JPET xPharm- The Comprehensive Pharmacology Reference

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on January 21, 2005; DOI: 10.1124/jpet.104.080002


0022-3565/05/3132-557-562$20.00
JPET 313:557-562, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.080002v1
313/2/557    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, W.
Right arrow Articles by Tsao, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, W.
Right arrow Articles by Tsao, P. S.

CARDIOVASCULAR

Rosuvastatin Attenuates Monocyte-Endothelial Cell Interactions and Vascular Free Radical Production in Hypercholesterolemic Mice

Wei Li, Tomoko Asagami, Hidetsugu Matsushita, Keun-Ho Lee, and Philip S. Tsao

Division of Cardiovascular Medicine, Stanford University School of Medicine, Stanford, California

Received November 2, 2004; accepted January 20, 2005.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
One of the earliest observable events in atherogenesis is enhanced monocyte adhesion to the endothelium. In addition to reducing circulating levels of cholesterol, 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors (statins) are thought to have direct salutary effects upon vascular cells. We hypothesized that the new statin, rosuvastatin, would have anti-inflammatory effects on the vessel wall. Eight-week-old apolipoprotein E-deficient mice were fed a normal chow diet for a period of 12 weeks. During this time mice were administered vehicle or rosuvastatin at a dose of 0, 1, 5, or 20 mg/kg by subcutaneous injection at the same time daily for a period of 2 or 6 weeks prior to sacrifice. At the end of the study, rosuvastatin-treated animals displayed lower plasma total cholesterol levels, whereas showing little change in high-density lipoprotein cholesterol or triglycerides. Using a functional binding assay, we also demonstrated that endothelial adhesiveness for monocytes was significantly attenuated after 2 weeks of treatment with rosuvastatin. Quantitative real-time polymerase chain reaction determined that rosuvastatin reduced the expression of vascular cell adhesion molecule-1, monocyte chemotactic protein-1, and metalloproteinase-9 in the vessel wall. In addition, rosuvastatin inhibited vascular expression of p22phox and superoxide production, as well as diminishing plasma 8-isoprostanes concentrations. Thus, treatment with rosuvastatin has acute anti-inflammatory actions that likely participate in its beneficial actions during atherogenesis.


The major cause of morbidity and mortality in Western civilization is atherosclerosis. The earliest observable abnormality of the vessel wall in animal models of atherogenesis is enhanced monocyte adherence to the endothelium (Ross et al., 1977Go). This event is mediated by the surface expression of endothelial adhesion molecules and chemotactic proteins induced by risk factors such as hypercholesterolemia. The exact mechanisms by which hypercholesterolemia accelerates monocyte adhesion (and, therefore, atherosclerotic disease) have not been fully delineated; however, recent evidence indicates that increased local oxidative stress may play a major role. In addition to inducing vascular smooth muscle cell proliferation (Griendling and Fitzgerald, 2003aGo), excess oxygen-derived free radicals can increase the expression of proinflammatory genes such as vascular cell adhesion molecule-1 (VCAM-1) (Marui et al., 1993Go) and monocyte chemotactic protein-1 (MCP-1) (Tsao et al., 1997Go), both of which are involved with the recruitment of monocytes.

One of the most important innovations in the treatment of atherosclerotic disease has been the development and use of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins). Several major clinical trials have demonstrated a clear benefit of statins upon cardiovascular endpoints as well as surrogate markers of coronary artery disease (Anonymous, 1994Go, 1998aGo,bGo; Heart Protection Study Collaborative Group, 2002Go). Yet, the mechanisms by which LDL cholesterol initiates atherogenesis are not completely delineated. Significant research has focused on how the cells within atherosclerotic lesions accumulate lipid. As such, simple lowering of cholesterol levels would reduce the rate of lipid accumulation and inhibit atherogenesis. However, closer examination of clinical trial data has led to the concept that the benefit of statins may go beyond their ability to lower circulating LDL levels (Anonymous, 1998aGo). In addition, recent preclinical studies have shown that statins can, indeed, directly affect intracellular processes. These actions are as diverse as enhancing endothelial expression of endothelial nitric-oxide synthase (eNOS) (Laufs et al., 1998Go; Laufs and Liao, 1998Go), increasing the number of circulating endothelial progenitor cells (Vasa et al., 2001Go), and modulating inflammatory cell activation (Kallen et al., 1999Go; Weitz-Schmidt et al., 2001Go). Rosuvastatin is a new statin that has potent inhibitory effects on hepatic HMG-CoA reductase. Comparative dose-ranging studies indicate that rosuvastatin is highly effective in reducing LDL cholesterol in hypercholesterolemic patients with large decreases at starting doses (Olsson et al., 2002Go). We hypothesized that rosuvastatin would not only lower circulating cholesterol levels, but would also attenuate early inflammatory processes involved with atherogenesis. Therefore, the influence of rosuvastatin upon endothelial adhesiveness as well as cellular signaling mechanisms essential for monocyte binding were investigated in the hypercholesterolemic apoE-deficient mouse.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture. Murine monocytoid cells (WEHI 78/24) were grown in Dulbecco's modified Eagle's medium + 10% fetal calf serum in an atmosphere of 5% CO2/95% air. Prior to binding studies, WEHI 78/24 were fluorescently labeled with tetramethyl rhodamine-6-isothiocyanate (3 µg/ml) (Molecular Probes, Eugene, OR) for 15 min at room temperature. The cell suspension was carefully underlaid with a layer of fetal calf serum and then centrifuged at 400g to separate labeled cells from the remaining dye. Cells were washed in complete medium and resuspended in Hanks' balanced salt solution (HBSS) containing 1 mM Ca2+, 1 mM Mg2+, and 2 mM HEPES for binding studies.

Animal Studies. All animals were housed in a room with a 12-h light/dark cycle and an ambient temperature of 22°C. The experimental protocols were approved by the Administrative Panel on Laboratory Animal Care of Stanford University and were performed in accordance with the recommendations of the American Association for the Accreditation of Laboratory Animal Care.

Eight-week-old female mice (both apoE knockout and their genetic controls, C57BL/6) were fed a normal chow diet (0.022% cholesterol, 10% fat by weight; Purina Mills, Richmond, IN) for a period of 12 weeks. ApoE-deficient mice were administered vehicle or rosuvastatin at a dose of 0, 1, 5, or 20 mg/kg by subcutaneous injection at the same time daily for a period of 2 or 6 weeks prior to sacrifice. At 20 weeks of age, mice received their final dose of drug and were sacrificed by an overdose of pentobarbital. Whole blood was collected in EDTA by intracardiac puncture and isolated plasma stored at –80°C for measurement of total cholesterol, HDL cholesterol, triglycerides by enzymatic method (Sigma-Aldrich, St. Louis, MO), and 8-epiprostaglandin (PG) F2{alpha} using a commercially available enzyme-linked immunosorbent assay (Cayman Chemical, Ann Arbor, MI).

Monocyte binding studies were performed as previously described (Tsao et al., 1994Go). Briefly, animals were sacrificed by cervical dislocation and thoracic aortae were removed, placed into ice-cold, oxygenated phosphate-buffered saline, and cleaned of adventitial tissue. Aortic segments were then carefully opened longitudinally and placed into 35-mm culture dishes containing 2 ml of HBSS. Aortic strips were fixed to the culture dish and placed on a rocking platform at room temperature. After 10 min, HBSS was replaced by 2 ml of HBSS containing fluorescently labeled WEHI 78/24 cells (2 x 106/ml) for 30 min, rotating the dishes 120° every 10 min. Nonadherent monocytes were then washed away and adherent cells counted by epifluorescent microscopy from at least 25 different sites. Data are expressed as a percentage of adherent cells on thoracic aorta compared with a control animal studied in parallel.

mRNA Expression. To investigate potential underlying mechanisms for altered inflammatory processes, aortic segments were harvested, quickly cleaned of adventitia, and flash frozen in liquid nitrogen. Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA) according to manufacturer's instructions. After DNase treatment, cDNA was synthesized from 5 mg of total RNA using Moloney murine leukemia virus reverse transcriptase (SuperScript II kit; Invitrogen). Relative expression levels of mRNA was determined by quantitative real-time polymerase chain reaction (q-RT-PCR) using the following primers and fluorescently labeled TaqMan probes: VCAM-1 (forward, CCGTCGCGAGGTTGTTTAGA; reverse, TCAGTCCAAGCAACACTCTCTGAT; probe, TCAGTCCAAGCAACACTCTCTGAT), MCP-1 (forward, CTGCTCAACTTGGCCATCTCT; reverse, GTGAGCCCAGAATGGTAATGTG; probe, ACCTGCTCTTCCTGC), metalloproteinase (MMP)-9 (forward, CAGCTGGCAGAGGCATACTTG; reverse, GCTTCTCTCCCATCATCTGGG; probe, ACCGCTATGGTTACACCCGGGCC), and p22phox (forward, 5'-ACCTGACCGCTGTGGTGAA-3'; reverse, 5'-GTG GAG GAC AGC CCG GA-3'; probe, 5'-CCCGCTGCCCACACCTCTTGAACT-3'). TaqMan 18S RNA probes and primers were supplied in a control reagent kit and used according to manufacturer's instructions (Applied Biosystems, Foster City, CA).

The sensitivity and specificity of the assays were assessed from serial dilutions of reference and target templates in separate PCR reactions. Optimal primer concentrations were determined as the minimum primer concentration to yield maximum change in emission intensity and minimum cycle number of fluorescence signal liberated upon dissolution of the specific probe that crosses an arbitrary threshold set within the exponential phase of the PCR (Ct). Amplification was carried out in triplicate at 50°C for 2 min and 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Threshold cycle was calculated for each target and normalized to the Ct for 18S RNA in the same sample. {Delta}Ct-{Delta}Ct method was then used to determine differences between experimental groups and control (normocholesterolemic) samples.

Evaluation of Vascular ROS Production. ROS production was measured as previously described (Uemura et al., 2001Go). Briefly, freshly isolated segments of aorta were cleaned of adventitia and incubated in Dulbecco's modified Eagle's medium supplemented with a spin-trapping agent 4-amino-2,2,6,6,-tetramethylpiperidino-1-oxyl [Tempamine (TA)] for 2 h in standard cell culture conditions. Electron paramagnetic resonance (EPR) spectra of conditioned medium were recorded at room temperature with a spectrometer (model 8400, Resonance Instruments, Skokie, IL) operating at X-band with a transverse magnetic 110 cavity and flat cell. The spectrometer settings are: modulation frequency, 100 kHz; modulation amplitude, 0.5 G; scan time, 30 s; microwave power, 10 to 20 mW; and microwave frequency, 9.5 GHz. Spectral simulations are performed on a personal computer and matched directly with experimental data to extract the spectral paramagnetic parameters. Quantification of the EPR signal intensity was determined by comparing the double integration of the recorded first derivative EPR peak of each sample with a standard TA spin solution.

Data Analysis. All values in the text are expressed as mean ± S.E.M. of n independent experiments. Differences between specific means were tested by analysis of variance followed by Bonferroni post hoc analysis. A value of p < 0.05 was accepted as being statistically significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Biochemical Parameters of Mice. To investigate the effects of rosuvastatin on early atherogenesis, we utilized a murine model of genetic and diet-induced hypercholesterolemia. The apoE-deficient mouse manifests increased plasma cholesterol levels and eventual atherosclerosis reminiscent of human disease even on a normal chow diet. As expected, 20-week-old apoE-knockout mice displayed increased plasma total cholesterol (Table 1) and triglycerides at 20 weeks of age, although having no changes in HDL cholesterol compared with C57BL/6 mice. Two-week treatment with rosuvastatin at 5 and 20 mg/kg reduced plasma total cholesterol levels. The lower dose of 1 mg/kg had no effect at this time point. However, following 6 weeks of treatment all doses reduced total cholesterol levels. None of the doses (at either time point) had any effect on HDL cholesterol or triglyceride levels.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Plasma lipid values

 

Monocyte Binding. To monitor the effects of rosuvastatin on monocyte-endothelial cell interactions, thoracic aortae were carefully harvested and functional binding assays performed using fluorescently labeled monocytoid cells (Fig. 1). Elevated cholesterol levels at 20 weeks of age were consistently associated with increased endothelial adhesiveness for monocytes compared with normocholesterolemic control animals (Fig. 2). Two-week treatment with rosuvastatin diminished monocyte binding at the highest dose tested (20 mg/kg). More robust effects were observed with 6 weeks of treatment in that both 5 and 20 mg/kg doses of rosuvastatin significantly reduced endothelial adhesiveness by 33 and 55%, respectively.



View larger version (7K):
[in this window]
[in a new window]
 
Fig. 1. Epifluorescent photomicrographs after monocyte adhesion to thoracic aortae derived from apoE-deficient mice treated with vehicle (A) or rosuvastatin (B) (20 mg/kg/day for 6 weeks).

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Enhanced monocyte-endothelial cell interactions in hypercholesterolemia are inhibited by rosuvastatin treatment. Segments of thoracic aortae were harvested from control animals (n = 10), cholesterol animals (n = 10), and rosuvastatin treatment (1, 5, or 20 mg/kg/day; n = 10 each group) at 20 weeks of age. Rosuvastatin animals were treated for either 2 (A) or 6 (B) weeks prior to sacrifice. All values were expressed as a percentage of the normocholesterolemic C57BL/6 animal. *, p < 0.05 from C57BL/6; **, p < 0.01 from C57BL/6; {dagger}, p < 0.05 from 0 mg/kg; {dagger}{dagger}, p < 0.01 from 0 mg/kg.

 

Vascular Gene Expression and Oxidative Signaling. To investigate potential underlying mechanisms that regulate endothelial adhesiveness, we determined the expression levels of known inflammatory mediators. Quantitative RT-PCR indicated that vascular mRNA levels of VCAM-1, MCP-1, and MMP-9 were higher in hypercholesterolemic animals (Fig. 3); rosuvastatin (20 mg/kg) potently inhibited this expression. Hypercholesterolemia is also known to induce an oxidative stress in several different cell types including vascular endothelial and smooth muscle cells. Indeed, it has been demonstrated that reactive oxygen species play an important role in the activation of several atherogenic genes as well as in the process of lipid peroxidation. Analysis of the mRNA levels of p22phox, an important regulatory component of the vascular NAD(P)H oxidase, indicated elevated expression in the setting of hypercholesterolemia (Fig. 4A). To determine whether this was associated with enhanced oxidative stress, oxygen-derived free radical production from vascular segments was analyzed by EPR using TA. As shown in Fig. 4B, hypercholesterolemia induced superoxide production from the vessel wall. In addition, the plasma concentrations of the oxidative marker 8-epi-PGF2{alpha} were also elevated (Fig. 5). Consistent with its role as an anti-inflammatory compound, rosuvastatin reduced both vascular oxidative stress as well as levels of 8-epi-PGF2{alpha}. This response to rosuvastatin was observed after 2 weeks but was more evident with 6 weeks of treatment.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Quantitative RT-PCR results indicate that the enhanced expression of vascular inflammatory genes induced by hypercholesterolemia is reduced by rosuvastatin (20 mg/kg/day; n = 7 per group). *, p < 0.05 from C57BL/6; {dagger}, p < 0.05 from 0 mg/kg. A, VCAM-1; B, MCP-1; C, MMP-9.

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. A, expression of p22phox is modulated by rosuvastatin (20 mg/kg/day; n = 7). B, EPR analysis of vascular tissue using TA indicates that hypercholesterolemia enhances superoxide production; this effect is inhibited by rosuvastatin treatment (20 mg/kg/day for 6 weeks; n = 7). *, p < 0.05 from C57BL/6; {dagger}, p < 0.05 from 0 mg/kg.

 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5. Rosuvastatin attenuates the increase in plasma 8-epi-PGF2{alpha} levels observed in hypercholesterolemia (20 mg/kg/day for 6 weeks; n = 8). *, p < 0.05 from C57BL/6; {dagger}, p < 0.05 from 0 mg/kg.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The current results indicate that rosuvastatin attenuates endothelial adhesiveness for monocytes in hypercholesterolemic mice. This effect is associated with reduced vascular oxidative stress as well as reduced expression of inflammatory molecules essential for monocyte accumulation and atherosclerosis.

The beneficial effects of statins on cardiovascular morbidity and mortality have been demonstrated in several primary and secondary prevention trials. These have included patients with a wide range of plasma cholesterol levels as well as concomitant risk factors. However, post hoc analysis of the West of Scotland Coronary Prevention Study (WOSCOPS) (Anonymous, 1998aGo), a study in which pravastatin was investigated in patients with moderate risk, indicated that some of the beneficial effects of statin treatment may go beyond its effects on cholesterol reduction. Specifically, patients in the treatment arm experienced greater benefit than would be predicted by the Framingham risk model. Furthermore, when pravastatin-treated patients were compared with placebo patients with similar LDL levels at the end of the study, the pravastatin cohort had a much lower risk of cardiovascular events.

These epidemiological findings are bolstered by preclinical animal studies with the same conclusion. One of the most convincing studies was one performed by Williams and colleagues (Williams et al., 1998Go) in cynomologous monkeys placed on high-fat diets. After 2 years, the animals received either low-fat or high-fat diets with pravastatin for an additional 2 years. Animals were closely monitored and diets were modified to produce the same level of total cholesterol, LDL, and HDL in the plasma of both groups. At the end of the study, isolated vessels from the statin-treated animals displayed greater endothelium-dependent vasodilatation. Moreover, histological analysis of vessels indicated reduced atherosclerotic burden as well as less macrophage content in the lesions, suggesting a potential anti-inflammatory effect of statins.

Other animal models also displayed evidence that statins may modulate inflammatory processes. Pretreatment with simvastatin produced a beneficial effect similar to indomethacin in the carrageen-induced footpad model of local inflammation (Sparrow et al., 2001Go). Maggard et al. (1998Go) showed that pravastatin prevented the aggressive coronary vasculopathy in a rat model of heart transplantation. This effect was also associated with reduced inflammatory infiltrate into the lesional areas. In addition, statins can alter the expression and activity of immunomodulatory molecules such as nitric oxide (NO). Peng et al. (1995Go) demonstrated that statins enhance the expression and activity of eNOS, whereas Lefer and colleagues (Lefer et al., 1999Go) found that statins increased coronary flow and reduced neutrophil infiltrate in the isolated perfused rat heart due to enhanced bioactivity of NO. Kline and Scalia (2003Go) also showed that rosuvastatin effectively prevented microcirculation leukocyte-endothelium interactions in the diabetic (db/db) mouse independent of cholesterol or glucose lowering activity. As a radical species, NO is quickly neutralized by other free radicals such as superoxide anion. Thus, the effect of simvastatin upon NO bioavailability could be due to increased NO production or reduced inactivation by reactive oxygen species. Since we detected reduced free radical production from the vessel wall, bioactivity of NO should be increased. Coupled with the ability of rosuvastatin to up-regulate endothelial NOS levels (Laufs et al., 1998Go) the resultant increase in NO bioavailability could help explain the observed effects on endothelial adhesiveness.

Many of the direct effects of statins on inflammatory processes are dependent on their ability to inhibit intracellular HMG-CoA reductase and, thereby, reduce intracellular concentrations of isoprenoid compounds such as farnesyl pyrophosphate and geranylgeranyl pyrophosphate (Laufs and Liao, 1998Go). These isoprenoids are essential for post-translational modification of proteins that allow anchoring to lipid membranes. Signaling molecules whose functions are dependent upon isoprenoid modification include the Rho family of GTPases. Indeed, the effect of statins on eNOS expression and activity is dependent upon inhibition of Rho GTPase geranylgeranylation and is reversible by mevalonate (Laufs and Liao, 1998Go).

Several markers of inflammation have also been used to investigate the potential anti-inflammatory effects of statins in humans. The best known inflammatory marker used in clinical trials is C-reactive protein (CRP). High circulating levels of CRP are indicative of acute as well as chronic inflammatory situations. Indeed, significantly elevated CRP levels have been associated with cardiovascular disease as well as most risk factors for coronary heart disease (Willerson and Ridker, 2004Go). A substudy of the Cholesterol and Recurrent Events (CARE) trial determined that baseline CRP, as well as another marker of inflammation serum amyloid A, were both significantly higher in patients who later developed recurrent nonfatal myocardial infarction or fatal coronary event compared with matched controls who remained event free throughout the study (Ridker et al., 1999Go). Moreover, patients with elevated inflammatory markers had a 2-fold greater benefit from statin therapy than those without chronic inflammation, indicating an added effect of pravastatin.

Longer clinical studies have shown a small but consistent effect of statins to elevate HDL levels (Kjekshus and Pedersen, 1995Go; Downs et al., 1998Go). HDL is thought to have positive effects on atherogenesis by both reducing vascular cholesterol levels (i.e., reverse cholesterol trafficking) as well as by direct anti-inflammatory actions, presumably proteins found in the HDL moiety such as paraoxonase (Durrington et al., 2001Go). This indirect mechanism may not explain the effects of rosuvastatin in the current study since there were not any significant alterations in HDL levels observed. However, we cannot discount a direct effect of rosuvastatin on paraoxonase activity.

Our EPR results indicate for the first time that rosuvastatin can attenuate the enhanced superoxide anion production from vascular segments derived from apoE-deficient mice. Although several enzymatic sources have been implicated in vascular superoxide production, various lines of evidence indicate that the vascular NAD(P)H oxidase plays a significant role (Griendling and Fitzgerald, 2003aGo,bGo; Spiekermann et al., 2003Go). Overexpression of the p22phox subunit of the NAD(P)H oxidase increases vascular smooth muscle cell production of reactive oxygen species (Fukui et al., 1997Go; Griendling and Fitzgerald, 2003aGo). Activation of NAD(P)H oxidase can then stimulate local inflammatory processes leading to leukocyte-endothelial cell interactions (Stokes et al., 2001Go). In the current study, rosuvastatin reduced expression of p22phox and attenuated superoxide production, further implying a role of NAD(P)H oxidase. In support of this idea, Wassman et al. (2002Go) demonstrated that atorvastatin could inhibit angiotensin II-induced superoxide production as well as NAD(P)H oxidase subunit expression in cultured endothelial cells. Membrane translocation of the Rac1 GTPase, another NAD(P)H oxidase subunit required for enzyme activation, was also inhibited by atorvastatin. Reversal of these effects by the addition of mevalonate argues that atorvastatin decreases geranylgeranylation-dependent translocation of Rac1. These results, together with the findings of the current study, indicate that statins can simultaneously modulate several aspects of ROS production in vivo.

Inhibition of cellular oxidative stress is likely to play a pivotal role in rosuvastatin-mediated modulation of local inflammatory processes. Reactive oxygen species can activate nuclear factor-{kappa}B (NF-{kappa}B), a transcription factor that is essential for the transcription of several inflammatory molecules including VCAM-1, MCP-1, macrophage colony stimulating factor, MMP-9, and CRP (Marui et al., 1993Go; Tsao et al., 1997Go; Jovanovic et al., 2000Go; Yao et al., 2000Go; Agrawal et al., 2003Go). Thus, inactivation of ROS production and NF-{kappa}B by rosuvastatin would modulate the expression of several molecules involved with leukocyte trafficking. Moreover, studies by Cammarano and Minden (2001Go) suggest that NF-{kappa}B is activated Rho GTPase, offering another explanation for the anti-inflammatory actions of rosuvastatin.

Statins may also reduce inflammatory gene expression by up-regulating members of the peroxisome proliferator-activated receptor (PPAR) family of nuclear receptors (Inoue et al., 2000Go; Zelvyte et al., 2002Go). Zelvyte and colleagues (Zelvyte et al., 2002Go) demonstrated an increase in PPAR-{gamma} expression after incubation of cultured monocytes with pravastatin. Intriguingly, the promoters of several inflammatory molecules, including VCAM-1 and MMP-9, contain PPAR-{gamma} binding sites. Likewise, Inoue et al. (2000Go) showed that reduced expression of p22phox by statin was dependent upon enhanced expression of PPAR-{alpha}. These findings may have particular importance when statins are used in combination with PPAR agonists for the treatment of diabetes. Fibric acid derivatives (PPAR-{alpha} agonists) and thiazolidinediones (PPAR-{gamma} agonists) are commonly used to reduce triglyceride levels and enhance insulin sensitivity, respectively, in patients with type 2 diabetes. Thus, the combinatorial effects of statins with PPAR agonists upon inflammatory gene transcription may help explain the added benefit of statins in diabetics observed in several large prevention trials (Pyorala et al., 1997Go; Goldberg et al., 1998Go).

In conclusion, we have demonstrated a potent anti-inflammatory effect of rosuvastatin in a murine model of hypercholesterolemia. This effect is associated with reduced vascular oxidative stress and local expression of inflammatory genes. Since many of these effects are directly related to the inhibition of HMG-CoA reductase and since rosuvastatin is considered one of the most effective statin compounds to date, it is presumed that these findings will translate into the clinical realm and have important implications for the role of rosuvastatin in the development of cardiovascular disease.


    Footnotes
 
This work was supported by a grant from AstraZeneca.

doi:10.1124/jpet.104.080002.

ABBREVIATIONS: VCAM-1, vascular cell adhesion molecule-1; MCP-1, monocyte chemotactic protein-1; HMG-CoA, 3-hydroxy-3-methylglutaryl coenzyme A; LDL, low-density lipoprotein; NO, nitric oxide; eNOS, endothelial nitric-oxide synthase; apoE, apolipoprotein E; HBSS, Hanks' balanced salt solution; HDL, high-density lipoprotein; PG, prostaglandin; RT-PCR, real-time polymerase chain reaction; MMP, metalloproteinase; ROS, reactive oxygen species; TA, 4-amino-2,2,6,6,-tetramethylpiperidino-1-oxyl; CRP, C-reactive protein; NF-{kappa}B, nuclear factor of the {kappa}-enhancer in B cells; PPAR, peroxisome proliferator-activated receptor.

Address correspondence to: Dr. Philip S. Tsao, Division of Cardiovascular Medicine, Stanford University School of Medicine, 300 Pasteur Drive, Stanford, CA 94305-5246. E-mail: ptsao{at}stanford.edu


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Agrawal A, Cha-Molstad H, Samols D, and Kushner I (2003) Overexpressed nuclear factor-kappaB can participate in endogenous C-reactive protein induction and enhances the effects of C/EBPbeta and signal transducer and activator of transcription-3. Immunology 108: 539–547.[CrossRef][Medline]

Anonymous (1994) Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet 344: 1383–1389.[CrossRef][Medline]

Anonymous (1998a) Influence of pravastatin and plasma lipids on clinical events in the West of Scotland Coronary Prevention Study (WOSCOPS). Circulation 97: 1440–1445.[Abstract/Free Full Text]

Anonymous (1998b) Prevention of cardiovascular events and death with pravastatin in patients with coronary heart disease and a broad range of initial cholesterol levels. The Long-Term Intervention with Pravastatin in Ischaemic Disease (LIPID) Study Group. N Engl J Med 339: 1349–1357.[Abstract/Free Full Text]

Cammarano MS and Minden A (2001) Dbl and the Rho GTPases activate NF kappa B by I kappa B kinase (IKK)-dependent and IKK-independent pathways. J Biol Chem 276: 25876–25882.[Abstract/Free Full Text]

Downs JR, Clearfield M, Weis S, Whitney E, Shapiro DR, Beere PA, Langendorfer A, Stein EA, Kruyer W, and Gotto AM Jr (1998) Primary prevention of acute coronary events with lovastatin in men and women with average cholesterol levels: results of AFCAPS/TexCAPS. Air Force/Texas Coronary Atherosclerosis Prevention Study. JAMA (J Am Med Assoc) 279: 1615–1622.[Abstract/Free Full Text]

Durrington PN, Mackness B, and Mackness MI (2001) Paraoxonase and atherosclerosis. Arterioscler Thromb Vasc Biol 21: 473–480.[Abstract/Free Full Text]

Fukui T, Ishizaka N, Rajagopalan S, Laursen JB, Capers Q 4th, Taylor WR, Harrison DG, de Leon H, Wilcox JN, and Griendling KK (1997) p22phox mRNA expression and NADPH oxidase activity are increased in aortas from hypertensive rats. Circ Res 80: 45–51.[Abstract/Free Full Text]

Goldberg RB, Mellies MJ, Sacks FM, Moye LA, Howard BV, Howard WJ, Davis BR, Cole TG, Pfeffer MA, and Braunwald E (1998) Cardiovascular events and their reduction with pravastatin in diabetic and glucose-intolerant myocardial infarction survivors with average cholesterol levels: subgroup analyses in the cholesterol and recurrent events (CARE) trial. The Care Investigators. Circulation 98: 2513–2519.[Abstract/Free Full Text]

Griendling KK and Fitzgerald GA (2003a) Oxidative stress and cardiovascular injury. Part I: basic mechanisms and in vivo monitoring of ROS. Circulation 108: 1912–1916.[Free Full Text]

Griendling KK and Fitzgerald GA (2003b) Oxidative stress and cardiovascular injury. Part II: animal and human studies. Circulation 108: 2034–2040.[Free Full Text]

Heart Protection Study Collaborative Group (2002) MRC/BHF Heart Protection Study of cholesterol lowering with simvastatin in 20,536 high-risk individuals: a randomised placebo-controlled trial. Lancet 360: 7–22.[CrossRef][Medline]

Inoue I, Goto S, Mizotani K, Awata T, Mastunaga T, Kawai S, Nakajima T, Hokari S, Komoda T, and Katayama S (2000) Lipophilic HMG-CoA reductase inhibitor has an anti-inflammatory effect: reduction of MRNA levels for interleukin-1beta, interleukin-6, cyclooxygenase-2 and p22phox by regulation of peroxisome proliferator-activated receptor alpha (PPARalpha) in primary endothelial cells. Life Sci 67: 863–876.[CrossRef][Medline]

Jovanovic DV, Martel-Pelletier J, Di Battista JA, Mineau F, Jolicoeur FC, Benderdour M, and Pelletier JP (2000) Stimulation of 92-kd gelatinase (matrix metalloproteinase 9) production by interleukin-17 in human monocyte/macrophages: a possible role in rheumatoid arthritis. Arthritis Rheum 43: 1134–1144.[CrossRef][Medline]

Kallen J, Welzenbach K, Ramage P, Geyl D, Kriwacki R, Legge G, Cottens S, Weitz-Schmidt G, and Hommel U (1999) Structural basis for LFA-1 inhibition upon lovastatin binding to the CD11a I-domain. J Mol Biol 292: 1–9.[CrossRef][Medline]

Kjekshus J and Pedersen TR (1995) Reducing the risk of coronary events: evidence from the Scandinavian Simvastatin Survival Study (4S). Am J Cardiol 76: 64C–68C.[CrossRef][Medline]

Kline R and Scalia R (2003) Rosuvastatin inhibits leukocyte-endothelium interactions in the diabetic microcirculation of db/db mice. FASEB J 17: A1052–A1053.

Laufs U, La Fata V, Plutzky J, and Liao JK (1998) Upregulation of endothelial nitric oxide synthase by HMG CoA reductase inhibitors. Circulation 97: 1129–1135.[Abstract/Free Full Text]

Laufs U and Liao JK (1998) Post-transcriptional regulation of endothelial nitric oxide synthase mRNA stability by Rho GTPase. J Biol Chem 273: 24266–24271.[Abstract/Free Full Text]

Lefer AM, Campbell B, Shin YK, Scalia R, Hayward R, and Lefer DJ (1999) Simvastatin preserves the ischemic-reperfused myocardium in normocholesterolemic rat hearts. Circulation 100: 178–184.[Abstract/Free Full Text]

Maggard MA, Ke B, Wang T, Kaldas F, Seu P, Busuttil RW, and Imagawa DK (1998) Effects of pravastatin on chronic rejection of rat cardiac allografts. Transplantation 65: 149–155.

Marui N, Offermann MK, Swerlick R, Kunsch C, Rosen CA, Ahmad M, Alexander RW, and Medford RM (1993) Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J Clin Investig 92: 1866–1874.

Olsson AG, McTaggart F, and Raza A (2002) Rosuvastatin: a highly effective new HMG-CoA reductase inhibitor. Cardiovasc Drug Rev 20: 303–328.[Medline]

Peng HB, Libby P, and Liao JK (1995) Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF-kappa B. J Biol Chem 270: 14214–14219.[Abstract/Free Full Text]

Pyorala K, Pedersen TR, Kjekshus J, Faergeman O, Olsson AG, and Thorgeirsson G (1997) Cholesterol lowering with simvastatin improves prognosis of diabetic patients with coronary heart disease. A subgroup analysis of the Scandinavian Simvastatin Survival Study (4S). Diabetes Care 20: 614–620.[Abstract]

Ridker PM, Rifai N, Pfeffer MA, Sacks F, and Braunwald E (1999) Long-term effects of pravastatin on plasma concentration of C-reactive protein. The Cholesterol and Recurrent Events (CARE) Investigators. Circulation 100: 230–235.[Abstract/Free Full Text]

Ross R, Glomset J, and Harker L (1977) Response to injury and atherogenesis. Am J Pathol 86: 675–684.[Abstract]

Sparrow CP, Burton CA, Hernandez M, Mundt S, Hassing H, Patel S, Rosa R, Hermanowski-Vosatka A, Wang PR, Zhang D, et al. (2001) Simvastatin has anti-inflammatory and antiatherosclerotic activities independent of plasma cholesterol lowering. Arterioscler Thromb Vasc Biol 21: 115–121.[Abstract/Free Full Text]

Spiekermann S, Landmesser U, Dikalov S, Bredt M, Gamez G, Tatge H, Reepschlager N, Hornig B, Drexler H, and Harrison DG (2003) Electron spin resonance characterization of vascular xanthine and NAD(P)H oxidase activity in patients with coronary artery disease: relation to endothelium-dependent vasodilation. Circulation 107: 1383–1389.[Abstract/Free Full Text]

Stokes KY, Clanton EC, Russell JM, Ross CR, and Granger DN (2001) NAD(P)H oxidase-derived superoxide mediates hypercholesterolemia-induced leukocyte-endothelial cell adhesion. Circ Res 88: 499–505.[Abstract/Free Full Text]

Tsao PS, McEvoy LM, Drexler H, Butcher EC, and Cooke JP (1994) Enhanced endothelial adhesiveness in hypercholesterolemia is attenuated by L-arginine. Circulation 89: 2176–2182.[Abstract/Free Full Text]

Tsao PS, Wang B, Buitrago R, Shyy JY, and Cooke JP (1997) Nitric oxide regulates monocyte chemotactic protein-1. Circulation 96: 934–940.[Abstract/Free Full Text]

Uemura S, Matsushita H, Li W, Glassford AJ, Asagami T, Lee KH, Harrison DG, and Tsao PS (2001) Diabetes mellitus enhances vascular matrix metalloproteinase activity: role of oxidative stress. Circ Res 88: 1291–1298.[Abstract/Free Full Text]

Vasa M, Fichtlscherer S, Adler K, Aicher A, Martin H, Zeiher AM, and Dimmeler S (2001) Increase in circulating endothelial progenitor cells by statin therapy in patients with stable coronary artery disease. Circulation 103: 2885–2890.[Abstract/Free Full Text]

Wassmann S, Laufs U, Muller K, Konkol C, Ahlbory K, Baumer AT, Linz W, Bohm M, and Nickenig G (2002) Cellular antioxidant effects of atorvastatin in vitro and in vivo. Arterioscler Thromb Vasc Biol 22: 300–305.[Abstract/Free Full Text]

Weitz-Schmidt G, Welzenbach K, Brinkmann V, Kamata T, Kallen J, Bruns C, Cottens S, Takada Y, and Hommel U (2001) Statins selectively inhibit leukocyte function antigen-1 by binding to a novel regulatory integrin site. Nat Med 7: 687–692.[CrossRef][Medline]

Willerson JT and Ridker PM (2004) Inflammation as a cardiovascular risk factor. Circulation 109: II2–II10.

Williams JK, Sukhova GK, Herrington DM, and Libby P (1998) Pravastatin has cholesterol-lowering independent effects on the artery wall of atherosclerotic monkeys. J Am Coll Cardiol 31: 684–691.[Abstract/Free Full Text]

Yao GQ, Sun BH, Insogna KL, and Weir EC (2000) Nuclear factor-kappaB p50 is required for tumor necrosis factor-alpha-induced colony-stimulating factor-1 gene expression in osteoblasts. Endocrinology 141: 2914–2922.[Abstract/Free Full Text]

Zelvyte I, Dominaitiene R, Crisby M, and Janciauskiene S (2002) Modulation of inflammatory mediators and PPARgamma and NFkappaB expression by pravastatin in response to lipoproteins in human monocytes in vitro. Pharmacol Res 45: 147–154.[CrossRef][Medline]


This article has been cited by other articles:


Home page
J CARDIOVASC PHARMACOL THERHome page
M. S. Kostapanos, H. J. Milionis, and M. S. Elisaf
An Overview of the Extra-Lipid Effects of Rosuvastatin
Journal of Cardiovascular Pharmacology and Therapeutics, September 1, 2008; 13(3): 157 - 174.
[Abstract] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Dever, C. M. Spickett, S. Kennedy, C. Rush, G. Tennant, A. Monopoli, and C. L. Wainwright
The Nitric Oxide-Donating Pravastatin Derivative, NCX 6550 [(1S-[1{alpha}(betaS*, {delta}S*), 2{alpha}, 6{alpha}, 8beta-(R*), 8a{alpha}]]-1,2,6,7,8,8a-Hexahydro-beta, {delta}, 6-trihydroxy-2-methyl-8-(2-methyl-1-oxobutoxy)-1-naphtalene-heptanoic Acid 4-(Nitrooxy)butyl Ester)], Reduces Splenocyte Adhesion and Reactive Oxygen Species Generation in Normal and Atherosclerotic Mice
J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 419 - 426.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.080002v1
313/2/557    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, W.
Right arrow Articles by Tsao, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, W.
Right arrow Articles by Tsao, P. S.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition