in humans with obesity or diabetes may differ from that in mouse models of cardiolipotoxicity. Thus, the effects of these treatments in humans might be different. Nonetheless, these types of animal studies provide a basis for exploring drug actions and dissecting their effects on disease.
| Footnotes |
|---|
ABBREVIATIONS: PPAR, peroxisome proliferator-activated receptor; FFA, free fatty acid; TG, triglyceride; LpL, lipoprotein lipase; GPI, glycosylphosphatidylinositol; TC, total cholesterol; PBS, phosphate-buffered saline; hLpLGPI, lipoprotein lipase anchored to the cardiomyocyte surface via a glycosylphosphatidylinositol anchor; hLpL, human lipoprotein lipase; DRF2655, alkoxy propanoic acid analog; ANF, atrial natriuretic factor; BNP, brain natriuretic peptide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCR, polymerase chain reaction; TNF, tumor necrosis factor; GLUT4, glucose transporter-4; S, sense; AS, antisense; mCPT1, muscle-specific carnitine palmitoyltransferase-1; FATP, fatty acid transporter protein; ACO, acyl CoA oxidase; CD36, fatty acid translocase.
Address correspondence to: Dr. Ira J. Goldberg, Department of Medicine, Columbia University College of Physicians and Surgeons, 630 West 168th St., New York, NY 10032. E-mail: ijg3{at}columbia.edu
| References |
|---|
|
|
|---|
Augustus AS, Kako Y, Yagyu H, and Goldberg IJ (2003) Routes of FA delivery to cardiac muscle: modulation of lipoprotein lipolysis alters uptake of TG-derived FA. Am J Physiol 284: E331E339.
Braissant O and Wahli W (1998) Differential expression of peroxisome proliferator-activated receptor-alpha, -beta and -gamma during rat embryonic development. Endocrinology 139: 27482754.
Chaput E, Saladin R, Silvestre M, and Edgar AD (2000) Fenofibrate and rosiglitazone lower serum triglycerides with opposing effects on body weight. Biochem Biophys Res Commun 271: 445450.[CrossRef][Medline]
Chiu HC, Kovacs A, Ford DA, Hsu FF, Garcia R, Herrero P, Saffitz JE, and Schaffer JE (2001) A novel mouse model of lipotoxic cardiomyopathy. J Clin Investig 107: 813822.[Medline]
Coburn CT, Knapp FF Jr, Febbraio M, Beets AL, Silverstein RL, and Abumrad NA (2000) Defective uptake and utilization of long chain fatty acids in muscle and adipose tissues of CD36 knockout mice. J Biol Chem 275: 3252332529.
Cornwell PD, De Souza AT, and Ulrich RG (2004) Profiling of hepatic gene expression in rats treated with fibric acid analogs. Mutat Res 549: 131145.[Medline]
Desvergne B and Wahli W (1999) Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev 20: 649688.
Diamant M and Heine RJ (2003) Thiazolidinediones in type 2 diabetes mellitus: current clinical evidence. Drugs 63: 13731405.[CrossRef][Medline]
Duez H, Chao YS, Hernandez M, Torpier G, Poulain P, Mundt S, Mallat Z, Teissier E, Burton CA, Tedgui A, et al. (2002) Reduction of atherosclerosis by the peroxisome proliferator-activated receptor alpha agonist fenofibrate in mice. J Biol Chem 277: 4805148057.
Finck BN, Han X, Courtois M, Aimond F, Nerbonne JM, Kovacs A, Gross RW, and Kelly DP (2003) A critical role for PPARalpha-mediated lipotoxicity in the pathogenesis of diabetic cardiomyopathy: modulation by dietary fat content. Proc Natl Acad Sci USA 100: 12261231.
Finck BN, Lehman JJ, Leone TC, Welch MJ, Bennett MJ, Kovacs A, Han X, Gross RW, Kozak R, Lopaschuk GD, et al. (2002) The cardiac phenotype induced by PPARalpha overexpression mimics that caused by diabetes mellitus. J Clin Investig 109: 121130.[CrossRef][Medline]
Francis GA, Annicotte JS, and Auwerx J (2003) PPAR-alpha effects on the heart and other vascular tissues. Am J Physiol 285: H1H9.
Goldberg IJ (1996) Lipoprotein lipase and lipolysis: central roles in lipoprotein metabolism and atherogenesis. J Lipid Res 37: 693707.[Abstract]
Hevener AL, He W, Barak Y, Le J, Bandyopadhyay G, Olson P, Wilkes J, Evans RM, and Olefsky J (2003) Muscle-specific PPARg deletion causes insulin resistance. Nat Med 9: 14911497.[CrossRef][Medline]
Kelly DP (2003) PPARs of the heart: three is a crowd. Circ Res 92: 482484.
Kocher AA, Schuster MD, Szabolcs MJ, Takuma S, Burkhoff D, Wang J, Homma S, Edwards NM, and Itescu S (2001) Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med 7: 430436.[CrossRef][Medline]
Lehmann JM, Lenhard JM, Oliver BB, Ringold GM, and Kliewer SA (1997) Peroxisome proliferator-activated receptors alpha and gamma are activated by indomethacin and other non-steroidal anti-inflammatory drugs. J Biol Chem 272: 34063410.
Listenberger LL, Han X, Lewis SE, Cases S, Farese RV Jr, Ory DS, and Schaffer JE (2003) Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc Natl Acad Sci USA 100: 30773082.
Muurling M, Mensink RP, Pijl H, Romijn JA, Havekes LM, and Voshol PJ (2003) Rosiglitazone improves muscle insulin sensitivity, irrespective of increased triglyceride content, in ob/ob mice. Metabolism 52: 10781083.[CrossRef][Medline]
Nohammer C, Brunner F, Wolkart G, Staber PB, Steyrer E, Gonzalez FJ, Zechner R, and Hoefler G (2003) Myocardial dysfunction and male mortality in peroxisome proliferator-activated receptor alpha knockout mice overexpressing lipoprotein lipase in muscle. Lab Investig 83: 259269.[Medline]
Norris AW, Chen L, Fisher SJ, Szanto I, Ristow M, Jozsi AC, Hirshman MF, Rosen ED, Goodyear LJ, Gonzalez FJ, et al. (2003) Muscle-specific PPARgamma-deficient mice develop increased adiposity and insulin resistance but respond to thiazolidinediones. J Clin Investig 112: 608618.[CrossRef][Medline]
Olivier P, Plancke MO, Marzin D, Clavey V, Sauzieres J, and Fruchart JC (1988) Effects of fenofibrate, gemfibrozil and nicotinic acid on plasma lipoprotein levels in normal and hyperlipidemic mice. A proposed model for drug screening. Atherosclerosis 70: 107114.[CrossRef][Medline]
Preiss-Landl K, Zimmermann R, Hammerle G, and Zechner R (2002) Lipoprotein lipase: the regulation of tissue specific expression and its role in lipid and energy metabolism. Curr Opin Lipidol 13: 471481.[CrossRef][Medline]
Schoonjans K, Martin G, Staels B, and Auwerx J (1997) Peroxisome proliferator-activated receptors, orphans with ligands and functions. Curr Opin Lipidol 8: 159166.[Medline]
Semenkovich CF, Chen SH, Wims M, Luo CC, Li WH, and Chan L (1989) Lipoprotein lipase and hepatic lipase mRNA tissue specific expression, developmental regulation and evolution. J Lipid Res 30: 423431.[Abstract]
Sharma S, Adrogue JV, Golfman L, Uray I, Lemm J, Youker K, Noon GP, Frazier OH, and Taegtmeyer H (2004) Intramyocardial lipid accumulation in the failing human heart resembles the lipotoxic rat heart. FASEB J 18: 16921700.
Takuma S, Suehiro K, Cardinale C, Hozumi T, Yano H, Shimizu J, Mullis-Jansson S, Sciacca R, Wang J, Burkhoff D, et al. (2001) Anesthetic inhibition in ischemic and nonischemic murine heart: comparison with conscious echocardiographic approach. Am J Physiol 280: H2364H2370.
Teusink B, Voshol PJ, Dahlmans VE, Rensen PC, Pijl H, Romijn JA, and Havekes LM (2003) Contribution of fatty acids released from lipolysis of plasma triglycerides to total plasma fatty acid flux and tissue-specific fatty acid uptake. Diabetes 52: 614620.
van Bennekum AM, Kako Y, Weinstock PH, Harrison EH, Deckelbaum RJ, Goldberg IJ, and Blaner WS (1999) Lipoprotein lipase expression level influences tissue clearance of chylomicron retinyl ester. J Lipid Res 40: 565574.
Vikramadithyan RK, Hiriyan J, Suresh J, Gershome C, Babu RK, Misra P, Rajagopalan R, and Chakrabarti R (2003) DRF 2655: a unique molecule that reduces body weight and ameliorates metabolic abnormalities. Obes Res 11: 292303.[Medline]
Wang CY, Mazer SP, Minamoto K, Takuma S, Homma S, Yellin M, Chess L, Fard A, Kalled SL, Oz MC, et al. (2002) Suppression of murine cardiac allograft arteriopathy by long-term blockade of CD40-CD154 interactions. Circulation 105: 16091614.
Yagyu H, Chen G, Yokoyama M, Hirata K, Augustus A, Kako Y, Seo T, Hu Y, Lutz EP, Merkel M, et al. (2003) Lipoprotein lipase (LpL) on the surface of cardiomyocytes increases lipid uptake and produces a cardiomyopathy. J Clin Investig 111: 419426.[CrossRef][Medline]
Ye JM, Doyle PJ, Iglesias MA, Watson DG, Cooney GJ, and Kraegen EW (2001) Peroxisome proliferator-activated receptor (PPAR)-alpha activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats: comparison with PPAR-gamma activation. Diabetes 50: 411417.
Ye JM, Dzamko N, Cleasby ME, Hegarty BD, Furler SM, Cooney GJ, and Kraegen EW (2004) Direct demonstration of lipid sequestration as a mechanism by which rosiglitazone prevents fatty-acid-induced insulin resistance in the rat: comparison with metformin. Diabetologia 47: 13061313.[Medline]
Young ME, Laws FA, Goodwin GW, and Taegtmeyer H (2001) Reactivation of peroxisome proliferator-activated receptor alpha is associated with contractile dysfunction in hypertrophied rat heart. J Biol Chem 276: 4439044395.
Zhou YT, Grayburn P, Karim A, Shimabukuro M, Higa M, Baetens D, Orci L, and Unger RH (2000) Lipotoxic heart disease in obese rats: implications for human obesity. Proc Natl Acad Sci USA 97: 17841789.
This article has been cited by other articles:
![]() |
T.-L. Yue, S. S. Nerurkar, W. Bao, B. M. Jucker, L. Sarov-Blat, K. Steplewski, E. H. Ohlstein, and R. N. Willette In Vivo Activation of Peroxisome Proliferator-Activated Receptor-{delta} Protects the Heart from Ischemia/Reperfusion Injury in Zucker Fatty Rats J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 466 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Abel, S. E. Litwin, and G. Sweeney Cardiac Remodeling in Obesity Physiol Rev, April 1, 2008; 88(2): 389 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Witteles and M. B. Fowler Insulin-Resistant Cardiomyopathy: Clinical Evidence, Mechanisms, and Treatment Options J. Am. Coll. Cardiol., January 15, 2008; 51(2): 93 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. LeBrasseur, T.-A. S. Duhaney, D. S. De Silva, L. Cui, P. C. Ip, L. Joseph, and F. Sam Effects of Fenofibrate on Cardiac Remodeling in Aldosterone-Induced Hypertension Hypertension, September 1, 2007; 50(3): 489 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Wergedal, C. L. Ackert-Bicknell, W. G. Beamer, S. Mohan, D. J. Baylink, and A. K. Srivastava Mapping genetic loci that regulate lipid levels in a NZB/B1NJxRF/J intercross and a combined intercross involving NZB/B1NJ, RF/J, MRL/MpJ, and SJL/J mouse strains J. Lipid Res., August 1, 2007; 48(8): 1724 - 1734. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-A. S. Duhaney, L. Cui, M. K. Rude, N. K. Lebrasseur, S. Ngoy, D. S. De Silva, D. A. Siwik, R. Liao, and F. Sam Peroxisome Proliferator-Activated Receptor {alpha}-Independent Actions of Fenofibrate Exacerbates Left Ventricular Dilation and Fibrosis in Chronic Pressure Overload Hypertension, May 1, 2007; 49(5): 1084 - 1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Qi and B. Rodrigues Glucocorticoids produce whole body insulin resistance with changes in cardiac metabolism Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E654 - E667. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. An and B. Rodrigues Role of changes in cardiac metabolism in development of diabetic cardiomyopathy Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1489 - H1506. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Asai, K. Okumura, R. Takahashi, H. Matsui, Y. Numaguchi, H. Murakami, R. Murakami, and T. Murohara Combined therapy with PPAR{alpha} agonist and L-carnitine rescues lipotoxic cardiomyopathy due to systemic carnitine deficiency Cardiovasc Res, June 1, 2006; 70(3): 566 - 577. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||